ID: 1142953688

View in Genome Browser
Species Human (GRCh38)
Location 17:3505581-3505603
Sequence CCATGGGACTCTCAGGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 248}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142953688_1142953706 30 Left 1142953688 17:3505581-3505603 CCTGAAGCCTGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 31
4: 248
Right 1142953706 17:3505634-3505656 CATGGATGTTCCAGGGCAGCAGG 0: 1
1: 0
2: 0
3: 17
4: 211
1142953688_1142953702 12 Left 1142953688 17:3505581-3505603 CCTGAAGCCTGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 31
4: 248
Right 1142953702 17:3505616-3505638 AGAGAGGCCTATACGGGTCATGG 0: 1
1: 0
2: 0
3: 3
4: 61
1142953688_1142953698 -4 Left 1142953688 17:3505581-3505603 CCTGAAGCCTGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 31
4: 248
Right 1142953698 17:3505600-3505622 ATGGGGGTGACCAGGGAGAGAGG 0: 1
1: 0
2: 3
3: 56
4: 584
1142953688_1142953705 23 Left 1142953688 17:3505581-3505603 CCTGAAGCCTGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 31
4: 248
Right 1142953705 17:3505627-3505649 TACGGGTCATGGATGTTCCAGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1142953688_1142953699 5 Left 1142953688 17:3505581-3505603 CCTGAAGCCTGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 31
4: 248
Right 1142953699 17:3505609-3505631 ACCAGGGAGAGAGGCCTATACGG 0: 1
1: 0
2: 0
3: 15
4: 180
1142953688_1142953701 6 Left 1142953688 17:3505581-3505603 CCTGAAGCCTGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 31
4: 248
Right 1142953701 17:3505610-3505632 CCAGGGAGAGAGGCCTATACGGG 0: 1
1: 0
2: 0
3: 14
4: 211
1142953688_1142953704 22 Left 1142953688 17:3505581-3505603 CCTGAAGCCTGAGAGTCCCATGG 0: 1
1: 0
2: 1
3: 31
4: 248
Right 1142953704 17:3505626-3505648 ATACGGGTCATGGATGTTCCAGG 0: 1
1: 0
2: 0
3: 2
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142953688 Original CRISPR CCATGGGACTCTCAGGCTTC AGG (reversed) Intronic
900142975 1:1146216-1146238 CCATGGCACTCCCAGGCTGGGGG - Intergenic
900309994 1:2029037-2029059 CCATGGGACTCAGGGGCTGCAGG - Intronic
900339356 1:2180776-2180798 GCATGGGACTCCCAGGCTCCTGG - Intronic
900417885 1:2543400-2543422 CCAGGGGAGACTCTGGCTTCTGG + Intergenic
900486697 1:2926070-2926092 CCACAGGACTCTCAGCCTGCTGG + Intergenic
901316594 1:8314158-8314180 CCATCCAAGTCTCAGGCTTCTGG + Intergenic
901494462 1:9613343-9613365 CCTTGGGGCTCCCTGGCTTCGGG - Exonic
902105915 1:14035945-14035967 CCTTGGCAGGCTCAGGCTTCAGG + Intergenic
902206704 1:14873592-14873614 CCAGGGGCCTTTCAGGCTTTTGG + Intronic
902700325 1:18167831-18167853 CCAGGGCACTCTCAGGTTCCCGG + Intronic
902813414 1:18902393-18902415 CCCAGTGACTCTCAGGCTCCCGG + Intronic
