ID: 1142956864

View in Genome Browser
Species Human (GRCh38)
Location 17:3528547-3528569
Sequence CTGTAAATATAGAACTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1307
Summary {0: 1, 1: 0, 2: 0, 3: 61, 4: 1245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142956864_1142956866 -5 Left 1142956864 17:3528547-3528569 CCCAGCTAGTTCTATATTTACAG 0: 1
1: 0
2: 0
3: 61
4: 1245
Right 1142956866 17:3528565-3528587 TACAGACAGAGACCCTGTGCAGG 0: 1
1: 0
2: 2
3: 16
4: 241
1142956864_1142956867 -4 Left 1142956864 17:3528547-3528569 CCCAGCTAGTTCTATATTTACAG 0: 1
1: 0
2: 0
3: 61
4: 1245
Right 1142956867 17:3528566-3528588 ACAGACAGAGACCCTGTGCAGGG 0: 1
1: 0
2: 8
3: 79
4: 870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142956864 Original CRISPR CTGTAAATATAGAACTAGCT GGG (reversed) Intronic
900342735 1:2196395-2196417 CTATAAATAAAAAATTAGCTGGG + Intronic
901227667 1:7623657-7623679 CTGAAAATACAGAATTAGCTGGG - Intronic
901285648 1:8076582-8076604 CTAAAAATACAGAATTAGCTGGG + Intergenic
901310326 1:8264525-8264547 CTAAAAATACAAAACTAGCTGGG - Intergenic
901502254 1:9660074-9660096 CTGAAAGTACAAAACTAGCTGGG - Intronic
901707057 1:11081919-11081941 CTGGAAATACAAAATTAGCTGGG + Intronic
901897893 1:12330252-12330274 CTAAAAATACAAAACTAGCTGGG + Intronic
901924611 1:12558024-12558046 CTAAAAATACAAAACTAGCTGGG + Intergenic
902037463 1:13468048-13468070 CTAAAAATATAAAACTAGCCAGG + Intergenic
902440543 1:16426739-16426761 CTAAAAATATAAAACTAGCTGGG - Intronic
902582321 1:17415905-17415927 CTGAAAATACAAAACTAGCCGGG + Intronic
902601399 1:17541804-17541826 CTAAAAATATAAAATTAGCTGGG + Intronic
903116415 1:21182128-21182150 CTGAAAATACAAAATTAGCTGGG - Intergenic
903631900 1:24780924-24780946 CTAAAAATACAAAACTAGCTGGG + Intronic
904010321 1:27386000-27386022 CTGAAAATACAAAACTAGCTGGG - Intergenic
904096909 1:27986202-27986224 CTAAAAATATAAAATTAGCTGGG + Intronic
904135261 1:28307353-28307375 CTAAAAATATAAAATTAGCTGGG + Intergenic
904166495 1:28559465-28559487 CTGAAAATACAAAATTAGCTGGG + Intronic
904217385 1:28932578-28932600 CTGAAAATATATAACTAGTTTGG - Intronic
904238530 1:29129232-29129254 CTAAAAATACAGAAATAGCTGGG - Intergenic
904414075 1:30344891-30344913 GTGTAATTTTAGAACTAGCTTGG + Intergenic
904759016 1:32787947-32787969 CTGAAAATAAAAAATTAGCTGGG + Intronic
904791833 1:33028340-33028362 CTGAAAATACAAAATTAGCTGGG + Intronic
904793002 1:33037674-33037696 CTGAAAATACAAAATTAGCTGGG + Intronic
905097118 1:35482588-35482610 CTAAAAATACAAAACTAGCTGGG - Intronic
905624851 1:39482632-39482654 CTAAAAATACAGAATTAGCTGGG + Intronic
905937634 1:41837485-41837507 CTATAAATATAAAATTAGCGGGG - Intronic
906030137 1:42712849-42712871 CTAAAAATACAGAATTAGCTGGG - Intergenic
906167071 1:43694353-43694375 CTAAAAATATAAAATTAGCTGGG + Intronic
906256327 1:44353726-44353748 CTGTAAATAATCAGCTAGCTAGG - Intronic
906426033 1:45713397-45713419 CTAAAAATATAAAACTAGCCAGG + Intronic
906881134 1:49592407-49592429 CTGAAAATACAAAATTAGCTGGG + Intronic
