ID: 1142951425

View in Genome Browser
Species Human (GRCh38)
Location 17:3484271-3484293
Sequence CCTAGCACAGGGTTGGTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142951425 Original CRISPR CCTAGCACAGGGTTGGTCTC TGG (reversed) Intronic
903323308 1:22555352-22555374 CCTGGCACAGAGTTGGTCTTCGG - Intergenic
903423966 1:23239268-23239290 CCTACCACAGGATTTGTTTCTGG + Intergenic
904300338 1:29549872-29549894 CCTGGCACAGGGTTGGTGTCTGG + Intergenic
904457897 1:30658243-30658265 CCTGGCACAGGGTTGGTGTGCGG - Intergenic
906059719 1:42940562-42940584 TCTAGCAATGGGTTGTTCTCTGG + Intronic
906472376 1:46141895-46141917 CTTAGCTCTGGGCTGGTCTCTGG + Intronic
906551472 1:46669323-46669345 CCTCGCACAGGGCAGGGCTCAGG - Intronic
906654795 1:47540293-47540315 CCTAGCACAGGACTGGTCAGTGG - Intergenic
907295764 1:53452397-53452419 CCCAGCACAGGTCTGGTATCTGG - Intergenic
907951549 1:59188516-59188538 CCTAGCACAGGGCTGGAATCAGG + Intergenic
908452817 1:64273022-64273044 ACTAGCACAGGCTTGGTCATGGG + Intergenic
910342794 1:86207441-86207463 CCTTGCCAAGAGTTGGTCTCAGG + Intergenic
911440726 1:97922021-97922043 CCTAGCACAGTGTCTGTGTCTGG - Intergenic
915477767 1:156163068-156163090 CCTGGCCGGGGGTTGGTCTCAGG - Exonic
915528579 1:156490573-156490595 CCTAGGGCAGGGGTGGTCTCAGG + Intronic
916037134 1:160932397-160932419 ACTGGGTCAGGGTTGGTCTCTGG + Intergenic
916233785 1:162565094-162565116 CCCAGCACAGGCCTGGGCTCAGG - Intronic
916272493 1:162958217-162958239 CCTAGCACAGAATAGGACTCTGG + Intergenic
916568125 1:166000219-166000241 CCTAGCACAGGGTCTGGCACAGG + Intergenic
916572505 1:166039956-166039978 CCTGTCACAGTGATGGTCTCTGG + Intergenic
918272882 1:182920241-182920263 CACAGCACAGGTTTGTTCTCTGG - Intronic
918807046 1:189061569-189061591 CCTAGCAGACAGTAGGTCTCAGG + Intergenic
921851876 1:219940208-219940230 CCTTGCACTAGGGTGGTCTCAGG - Intronic
922344114 1:224681763-224681785 CCACATACAGGGTTGGTCTCTGG - Intronic
1062842520 10:681950-681972 CTGAGCAGAGGCTTGGTCTCTGG - Intronic
1064281302 10:13954044-13954066 CCTAGCACAGGGCTGGATCCTGG - Intronic
1067101368 10:43337049-43337071 CATAGCACAGTGTTGGTCACGGG - Intergenic
1067450077 10:46376675-46376697 CTTAGCACAGCGATGGCCTCAGG - Intronic
1067587165 10:47483088-47483110 CTTAGCACAGCGATGGCCTCAGG + Intronic
1067634224 10:47990855-47990877 CTTAGCACAGCGATGGCCTCAGG + Intergenic
1068081426 10:52322596-52322618 CCTTGCTCAGGATTGGTCTTTGG - Intergenic
1071161750 10:82754688-82754710 CATAGAACAGGATTGGTCTCTGG - Intronic
1071725024 10:88190061-88190083 CCAAACACAGGGTTGATCCCAGG - Intergenic
1071984959 10:91041105-91041127 CCTAGCTCTGGCTTGGCCTCTGG - Intergenic
1073268749 10:102244185-102244207 CGTAGCACACGGATGGTCTTTGG + Intergenic
1073624342 10:105081421-105081443 CTTTGCAAAGGGTTGGTTTCTGG + Intronic
1074152668 10:110771455-110771477 CCTAGCACATGGTAGGTGTGTGG - Intronic
1076797172 10:132803998-132804020 CCAAGCACAGGGCTGGGCCCTGG - Intergenic
1081863766 11:46348460-46348482 CCTAGCAGAGGGATGGGCTGGGG - Intronic
1083846949 11:65340956-65340978 CCTGCCACAGGATTGGCCTCCGG + Exonic