904510174 1:30998710-30998732 CCATAGGAATCTCAAACTTCAGG - Intronic
904671669 1:32170855-32170877 CCATGGGGGCCTCAGGCTGCTGG - Exonic
905892444 1:41525910-41525932 CCAGTGGCCTCTCAGGCTTCAGG - Intronic
906082253 1:43101093-43101115 CCATGGGCCACAGAGGCTTCTGG - Intergenic
906769946 1:48474969-48474991 CCATGTGGCTATCAGGCTTTTGG - Intergenic
907300013 1:53481235-53481257 CTTTGGGGCTCTCTGGCTTCTGG - Intergenic
908930714 1:69313316-69313338 CCATGTGGCTCTCAGGCCGCAGG + Intergenic
913435429 1:118842657-118842679 CCATCGGCCCCTCTGGCTTCTGG - Intergenic
913960294 1:143333942-143333964 CCATGGGACCCTCGGGCTCTGGG + Intergenic
914054650 1:144159515-144159537 CCATGGGACCCTCGGGCTCTGGG + Intergenic
914124496 1:144806846-144806868 CCATGGGACCCTCGGGCTCTGGG - Intergenic
914229952 1:145756687-145756709 CCATGATTCTCTCTGGCTTCTGG + Intronic
915021678 1:152785911-152785933 CCATGGAACTCATTGGCTTCTGG - Intronic
915755618 1:158256791-158256813 CCATGGGACAGCCAGGCCTCGGG - Exonic
916422522 1:164650180-164650202 CCACTGGACTCTTAGGCATCTGG + Intronic
916822179 1:168410276-168410298 ACATGGCACTCTGAGGCTCCAGG - Intergenic
916842492 1:168614412-168614434 CCATGAGATTCCCAGGCTGCAGG + Intergenic
917396768 1:174601977-174601999 CCATATCACTCTCAGGCTTTTGG + Intronic
918656065 1:187027720-187027742 CCCTGGGGATCTCAGGCATCTGG + Intergenic
921494393 1:215820744-215820766 CCATGACCCTCTCAGGCCTCTGG + Intronic
921610307 1:217205932-217205954 CCATACCACTATCAGGCTTCTGG - Intergenic
923262861 1:232284081-232284103 CCAAGGGACACTGAGGCTTCTGG - Intergenic
923270231 1:232348742-232348764 ACTTGGGACTCTCAGGAGTCTGG - Intergenic
923476930 1:234342879-234342901 CGATGGGACTCTCAGGGAGCAGG + Intergenic
924204784 1:241700519-241700541 ACAGGTGACTGTCAGGCTTCTGG + Intronic
1065833267 10:29633912-29633934 CCTTGGTACTCTCATTCTTCAGG - Intronic
1067942841 10:50670537-50670559 CCATGGAAACCTGAGGCTTCGGG - Intergenic
1069996056 10:72342856-72342878 ACATGGCAGTCTCTGGCTTCAGG - Intronic
1070432773 10:76357885-76357907 CCATGGGACTGTGAGGCCTCCGG + Intronic
1070494327 10:77007983-77008005 CCTGGGGACTCTCTGGCTCCAGG + Intronic
1070617616 10:77981103-77981125 CCATGGGACTCTCTGGGCTTTGG + Intronic
1070864085 10:79695501-79695523 CCATGGGAACCTGAGGCTTCGGG - Intergenic
1071630982 10:87217727-87217749 CCATGGAAACCTGAGGCTTCGGG - Intergenic
1071719696 10:88131062-88131084 GCCTGGGACTCTCTGGCTTTAGG - Intergenic
1073323824 10:102631161-102631183 CCCTGGGCCTCCCAGCCTTCAGG + Exonic
1073445688 10:103579017-103579039 AAATGGGACTCTCAGGCTGACGG + Intronic
1074390801 10:113056626-113056648 CCAGGGGACTCTGAGGATTTAGG + Intronic
1075455481 10:122582214-122582236 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075456530 10:122588574-122588596 CCATGGTCCTCCCTGGCTTCTGG - Intronic