906932995 1:50187932-50187954 CTAAAAATATAAAATTAGCTGGG + Intronic
907023373 1:51090421-51090443 CTGAAAATATAAAACTAGCCAGG + Intergenic
907176045 1:52523442-52523464 CTAAAAATATAGAATTAGCCAGG + Intronic
907215294 1:52858464-52858486 CTAAAAATAAAAAACTAGCTGGG - Intronic
907753365 1:57285224-57285246 CTGTGAGTAAAGAGCTAGCTTGG - Intronic
908233878 1:62132007-62132029 CTGAAAATATAAAATTAGCCAGG - Intronic
908303821 1:62790073-62790095 CTAAAAATACAAAACTAGCTGGG - Intronic
909040741 1:70646546-70646568 CTATATATATACACCTAGCTAGG + Intergenic
909375910 1:74941725-74941747 CTGTAAATACAGAATTAGCCGGG + Intergenic
909654116 1:78011643-78011665 CTATAAATACAAAATTAGCTGGG - Intronic
910142717 1:84043992-84044014 CTGAAAATACAAAATTAGCTGGG + Intergenic
910148796 1:84115719-84115741 CTAAAAATATAAAATTAGCTGGG + Intronic
910317363 1:85901647-85901669 CTAAAAATATAAAATTAGCTGGG + Intronic
910415997 1:86999337-86999359 CTGAAAATACAAAATTAGCTGGG - Intronic
910572670 1:88723272-88723294 CTGAAAATATAAAATTAGCTGGG - Intronic
910810519 1:91230915-91230937 CTAAAAATATAAAATTAGCTGGG - Intergenic
910896539 1:92075877-92075899 CTGAAAATACAAAATTAGCTGGG - Intergenic
911012954 1:93300733-93300755 CTAAAAATATAAAATTAGCTGGG + Intergenic
911071979 1:93839130-93839152 CTAAAAATATAAAATTAGCTGGG + Intronic
911603509 1:99873593-99873615 CTAAAAATACAGAATTAGCTGGG - Intronic
911640038 1:100278708-100278730 TGGTAAATCTAGAACTAGTTGGG + Intronic
911725018 1:101233930-101233952 CTAAAAATACAAAACTAGCTGGG + Intergenic
912250176 1:108003178-108003200 CTAAAAATATATAATTAGCTGGG + Intergenic
912389074 1:109289312-109289334 CTAAAAATACAAAACTAGCTGGG - Intergenic
913066140 1:115257150-115257172 CTGTAAATCTAGAGCCATCTAGG + Intergenic
913292574 1:117287588-117287610 CTAAAAATATATAATTAGCTGGG + Intergenic
914228809 1:145745616-145745638 CTAAAAATATAAAATTAGCTGGG - Exonic
914712115 1:150223904-150223926 CTATAAATACAAAATTAGCTGGG - Intronic
914760952 1:150597800-150597822 CTGAAAATACAAAATTAGCTGGG + Intergenic
914840152 1:151241637-151241659 CTAAAAATATAAAATTAGCTGGG + Intronic
915060846 1:153183246-153183268 CTGAAAATACAAAATTAGCTGGG - Intergenic
915150432 1:153826465-153826487 CTAAAAATACAAAACTAGCTGGG + Intronic
915171295 1:153979385-153979407 CTAAAAATACAGAATTAGCTGGG + Intergenic
915179597 1:154046895-154046917 CTGAAAATACAAAATTAGCTGGG + Intronic
915186392 1:154108937-154108959 CTAAAAATATAAAATTAGCTGGG + Intronic
915337480 1:155154104-155154126 CTAAAAATAAAAAACTAGCTGGG + Intergenic
916032154 1:160886668-160886690 CTAAAAATATAAAATTAGCTGGG + Intergenic
916143285 1:161718300-161718322 CTAAAAATACAAAACTAGCTAGG + Intergenic
916173645 1:162020685-162020707 CTGAAAATACAAAATTAGCTGGG - Intronic
916740635 1:167644316-167644338 CTGAAAATACAAAATTAGCTGGG + Intronic
917133643 1:171766868-171766890 CTAAAAATATAAAATTAGCTGGG + Intergenic
917405845 1:174708011-174708033 CTCTAAAAATTGAACTATCTGGG - Intronic
918228395 1:182508458-182508480 CTAAAAATACAAAACTAGCTGGG - Intronic