1084538781 11:69774301-69774323 GCTAGCGCAGGCTTGGGCTCCGG - Intronic
1084694212 11:70744218-70744240 CAAGGCACAGGGTGGGTCTCTGG + Intronic
1086169629 11:83821063-83821085 CCTAGCACTGGGTTAGGTTCTGG + Intronic
1088459371 11:110066490-110066512 CCTAACATAGGGTAGGTTTCTGG - Intergenic
1088577194 11:111283783-111283805 CCTAGCACAGCGCCGGTCACCGG + Intronic
1091692497 12:2606513-2606535 CCTAGCACAGTGCTGGGCTATGG + Intronic
1092052437 12:5481146-5481168 GCTAGCGCCGGGATGGTCTCTGG + Intronic
1093165613 12:15801904-15801926 CCAAGCACAGGGATGGGCCCTGG + Intronic
1096006370 12:48175990-48176012 AATAGCACAGAGCTGGTCTCAGG + Intronic
1097940658 12:65301048-65301070 CCTAGCTCAGGGTTGATGTGAGG + Intronic
1100568698 12:95825197-95825219 CCTAGCACAGAGTAGGTCCTGGG - Intergenic
1103796301 12:123505566-123505588 CCTAGCACTTGGTGGGACTCAGG - Intronic
1104057598 12:125242563-125242585 CCTAGCACTGGGATGTCCTCAGG - Intronic
1106549349 13:30758055-30758077 CCGAGGCCAGGTTTGGTCTCTGG - Intronic
1114087239 14:19242673-19242695 TCGAGCACAGGGTGTGTCTCGGG - Intergenic
1114656276 14:24317455-24317477 CCTGGCACAGGGTGGGGCTGAGG + Exonic
1120877399 14:89387727-89387749 CTTAGGACAGAGTTGGTCTGGGG + Intronic
1121410530 14:93745676-93745698 CCCAGCACAGGGCTGGAGTCAGG - Intronic
1121912227 14:97802027-97802049 CCTAGTACAGTGTTGGGCACAGG - Intergenic
1122735050 14:103833971-103833993 CTTAGGACATTGTTGGTCTCTGG - Intronic
1124576158 15:30910145-30910167 CCTAGGCCAAGGTTGGTGTCGGG + Intronic
1130022700 15:80244401-80244423 CCCAACACAGGGTTGGTCATGGG + Intergenic
1131021038 15:89099035-89099057 CCTGGCACAGGGAGGGTCCCTGG + Intronic
1132839927 16:1973985-1974007 CCTAGCACAGGGCGGGGCCCTGG + Intronic
1132851122 16:2025516-2025538 CCAAGCACAGGGCTCGCCTCTGG - Intronic
1134230760 16:12427651-12427673 CCTGGCACAGGCATTGTCTCTGG - Intronic
1134343139 16:13363717-13363739 CCTAGCACAGCGCTGGCTTCAGG + Intergenic
1134569625 16:15280172-15280194 GATAGCACAGGGTTGGTGTGAGG - Intergenic
1134732754 16:16475877-16475899 GATAGCACAGGGTTGGTGTGAGG + Intergenic
1134934688 16:18236091-18236113 GATAGCACAGGGTTGGTGTGAGG - Intergenic
1135954484 16:26944869-26944891 CTTTCCACAGGGTTGATCTCAGG - Intergenic
1138537725 16:57668605-57668627 CCTTGCTCAGGACTGGTCTCAGG + Intronic
1139824301 16:69745075-69745097 CAGAGCACAAGGTGGGTCTCGGG + Intronic
1141428472 16:83958381-83958403 CCTAGCACAGTGCTGGGCACAGG - Intronic
1142951425 17:3484271-3484293 CCTAGCACAGGGTTGGTCTCTGG - Intronic
1144506276 17:15834012-15834034 TCTGACACAGGGTTGGGCTCTGG + Intergenic
1144802553 17:17940474-17940496 CCCAGCTCAGGGATGGACTCTGG + Intronic
1145170451 17:20651945-20651967 TCTGACACAGGGTTGGGCTCTGG + Intergenic
1146241981 17:31238329-31238351 CCTAGCAAAGGTTTGCCCTCAGG + Intronic
1146280509 17:31541370-31541392 CCAAGCACTGGGTTAGCCTCAGG - Intergenic
1146449244 17:32959338-32959360 CCAAGCAGTGGGTTGGGCTCAGG + Intergenic
1148591361 17:48818564-48818586 CCTAGCTCCTGTTTGGTCTCCGG + Intergenic
1149638318 17:58187213-58187235 CCCACCACAGGGTTGGGCCCAGG - Intergenic
1151289423 17:73138844-73138866 GCTAGCACTGGGCTGGTATCTGG - Intergenic