1075457604 10:122594917-122594939 GCATGGGCCTCTCTGCCTTCTGG - Intronic
1075674684 10:124288073-124288095 CCATGGGACCCACAGCCCTCAGG + Intergenic
1076407148 10:130220234-130220256 CCAATGGCCTCTCAGGCCTCAGG - Intergenic
1077315274 11:1916891-1916913 CCAGGGGCCTCTTAGGCTGCAGG - Intergenic
1077865622 11:6218914-6218936 GCATAAGACTCTGAGGCTTCAGG + Intronic
1078010280 11:7568238-7568260 CCCTGGGACTGTCTGTCTTCTGG - Intronic
1078307653 11:10206142-10206164 GGAGGGGACTCTCAGGCTACAGG - Intronic
1081668680 11:44931400-44931422 CCAGGGGCATCCCAGGCTTCTGG + Exonic
1081855413 11:46300245-46300267 CTCTGGGAGTCTCAGGCTGCAGG - Intronic
1081942800 11:46958819-46958841 CCCTGGGACACCAAGGCTTCTGG - Intronic
1083007138 11:59357013-59357035 CCCTGGGAGGCTCAGGCCTCAGG - Intergenic
1083603178 11:63961478-63961500 CCATGGGCCTCTCTTGTTTCTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084424934 11:69079381-69079403 CCAGGGGGCTCTCAGGCACCAGG + Intronic
1085216444 11:74836917-74836939 GGATGGGTCACTCAGGCTTCTGG - Exonic
1085767460 11:79295530-79295552 ACATGGGACACTCAGGTTCCAGG + Intronic
1086018869 11:82201138-82201160 CTATGGGGCTGTAAGGCTTCGGG - Intergenic
1087377698 11:97365859-97365881 CCTTGAGACTTTCTGGCTTCCGG + Intergenic
1090079649 11:123603419-123603441 CCTTGGGACACAGAGGCTTCAGG - Exonic
1090327037 11:125897538-125897560 CCATTTGACTCTCAGGTTGCTGG - Intronic
1090431556 11:126650637-126650659 CCATATCACTATCAGGCTTCTGG + Intronic
1090721108 11:129474058-129474080 CCATGATACTCGCAGGCTTAAGG - Intergenic
1094483420 12:30903849-30903871 TCATGGGACTCTCTGGCCTATGG - Intergenic
1095737068 12:45569001-45569023 CCTTGGGACTCTGAAGCTTGTGG + Intergenic
1096513226 12:52143377-52143399 TCATGCGACTCTCAGGTTTCTGG - Intergenic
1101471785 12:105004015-105004037 CCAAGGGAGTCTCAGGCTAATGG + Intronic
1101809923 12:108098730-108098752 CCATATGACTCTCAGGTTTCTGG - Intergenic
1102425284 12:112839051-112839073 CCTTGTGAGTCTCAGGCATCTGG + Intronic
1103448181 12:121008566-121008588 CTTTGTGACTCTCTGGCTTCAGG - Intronic
1106381793 13:29246370-29246392 CCATGGGCCTCTTCTGCTTCTGG - Intronic
1106473585 13:30078716-30078738 CCATGAGACCCTCAGGTCTCAGG + Intergenic
1107094032 13:36515483-36515505 CTGTGGTAGTCTCAGGCTTCAGG - Intergenic
1109024781 13:57143087-57143109 TCAGGGGAAGCTCAGGCTTCAGG - Exonic
1109025768 13:57149657-57149679 TCAGGGGAAGCTCAGGCTTCAGG - Exonic
1109026758 13:57156230-57156252 TCAGGGGAAGCTCAGGCTTCAGG - Exonic
1109027750 13:57162801-57162823 TCAGGGGAAGCTCAGGCTTCAGG - Exonic
1109028736 13:57169366-57169388 TCAGGGGAAGCTCAGGCTTCAGG - Exonic
1110168271 13:72469642-72469664 GCCTGGGACTCTCAGGCCTTCGG + Intergenic