918302086 1:183213902-183213924 CTAAAAATACAAAACTAGCTGGG + Intronic
919217657 1:194580339-194580361 CTGAAAATACAAAATTAGCTGGG + Intergenic
919269333 1:195318765-195318787 CTCTAAATACAAAATTAGCTGGG - Intergenic
919709427 1:200711132-200711154 CTAAAAATATAGAATTAGCTGGG + Intergenic
919842055 1:201616646-201616668 CTGAAAATACAAAATTAGCTGGG - Intergenic
920157192 1:203963082-203963104 CTAAAAATACAAAACTAGCTGGG + Intergenic
920238648 1:204527490-204527512 CTAAAAATACAAAACTAGCTTGG + Intronic
920330096 1:205201064-205201086 CTGAAAATACAAAACTAGCCGGG - Intronic
920384816 1:205563658-205563680 CTGAAAATACAAAATTAGCTAGG - Intergenic
920828648 1:209446011-209446033 CTAAAAATACAAAACTAGCTTGG + Intergenic
920836823 1:209518853-209518875 CTGAAAGTATAGAAGCAGCTTGG + Intergenic
921113574 1:212064051-212064073 CTAAAAATACATAACTAGCTGGG - Intronic
921173686 1:212572354-212572376 CTAAAAATATAAAATTAGCTGGG + Intronic
921223582 1:212994118-212994140 CTGAAAATACAAAATTAGCTGGG + Exonic
921381272 1:214526928-214526950 CTAAAAATATAAAATTAGCTGGG + Intronic
921907183 1:220507440-220507462 CTAAAAATACAAAACTAGCTGGG + Intergenic
921918218 1:220637516-220637538 CTAAAAATATAAAATTAGCTGGG + Intronic
922316071 1:224443289-224443311 TTGTAAATATAAACCTAGCTAGG - Intronic
922418577 1:225443982-225444004 CTAAAAATACAGAATTAGCTTGG - Intergenic
922452518 1:225748385-225748407 CTGAAAATATAAAATTAGCTGGG - Intergenic
922993351 1:229935219-229935241 CTAAAAATATAAAATTAGCTGGG + Intergenic
923508072 1:234624000-234624022 CTGTGAATCTAAAACTACCTGGG + Intergenic
923642441 1:235778533-235778555 CTAAAAATATAAAATTAGCTGGG - Intronic
923892587 1:238232624-238232646 CTGAAACTATAAAATTAGCTAGG - Intergenic
924068150 1:240247339-240247361 CTGTAAATACAAAATTGGCTGGG + Intronic
924111445 1:240703657-240703679 CTGAAAATACAAAACTAGCCAGG - Intergenic
924555797 1:245117582-245117604 CTAAAAATACAGAATTAGCTGGG - Intronic
924878707 1:248134504-248134526 CTGTAAAAATAAAACAAGATAGG + Intergenic
924901982 1:248410955-248410977 ATGAAAATATAGAAGTGGCTTGG + Intergenic
1063641650 10:7836433-7836455 CTGAAAATACAAAATTAGCTGGG - Intronic
1063644300 10:7863447-7863469 CTGAAAATACAAAATTAGCTGGG + Intronic
1063805127 10:9630420-9630442 CTAAAAATACAAAACTAGCTGGG + Intergenic
1063829306 10:9933661-9933683 GAGTAAATAGAGAACTAGGTTGG - Intergenic
1064186482 10:13166472-13166494 CTGAAAATACAAAATTAGCTGGG + Intronic
1064391966 10:14950177-14950199 CTAAAAATATAAAATTAGCTGGG + Intronic
1064408089 10:15082123-15082145 CTGAAAATACAAAATTAGCTGGG + Intronic
1064562120 10:16604104-16604126 CTGCCAACACAGAACTAGCTGGG + Intronic
1064608662 10:17073605-17073627 CTAAAAATACAAAACTAGCTGGG - Intronic
1064999889 10:21328856-21328878 CTGAAAATACAAAATTAGCTGGG - Intergenic
1065029447 10:21570068-21570090 CTGAAAATACAAAATTAGCTGGG - Intronic
1065303637 10:24348190-24348212 CTGAAAATACAAAATTAGCTGGG + Intronic
1065504360 10:26414564-26414586 CTGAAAATACAAAATTAGCTGGG + Intergenic
1065620620 10:27577259-27577281 CTGAAAATACAAAATTAGCTGGG + Intergenic