1151529374 17:74694942-74694964 CCTAGCTCTGGGTTGGGCTTGGG - Exonic
1153524219 18:5979432-5979454 CCCAGCACAGGCTTGTTCCCTGG - Intronic
1153624042 18:7006277-7006299 CCTAGGCCAAGATTGGTCTCGGG - Intronic
1159284853 18:66336304-66336326 CCCAGCCCAGGGTGGGTCTGGGG + Intergenic
1160869716 19:1271650-1271672 CCAAGCACAGGGGTGGTTGCGGG + Intronic
1160950624 19:1665594-1665616 CCTAGCAGAGGCTGGGCCTCTGG + Intergenic
1163684011 19:18700369-18700391 CCAAGCACCGTGGTGGTCTCTGG - Intronic
1167557308 19:50204279-50204301 CCCAGCACACAGTTGGTCTCTGG - Intronic
1168719942 19:58549382-58549404 ATAAGCACAGGTTTGGTCTCAGG - Exonic
925348488 2:3186210-3186232 CCAAGCAAAGTGTTGGTTTCCGG - Intergenic
926352740 2:12011665-12011687 ACTAGCACAGTGTTGACCTCAGG - Intergenic
928919963 2:36516596-36516618 CCAAGCACATGTTTAGTCTCAGG + Intronic
936067970 2:109346528-109346550 TCTAGCACAGGATTGACCTCTGG + Intronic
936072449 2:109380375-109380397 CCTGGCACAGGGTGGGGCCCAGG + Intronic
937166075 2:119818823-119818845 CCTAGGACAGAGTTTGTCTAGGG + Intronic
943093775 2:183404679-183404701 GTTAGCACAGGGTTGGGCACTGG + Intergenic
947536662 2:230943991-230944013 CCTAACACAGGGTCTGTCTTAGG + Intronic
947877537 2:233477667-233477689 CCTGGCACAGGGCTGGTGGCAGG - Intronic
948756800 2:240164816-240164838 CCCAGCACAGGGCTGGGCACAGG + Intergenic
1168836288 20:879893-879915 GCTAGCACAGGCCTGGCCTCTGG - Intronic
1169032079 20:2417425-2417447 CCAAGCACAGGGCCAGTCTCAGG - Exonic
1169685423 20:8266377-8266399 GCTAGCACTGGGTTTTTCTCAGG + Intronic
1173563242 20:44021138-44021160 CCTAGGACAGGGGAGGTATCAGG + Intronic
1173673290 20:44812529-44812551 CCTAGCACAGTGCTGGCCTTCGG + Intergenic
1177243442 21:18491323-18491345 CCTAGCACTTAGTAGGTCTCTGG - Intergenic
1178643448 21:34365201-34365223 CCTAGCACAGGCTGGGCCCCTGG - Intronic
1179281955 21:39941326-39941348 CCAAACACAGAGTTGTTCTCAGG - Intergenic
1181667191 22:24406469-24406491 CCAAGCACAGAGCTGGTCTGTGG + Intronic
1181926144 22:26360343-26360365 TTTAGCACAGGTTTGGTATCAGG + Intronic
1183270141 22:36856912-36856934 CCTAGCACACAGTGGGTGTCTGG + Intergenic
1183292268 22:37010144-37010166 CCAAGGACAGACTTGGTCTCCGG + Intergenic
1184064220 22:42107150-42107172 CCTAGCACAGGCTCTGCCTCTGG - Intergenic
1184164477 22:42719782-42719804 CCGAGCACCTGGTGGGTCTCAGG - Intronic
952184288 3:30952068-30952090 CCAAGCACAGGGTTGAGCTCTGG + Intergenic
952884455 3:38003910-38003932 CCTGGCAGAGAGTAGGTCTCCGG - Intronic
954269345 3:49495409-49495431 CCTAGCACAGGGTAGGTAGTTGG + Intronic
954535515 3:51356613-51356635 CCTAGCACAGGGTTGACCTGTGG - Intronic
954847811 3:53575074-53575096 CCTGGCACATGGTTGGCCTGGGG + Intronic
956304447 3:67808796-67808818 CCTAGGACAGGGTGTGTCACGGG + Intergenic
961380936 3:126496198-126496220 CCTAGCTCAGTGGTGGGCTCGGG - Intronic
962842763 3:139251055-139251077 CCCACCACAGGCTTGGCCTCGGG + Intronic
962895393 3:139709378-139709400 CCTAGTGCAGGGCTGGGCTCAGG + Intergenic
963066515 3:141268810-141268832 CGTAGCTCAGGGGTGGGCTCAGG + Intronic
965435596 3:168646810-168646832 CCTGGGACAGGGTTCATCTCAGG + Intergenic