1112307244 13:98286129-98286151 CCATGGGCCACGCAGGTTTCTGG - Intronic
1113542399 13:111119077-111119099 CCAGGCCACTCTCAGGCTTCTGG + Intronic
1113805218 13:113107898-113107920 CCCTGGGACACTCACACTTCTGG - Intronic
1113805684 13:113109175-113109197 CCCTGGGACACTCACACTTCTGG - Intronic
1114616939 14:24073314-24073336 CCACTGGACTCTCAGTCCTCCGG - Intronic
1117828418 14:59727036-59727058 ACATGGGCGTCTCAGGCTCCAGG + Exonic
1121067311 14:90980477-90980499 CCATGTGACACACAGGCTGCTGG + Intronic
1122790006 14:104180218-104180240 CCAGGGGTCTTTCAGGATTCAGG + Intronic
1123919433 15:25060137-25060159 CCATGGGCATCTCACGGTTCAGG - Intergenic
1123931006 15:25171651-25171673 CCCTGGGACTCGCTGGCTTTGGG + Intergenic
1125539305 15:40460581-40460603 GCATGGGCCTCTCAGGTGTCTGG - Intronic
1128659089 15:69484753-69484775 CCATGGTTCCCTCAGGATTCTGG + Intergenic
1129057421 15:72830892-72830914 CCATGCGTCTCCCTGGCTTCTGG + Intergenic
1129714587 15:77839766-77839788 ACAGGGGACTCCCAGGCTACTGG - Intergenic
1129929514 15:79398767-79398789 CCATGGGATGCTCAGACATCTGG - Intronic
1133332028 16:4980807-4980829 CAAGGAGACGCTCAGGCTTCAGG - Intronic
1133357224 16:5145439-5145461 CCATCGTATTCTCAGCCTTCAGG + Intergenic
1133358224 16:5152803-5152825 CCATGGGACACACAGGCTTGTGG + Intergenic
1136077464 16:27826800-27826822 CCATGTGACTCTCAGCCTTGAGG - Intronic
1136633041 16:31500322-31500344 CCATGGAAAGCACAGGCTTCAGG + Intronic
1139294024 16:65884455-65884477 CCCTGGGGCTCCCAGGCTTATGG - Intergenic
1140236347 16:73162378-73162400 ACATGGGACTCTTTGGCTGCAGG + Intergenic
1140416190 16:74775130-74775152 GCATGGGACCCTCTGGCTCCAGG + Intergenic
1141172521 16:81700384-81700406 CTCTGGGAGTCTCAGGCTTCTGG - Intronic
1141172529 16:81700424-81700446 CTCTGGGAGTCTCAGGCTTCTGG - Intronic
1142118052 16:88370634-88370656 CCAGGAGACTCACACGCTTCAGG - Intergenic
1142953688 17:3505581-3505603 CCATGGGACTCTCAGGCTTCAGG - Intronic
1143779305 17:9221051-9221073 CCATGGGTATCACAGGCCTCTGG + Intronic
1146637697 17:34518493-34518515 CCTGGGGACTCTGAGGCTGCTGG + Intergenic
1146830109 17:36061638-36061660 CCATTGCTTTCTCAGGCTTCTGG - Intergenic
1147132049 17:38415411-38415433 CCATCCGGCTCTCAGGCCTCGGG - Intergenic
1147672745 17:42185881-42185903 CCTGGGGACTGTCAGGCTCCAGG + Intergenic
1148818032 17:50345023-50345045 CCATGGGCCTGCCAGGCTTAGGG + Intergenic
1148825200 17:50387990-50388012 CCAGTGGATTCTCATGCTTCAGG - Intronic
1149082362 17:52674334-52674356 ACATGTCACTCTCAGACTTCTGG + Intergenic
1150441674 17:65196654-65196676 CCATGGCACACCCTGGCTTCTGG - Intronic
1151492178 17:74439337-74439359 CCCTGGGACTTTCAGGCTTCAGG - Intronic
1152420261 17:80188972-80188994 CCCTGGGAGTTTCAGGCTGCAGG + Intronic
1154411336 18:14143679-14143701 CCATGGCACTCACTGCCTTCTGG + Intergenic