1065958453 10:30713788-30713810 CTGAAAATACAAAATTAGCTGGG - Intergenic
1066127209 10:32352992-32353014 CTAAAAATATAAAATTAGCTGGG + Intronic
1067096962 10:43307732-43307754 CTGAAAATACAAAATTAGCTGGG + Intergenic
1067202167 10:44182486-44182508 CTAAAAATACAGAATTAGCTGGG + Intergenic
1067347884 10:45450750-45450772 CTAAAAATATAAAATTAGCTAGG + Intergenic
1067579914 10:47437554-47437576 CTAAAAATACAAAACTAGCTGGG - Intergenic
1068222254 10:54058853-54058875 CTGAAAATATAAAATTAGCTGGG - Intronic
1069163960 10:65125997-65126019 CTAAAAATATAAAATTAGCTGGG - Intergenic
1069270805 10:66524886-66524908 CTGAAAATACAAAATTAGCTGGG + Intronic
1069959496 10:72071348-72071370 CTGAAAATACAAAATTAGCTGGG - Intronic
1069978760 10:72237398-72237420 CTATAAATACAAAATTAGCTGGG + Intergenic
1070019509 10:72570104-72570126 CTAAAAATATAAAATTAGCTGGG - Intronic
1070038892 10:72755307-72755329 CTAAAAATACAAAACTAGCTGGG - Intronic
1070178174 10:73990259-73990281 CTGAAAATACAAAATTAGCTGGG - Intergenic
1070204614 10:74244154-74244176 CTATAAATAGTGAAGTAGCTTGG - Intronic
1071548699 10:86549163-86549185 CTGAAAATACAAAATTAGCTGGG - Intergenic
1072077320 10:91990631-91990653 CTAAAAATATATAATTAGCTGGG + Intronic
1072123227 10:92422398-92422420 CTATAAATAAAAAATTAGCTGGG + Intergenic
1072195025 10:93110171-93110193 CTAAAAATACAAAACTAGCTGGG - Intergenic
1072230227 10:93408374-93408396 CTGAAAATATAAAATTAGCCAGG + Intronic
1072434808 10:95405283-95405305 CTTTAAAAAAAAAACTAGCTGGG + Intronic
1072536942 10:96371158-96371180 CTGAAAATACAAAATTAGCTAGG + Intronic
1072559119 10:96553873-96553895 ATGTAAATAAAGAAATAACTGGG - Intronic
1072649756 10:97285679-97285701 CTAAAAATATAAAATTAGCTGGG - Intronic
1072699070 10:97626916-97626938 CTGAAAATACAAAATTAGCTGGG - Intronic
1073172189 10:101519832-101519854 CTAAAAATACAGAATTAGCTGGG + Intronic
1073202377 10:101746214-101746236 CTGAAAATACAAAATTAGCTGGG - Intergenic
1073238014 10:102035073-102035095 CTGAAAATACAAAAATAGCTGGG + Intronic
1073244739 10:102081771-102081793 CTGAAAATACAAAATTAGCTGGG - Intergenic
1073538218 10:104296938-104296960 CTGAAAATACAAAATTAGCTGGG - Intronic
1073838736 10:107473913-107473935 CTGAAAATGTAGAAGTAGGTAGG + Intergenic
1074167344 10:110894946-110894968 GTGTAAATAGAGAAGTAGATGGG + Intronic
1074281058 10:112052020-112052042 TTTTAAATATAAAACTGGCTGGG - Intergenic
1074325824 10:112449590-112449612 CTAAAAATACAAAACTAGCTGGG + Intronic
1074477069 10:113783072-113783094 CTAAAAATACAAAACTAGCTGGG + Intronic
1074569130 10:114608506-114608528 CTGAAAATACAAAATTAGCTGGG + Intronic
1074716618 10:116225748-116225770 CTAAAAATATAAAATTAGCTGGG - Intronic
1075674297 10:124285419-124285441 CTAAAAATATAAAATTAGCTGGG + Intergenic
1075755000 10:124803738-124803760 CTGAAAATATAAAATTAGCCAGG + Intronic
1075860628 10:125673547-125673569 CTATAAATACAAAATTAGCTGGG + Intronic
1076391118 10:130103137-130103159 CTAAAAATACAGAATTAGCTGGG - Intergenic
1077070597 11:669473-669495 CTGAAAATACAAAATTAGCTGGG + Intronic