965827841 3:172748746-172748768 CCTAGCAGAGGGCTGGTGTCTGG - Intergenic
966516867 3:180829140-180829162 ACTAGCCCAGGGGTGGGCTCTGG + Intronic
969035655 4:4251411-4251433 CCTAGGACGGGGTCAGTCTCTGG - Intergenic
971316517 4:25572421-25572443 GCTAGGGCAGGGTGGGTCTCTGG + Intergenic
971860025 4:32090273-32090295 CGTAGGACAGGCTTGGTGTCAGG - Intergenic
973206300 4:47564225-47564247 CCAAGCACAAGGTAGGTTTCTGG - Intronic
976203106 4:82599096-82599118 CCTAGCCCAGGGTTGGTAGGAGG - Intergenic
977171440 4:93767606-93767628 TCTGGTAGAGGGTTGGTCTCAGG - Intronic
981975493 4:150723154-150723176 CCTAGTGCTGGGTTGGGCTCAGG + Intronic
985763762 5:1765643-1765665 CCTTCGACTGGGTTGGTCTCTGG - Intergenic
985826740 5:2197533-2197555 CCTATCAAAGGGTTGTGCTCAGG - Intergenic
985941453 5:3139765-3139787 CCTATCACAGGGTGGGTCTGTGG - Intergenic
989751140 5:44895392-44895414 CCTAGCACTGTGCTGGTTTCAGG - Intergenic
990066089 5:51716575-51716597 ACTATCACAGAGTTGGCCTCAGG - Intergenic
994135676 5:96283657-96283679 CCGAGGACAGGGCTGGACTCAGG - Intergenic
995323087 5:110859212-110859234 CCTAGCTCTGGCTTGGTCTTTGG - Intergenic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
996638966 5:125730017-125730039 CCTTGCACAGTGTGGCTCTCAGG - Intergenic
996749666 5:126875777-126875799 CCTAGCAGAGTGTTGGCCCCAGG - Intronic
1001928509 5:175656985-175657007 CCTGGCACAGGGCTGGTCCATGG + Intergenic
1006293390 6:33158121-33158143 CCTATAACAGGCTTGGACTCCGG - Intergenic
1006580279 6:35073116-35073138 CCTAGCACAGTGCTGGACTGTGG + Intronic
1011733378 6:90289350-90289372 CCTAGCCCTGGGTTGTTCTGAGG + Intronic
1021195091 7:17665682-17665704 CCTGGCACAGCCTTGGTCTAGGG - Intergenic
1021272993 7:18615313-18615335 CCTATCACAGAGTTGGTATTTGG + Intronic
1024510845 7:50203716-50203738 GTTAGCACTGGGGTGGTCTCTGG - Intergenic
1025810217 7:64870862-64870884 TCTGGCCCAGGGTTGGCCTCAGG - Intronic
1026965003 7:74433970-74433992 CCCAGGACAGGGTAGGTCTGGGG - Intergenic
1027351939 7:77321074-77321096 CCTGGCACATGGTTGGTGACAGG - Intronic
1029923551 7:104291716-104291738 CTTAGCACAGGGATGGGCTCTGG - Intergenic
1035391561 7:158507972-158507994 CCTAGCACGGGGCTGTTCCCCGG - Intronic
1038414608 8:27385197-27385219 GCTAGCCCAGGGTTGGGCTACGG + Intronic
1040952909 8:52954043-52954065 CTTCCCACAGGGTTGGGCTCGGG + Intergenic
1041628299 8:60056205-60056227 CTTAGTACAGGCTTGGTGTCAGG - Intergenic
1042275025 8:66995568-66995590 CCAAGCACTGGGCTGGGCTCTGG + Intronic
1049418626 8:142506920-142506942 CCTGGCTCAGGATGGGTCTCAGG + Intronic
1051581480 9:18680495-18680517 GCTGGCACAGGAGTGGTCTCCGG + Exonic
1055468364 9:76587689-76587711 ACTAGCAGAGGGTGAGTCTCTGG + Intergenic
1057138762 9:92714173-92714195 CCCAGCACCGGGCTGGGCTCTGG + Exonic
1062302672 9:135884115-135884137 CCTAGCAGAGTGTTGGGCGCGGG - Intronic
1190889874 X:54558663-54558685 CAGAGCACAGGGTTGGTCTGGGG - Intronic
1190991597 X:55556491-55556513 CCTACCACAGGGTTAATCCCAGG + Intergenic
1193150708 X:78121549-78121571 CCTAGCATAGGGTTTCTCACTGG + Intronic
1199806673 X:151307021-151307043 TCTACCACAGGGCTGGTCTGAGG - Intergenic