1155078735 18:22386907-22386929 CCAAGTCACTCTCAGACTTCTGG + Intergenic
1155145246 18:23078047-23078069 CCATGAGTCCCTCTGGCTTCTGG + Intergenic
1157454548 18:47814213-47814235 TCCTGTGACTGTCAGGCTTCAGG - Exonic
1161410666 19:4115425-4115447 GCCAGGGACCCTCAGGCTTCTGG - Intronic
1161840974 19:6680099-6680121 ACCTGGGACTCTCAGGCCCCTGG + Intronic
1164753288 19:30671495-30671517 CCAAGTGACTCTGGGGCTTCAGG + Intronic
1165222292 19:34326170-34326192 CTGTGAGACTCTTAGGCTTCAGG + Intronic
1165285597 19:34839126-34839148 GCAGGGGACTCTCGAGCTTCGGG + Intergenic
1166530915 19:43543029-43543051 CCTGGGGACGCTGAGGCTTCAGG + Exonic
1167101685 19:47407588-47407610 CCAAGGGAGCCTCAGGCTTGGGG + Intronic
1168605745 19:57758819-57758841 CTGTGGGACTCACAGGCTTGTGG - Intergenic
1168669049 19:58227619-58227641 CCACGGCACTCTCCGCCTTCCGG - Intergenic
1202694131 1_KI270712v1_random:112193-112215 CCATGGGACCCTCGGGCTCTGGG + Intergenic
925614062 2:5728794-5728816 CCATGGGGAGCACAGGCTTCAGG + Intergenic
926275278 2:11398936-11398958 CCATGTGCCTCTCCTGCTTCAGG + Intergenic
926635013 2:15169500-15169522 TCAAGGGCCTCTCAGGGTTCTGG - Intronic
926841933 2:17090304-17090326 CAATGAGACTCTCAGGCTCAAGG + Intergenic
929278171 2:40048050-40048072 CCTTGAGGCTCTGAGGCTTCAGG + Intergenic
933004741 2:76977538-76977560 CCTTGGAAATCACAGGCTTCTGG - Intronic
933952429 2:87342382-87342404 CCATGGGACCCTCGGGCTCTGGG - Intergenic
934558450 2:95299863-95299885 CGTTGGTACCCTCAGGCTTCTGG - Intronic
935400336 2:102653696-102653718 GCATGGGTCTCTGAGGCTGCTGG + Intronic
937620244 2:123977012-123977034 CCAGGGGGCTCTCAGGCATTTGG - Intergenic
937975803 2:127581553-127581575 CCTTTAGACTCTCAGCCTTCAGG + Intronic
938310321 2:130285123-130285145 CTCTGGGGCTCCCAGGCTTCGGG + Intergenic
938444610 2:131367246-131367268 CCCTGGGGCTCCCAGGCTTCGGG - Intergenic
939198301 2:139001414-139001436 CCATGAGCCTCTGAGGCTCCTGG + Intergenic
939260924 2:139807636-139807658 CCATGGAAATCTGGGGCTTCAGG + Intergenic
939959786 2:148556312-148556334 GCATGGGACTCTCTGGCTGGTGG + Intergenic
940248699 2:151648937-151648959 ACATGGAGCTCTCAGGCCTCAGG - Intronic
946025782 2:216670929-216670951 ACATGGCTCTCTCAGGCTACCGG - Intergenic
946058178 2:216919268-216919290 CCATAGGACTGGCAAGCTTCTGG - Intergenic
947903458 2:233742194-233742216 TCAGGGGACTCACAGCCTTCAGG + Intronic
948706749 2:239798831-239798853 CAGTGGAACTCTCAGGGTTCTGG - Intronic
1168742075 20:200506-200528 CCATGAGACTTTCTGGCTTCAGG - Intergenic
1168924135 20:1565880-1565902 CCATGGGACTCCTAGGCCACTGG + Intronic
1169016371 20:2296105-2296127 CCAGGGGAAGCACAGGCTTCTGG - Intronic
1170004076 20:11646757-11646779 CCCTCGGCCTCTCAGGCTTGGGG + Intergenic