1077120724 11:906865-906887 CTGAAAATACAAAATTAGCTGGG + Intronic
1078247852 11:9592391-9592413 CTAAAAATACAAAACTAGCTGGG + Intronic
1078326326 11:10384212-10384234 CTAAAAATACAAAACTAGCTGGG - Intronic
1078444273 11:11392456-11392478 CTAAAAATACAAAACTAGCTGGG + Intronic
1078481627 11:11681259-11681281 CTAAAAATACAAAACTAGCTGGG + Intergenic
1078841938 11:15085331-15085353 CTAAAAATATAAAATTAGCTGGG + Intergenic
1079065837 11:17291383-17291405 CTAAAAATATAAAACTAGCTGGG + Intronic
1079511392 11:21215362-21215384 CTGCTAATAAAGAACTAGCTGGG - Intronic
1079636738 11:22751667-22751689 CTGTGAACCTAGAAGTAGCTAGG + Intronic
1079763476 11:24358947-24358969 CTAAAAATATAAAATTAGCTGGG + Intergenic
1079791870 11:24748618-24748640 CTGAAAATACAAAATTAGCTGGG - Intronic
1080131822 11:28804699-28804721 CTGTGAAGATAAAACTAGTTAGG + Intergenic
1080310823 11:30889779-30889801 CTGTAAATAAAGAAATGGCATGG - Intronic
1080434943 11:32231214-32231236 CTAAAAATACAAAACTAGCTGGG - Intergenic
1080525541 11:33113044-33113066 CTAAAAATATAAAATTAGCTGGG + Intronic
1081055792 11:38409253-38409275 CTGAAAATACAAAACTAGCCAGG - Intergenic
1081184177 11:40021770-40021792 CTAAAAATACAAAACTAGCTGGG + Intergenic
1081440896 11:43079627-43079649 CTATAAATTTAGAGCTGGCTGGG + Intergenic
1081721656 11:45294014-45294036 CTGAAAATACAAAATTAGCTGGG - Intergenic
1081830739 11:46110944-46110966 CTGAAAATAGAAAATTAGCTGGG - Intronic
1081835133 11:46147174-46147196 CTAAAAATATAAAATTAGCTGGG + Intergenic
1081874377 11:46398637-46398659 CTAAAAATATAAAATTAGCTGGG - Intronic
1081908396 11:46683799-46683821 CTGAAAATACAAAATTAGCTGGG - Intronic
1082049749 11:47761429-47761451 CTAAAAATATAAAATTAGCTGGG + Intronic
1082049814 11:47761997-47762019 CTAAAAATACAAAACTAGCTGGG - Intronic
1082863243 11:57874752-57874774 CTGAAAATACAAAATTAGCTGGG + Intergenic
1083056073 11:59821266-59821288 ATGAAAATATACAACCAGCTGGG - Intergenic
1083565462 11:63711723-63711745 CTAAAAATACAAAACTAGCTGGG - Intronic
1083608818 11:63995355-63995377 CTGAAAATATAAAATTAGCTCGG - Intronic
1083834696 11:65258364-65258386 CTAAAAATACAAAACTAGCTGGG + Intergenic
1083850326 11:65362174-65362196 CTGAAAATATAAAACTAGCCAGG - Intergenic
1084081309 11:66827209-66827231 CTGAAAATACAAAATTAGCTGGG - Intronic
1084140602 11:67225767-67225789 CTCTAAATAAATAAATAGCTGGG + Intronic
1084160252 11:67344786-67344808 CTAAAAATATAAAATTAGCTGGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084695605 11:70752950-70752972 CTAAAAATATAAAATTAGCTGGG + Intronic
1084762287 11:71281586-71281608 CTGAAAATACAAAATTAGCTGGG - Intergenic
1084950898 11:72664965-72664987 CTAAAAATACAGAATTAGCTGGG - Intronic
1085273682 11:75284740-75284762 CTATAAATACAAAAATAGCTGGG + Intronic
1085358692 11:75865124-75865146 CTAAAAATATAAAATTAGCTGGG + Intronic
1086137060 11:83452380-83452402 CTAAAAATACAAAACTAGCTGGG - Intergenic
1086340869 11:85846893-85846915 CTGAAAATACAAAATTAGCTGGG - Intergenic
1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG + Exonic