1170474492 20:16701391-16701413 CCATTGGACTCTTGGCCTTCAGG + Intergenic
1170857176 20:20068090-20068112 CCATGGGAACCTCAGGATGCTGG - Intronic
1172841571 20:37905286-37905308 GAATGGGACTCTGAGGCTTATGG + Intronic
1174527591 20:51186044-51186066 GCCTGGGCCTCTCAGTCTTCTGG - Intergenic
1174694170 20:52540836-52540858 AAAGGTGACTCTCAGGCTTCTGG - Intergenic
1174704883 20:52644998-52645020 GCCTGGCACTCTCAGGATTCAGG + Intergenic
1175171943 20:57086791-57086813 CCATGGCACCATCAGCCTTCGGG - Intergenic
1175225233 20:57440685-57440707 CCATGGGGTCCTCAGGCCTCAGG - Intergenic
1176051735 20:63123460-63123482 CCATGAGACTCTCCAGCATCTGG - Intergenic
1176861721 21:14014738-14014760 CCATGGCACTCACTGCCTTCTGG - Intergenic
1177196776 21:17911694-17911716 CCATACCACTCTGAGGCTTCAGG - Intronic
1179106421 21:38404588-38404610 CCATGTGTCTCTCAGGGCTCGGG - Intronic
1179463828 21:41557456-41557478 CCATGAGGCTCTCGGTCTTCAGG - Intergenic
1179466862 21:41581620-41581642 CCCTGGGACTCCCTGGCTCCTGG - Intergenic
1179777497 21:43675750-43675772 CCATGCAGCTCTCAGGCTGCGGG - Intronic
1180703776 22:17796392-17796414 GGATGGCACTCTCCGGCTTCAGG + Intronic
1181048642 22:20228340-20228362 CCATGGGACTCTGGGGCCTTTGG + Intergenic
1182435598 22:30327396-30327418 CAATGGGACTGCCAGACTTCTGG - Intergenic
1182508697 22:30803397-30803419 CCTTGTGACTGTCTGGCTTCTGG - Intronic
1184474781 22:44714538-44714560 CCAGGGGGCTCTCAGACCTCAGG + Intronic
1185112048 22:48905558-48905580 CCATGGGACACTCATCCTTGGGG - Intergenic
1185366880 22:50440928-50440950 CCATGGCACTCGCTGCCTTCTGG - Exonic
950888155 3:16378702-16378724 CCCTGGTGCTCTCAGGCTTAGGG + Intronic
953839767 3:46380177-46380199 CCATGGAACTCTCACCCTTCAGG - Intergenic
954214015 3:49114398-49114420 CCAGCAAACTCTCAGGCTTCAGG + Intronic
957062745 3:75495392-75495414 CCATGGGACATGCAGGCTTGTGG + Intergenic
957129365 3:76203446-76203468 CCATGAGATTCTCAGGCTGTCGG + Intronic
957129409 3:76203751-76203773 CCATGAGATTCTCAGGCTAGCGG + Intronic
958617605 3:96515334-96515356 CTCTGGAACTCTCTGGCTTCAGG + Intergenic
958653066 3:96962908-96962930 CCTTGGGAGTCTGAGGCTTGCGG + Intronic
958898378 3:99856145-99856167 TCATAGGACTCTCAGGATTAAGG + Intronic
958981539 3:100726132-100726154 CCAGGGGACTCTCAGGCCTTTGG - Intronic
960480209 3:118179018-118179040 CCTTGGGCCTCCCAGTCTTCAGG - Intergenic
961290653 3:125844024-125844046 CCATGGGACATGCAGGCTTGTGG - Intergenic
961348243 3:126278704-126278726 CCAGGGAGCTCCCAGGCTTCTGG + Intergenic
961494557 3:127282140-127282162 TCAGGGGAAGCTCAGGCTTCAGG + Intergenic
962476736 3:135761595-135761617 CCATGGGGCCCTTAGACTTCAGG + Intergenic
963349379 3:144134141-144134163 CCTTGGGCCTCTCTGGCTGCAGG - Intergenic
965458284 3:168930613-168930635 CCATGTCACTATCAGGCTTTTGG + Intergenic
967015772 3:185480400-185480422 CAATGGGAATCTCTGGCGTCTGG - Exonic
969006644 4:4025525-4025547 CCGTGGGACACTCAGGCTTGTGG + Intergenic
969504354 4:7574959-7574981 CAATGGGGCTCTCAGGCATCTGG - Intronic
970101039 4:12523361-12523383 CCCTTGGGCTCTCAGGCTTGTGG - Intergenic
971053329 4:22885701-22885723 CCTTGGGACTCTCAGGCAGAAGG - Intergenic
976497365 4:85745933-85745955 CCACTGGACTGTCAGGCTACAGG - Intronic
978150091 4:105424195-105424217 CCATGAAACTTTGAGGCTTCAGG + Exonic
978689018 4:111484131-111484153 CCAAGGTACTCTCAGGCCTCTGG - Intergenic
979106944 4:116701246-116701268 CCAAGGGACTCTCAGGCCTTTGG - Intergenic
980339539 4:131526452-131526474 GCATGGGGCCCGCAGGCTTCAGG - Intergenic
981734437 4:147934368-147934390 CTGTGGGAATCTCAGGATTCAGG - Intronic
982099981 4:151958301-151958323 CCATGGGCATCTCAGGCTGCTGG + Intergenic
985563287 5:602700-602722 ACGCAGGACTCTCAGGCTTCTGG + Intergenic
985767326 5:1786932-1786954 CCTTGGGACTCACAGGCCTCAGG - Intergenic
986833541 5:11608868-11608890 CCAAGGGTATCTGAGGCTTCTGG + Intronic
992816956 5:80451636-80451658 CCCAGGGAATCTCAAGCTTCTGG - Exonic
993872497 5:93268523-93268545 CCATCAGCTTCTCAGGCTTCGGG + Intergenic
997814219 5:137000425-137000447 TCATGGCATTCTCAGGCTGCTGG + Intronic
998370491 5:141657739-141657761 CCAGAGGACTCCCAGGTTTCTGG + Intronic
998867135 5:146516633-146516655 CCATGAGACTCTGATGCTGCAGG + Intergenic
999545735 5:152626343-152626365 CCCTGGGGCTCTCAGGCCTTTGG + Intergenic
999891840 5:155986477-155986499 CCATGCTCATCTCAGGCTTCTGG - Intronic
1001569003 5:172718058-172718080 CCAGAGGGCTCTGAGGCTTCTGG - Intergenic
1004223626 6:13767716-13767738 CCATGGGACTTTCCCGGTTCTGG - Intergenic
1008439816 6:51520173-51520195 CCAAGGGACTCTCAGGCTCTGGG + Intergenic
1008470833 6:51882593-51882615 CCATTGGTCTCTTAGGCTTCAGG - Intronic
1013279390 6:108621693-108621715 CCATGCCACTGTGAGGCTTCAGG - Intronic
1015629052 6:135212906-135212928 GCATGGGGCTCCCAGGCTTCAGG + Intronic
1019410123 7:903084-903106 CCGTGGGAGTCGCAGGCTCCTGG + Intronic
1019647912 7:2140761-2140783 CCCTGGGACCCACTGGCTTCTGG + Intronic
1027200552 7:76061435-76061457 CCATGGAACTCTAAGGCCTGGGG - Intronic
1027608536 7:80330494-80330516 CCATGGGTCTCTCACATTTCTGG - Intergenic
1029744894 7:102511384-102511406 CTATGGGACTCTCAGGGGACAGG + Intronic
1029762886 7:102610546-102610568 CTATGGGACTCTCAGGGGACAGG + Intronic
1032417147 7:131744560-131744582 CCATGGGTCTACCTGGCTTCAGG - Intergenic
1032500295 7:132394937-132394959 CCTGGGGATTCTCAGCCTTCAGG + Intronic
1032751688 7:134847572-134847594 CCATGGGACTCCCAGCGTTCTGG + Intronic
1032787897 7:135215428-135215450 CCATGGCACTCTCTGGTTTCTGG - Intergenic
1033305698 7:140223821-140223843 CCATGGGGCTGCCAGGCTCCAGG + Intergenic
1035074659 7:156169649-156169671 CATTGTGCCTCTCAGGCTTCCGG + Intergenic
1035862284 8:3042139-3042161 CCAGGGGTCTCTCATGCATCTGG + Intronic
1036038646 8:5048606-5048628 CCACTGGCCTCTCAGACTTCTGG + Intergenic
1036246142 8:7118624-7118646 CCATGTGAATCTCAGGTTTGTGG + Intergenic
1036895734 8:12633516-12633538 CCATGTGAATCTCAGCTTTCTGG - Intergenic
1039847028 8:41332804-41332826 AAATGGAAGTCTCAGGCTTCAGG - Intergenic
1044830258 8:96240679-96240701 TCACAGGTCTCTCAGGCTTCAGG - Intronic
1045180486 8:99775987-99776009 CCATGGGACCCTCATTCTTCTGG + Intronic
1046458338 8:114499337-114499359 CCAGGGGACTCTAATGCTGCTGG - Intergenic
1049098292 8:140561639-140561661 CCATGGTGTTCTCAGTCTTCAGG - Intronic
1049640680 8:143713768-143713790 CCTTGTGACTCTGGGGCTTCTGG + Intronic
1051437657 9:17050087-17050109 CCATGGGCCTCAGAGGCTACAGG - Intergenic
1051779102 9:20669355-20669377 CCAAGTGCTTCTCAGGCTTCTGG - Intronic
1053854287 9:42321839-42321861 CTGTGGGACTCTCAGGTTGCTGG + Intergenic
1054569935 9:66799819-66799841 CTGTGGGACTCTCAGGTTGCTGG - Intergenic
1055351646 9:75394959-75394981 TCATGGGGCTCCCAGGCTGCTGG - Intergenic
1055640870 9:78317989-78318011 CCCTGGGGCTCTCAGGCTTTGGG + Intronic
1059206564 9:112472621-112472643 CCATTGGAATCTCTGCCTTCTGG + Intronic
1059533849 9:115062999-115063021 CCATGGAAATCCCAGGCCTCAGG - Exonic
1059968916 9:119644343-119644365 CCATGGGAAACTCAGGGTTTTGG - Intergenic
1060300022 9:122369719-122369741 CCCTGGGGCTCTCAGGGTGCCGG - Intergenic
1061667902 9:132170947-132170969 CCATGGGACCCACAGACCTCTGG - Intronic
1062456882 9:136644222-136644244 CCGTGTGACTCGCAGGATTCAGG + Intergenic
1185769136 X:2751936-2751958 CAATGGGCATCTCAGGCTTCTGG - Intergenic
1186408712 X:9326970-9326992 CCATGGGACTATTTGACTTCTGG - Intergenic
1188786546 X:34353466-34353488 CCAAGGGGCTCTCGGGCTTTTGG + Intergenic
1188862092 X:35270276-35270298 CCCTTGGGCTCTCAGGCTTTGGG - Intergenic
1189190360 X:39096550-39096572 CCATGGGACACTGATGCTGCTGG + Intergenic
1189213100 X:39301266-39301288 CCATGGGACTCTCTGATGTCTGG - Intergenic
1189264518 X:39703484-39703506 CAATGGGCCTCTGAGGCTTGGGG - Intergenic
1189318989 X:40075901-40075923 CCCTGGGCCTGTCAGGCTTGGGG + Intronic
1191269479 X:58444980-58445002 CCATGGGGGTCTCTGCCTTCTGG + Intergenic
1192853447 X:74981642-74981664 CAGTGGGACTACCAGGCTTCAGG - Intergenic
1195090194 X:101451084-101451106 TCATGTGACCCTCAGTCTTCTGG + Intronic
1196307117 X:114116778-114116800 CCAAGCTAGTCTCAGGCTTCTGG + Intergenic
1197112911 X:122797650-122797672 CCCTGAGACTTTCTGGCTTCAGG + Intergenic
1197903031 X:131393565-131393587 CCAGTGGCCTCTCAGGCTTAAGG - Intronic
1201301370 Y:12507686-12507708 CAATGGGCATCTCAGGCTTCTGG + Intergenic