1086729398 11:90228876-90228898 CTGAAAATGTAGAAACAGCTTGG - Intergenic
1087478073 11:98662724-98662746 CTGAAAATACAAAATTAGCTGGG + Intergenic
1087760470 11:102099668-102099690 CTGAAAATACAAAATTAGCTGGG + Intergenic
1087760730 11:102101897-102101919 CTGAAAATACAAAATTAGCTTGG + Intergenic
1087876552 11:103365198-103365220 CTGAAAATACAAAATTAGCTGGG + Intronic
1088178873 11:107086275-107086297 CTGAAAATATAAAATTAGCCTGG + Intergenic
1088254859 11:107893836-107893858 CTAAAAATAAAGAATTAGCTGGG + Intronic
1088267379 11:108000710-108000732 CTAAAAATATAAAATTAGCTGGG + Intergenic
1088823987 11:113478310-113478332 CTGAAAATACAAAATTAGCTGGG - Intergenic
1089522751 11:119076363-119076385 CTAAAAATACAAAACTAGCTGGG + Intronic
1089663170 11:119998942-119998964 CTGAAAATACAAAATTAGCTGGG - Intergenic
1089717126 11:120371325-120371347 CTAAAAATACAGAATTAGCTGGG + Intronic
1090008500 11:123024069-123024091 CTGAAAATACAAAATTAGCTAGG + Intergenic
1090219742 11:125009055-125009077 CTAAAAATACAAAACTAGCTGGG + Intronic
1090279575 11:125444422-125444444 CTAAAAATATAAAATTAGCTGGG + Intergenic
1090548229 11:127789574-127789596 CTGAAAATACAAAATTAGCTGGG + Intergenic
1090843945 11:130515626-130515648 CTACAAATGTAGAAATAGCTTGG + Intergenic
1091276070 11:134351504-134351526 CTGAAAATACAAAATTAGCTGGG - Intronic
1091310139 11:134567732-134567754 CTAAAAATACAAAACTAGCTGGG - Intergenic
1091702491 12:2673303-2673325 CTAAAAATATAAAATTAGCTGGG + Intronic
1092353604 12:7776428-7776450 CTAAAAATATAGAATTAGCCAGG - Intergenic
1092361785 12:7842887-7842909 CTAAAAATATAAAATTAGCTGGG - Intronic
1092457492 12:8657256-8657278 CTGTAAATACAAAATTAGCCTGG + Intronic
1092516602 12:9221216-9221238 CTGAAAATATAAAACTAGCCGGG + Intergenic
1092622682 12:10289937-10289959 CTAAAAATACAAAACTAGCTGGG - Intergenic
1093073577 12:14733534-14733556 CTGAAAATACAAAACTCGCTGGG - Intergenic
1093094870 12:14960662-14960684 CTGAAAATACAAAATTAGCTGGG - Intronic
1093117456 12:15228618-15228640 CTAAAAATACAAAACTAGCTGGG + Intronic
1093131748 12:15400149-15400171 CTAAAAATACAAAACTAGCTGGG - Intronic
1093144928 12:15554031-15554053 CTGAAAATACAAAATTAGCTGGG + Intronic
1093430911 12:19083941-19083963 CTAAAAATACAAAACTAGCTAGG - Intergenic
1094112424 12:26875724-26875746 CTAAAAATACAAAACTAGCTGGG - Intergenic
1094151392 12:27288041-27288063 CTAAAAATACAGAATTAGCTGGG - Intronic
1094235915 12:28166016-28166038 CTGTAAATAAATAAATAGCTAGG + Intronic
1095053440 12:37574606-37574628 CTAAAAATATAAAATTAGCTGGG - Intergenic
1095140295 12:38654352-38654374 CTGAAAATACAAAATTAGCTGGG + Intronic
1095327009 12:40906836-40906858 CTAAAAATATAAAACTAGCCTGG - Intronic
1095396514 12:41768363-41768385 CTCTAAATATAGAACTATCATGG - Intergenic
1095892924 12:47251212-47251234 CTAAAAATATAAAATTAGCTGGG - Intergenic
1096006243 12:48174557-48174579 CTAAAAATATAAAATTAGCTGGG + Intronic
1096169667 12:49457592-49457614 CTAAAAATACAGAATTAGCTGGG - Intronic
1096319140 12:50595598-50595620 CTGTTAATAAAAAACTGGCTGGG - Intronic
1096335853 12:50755319-50755341 CTAAAAATACAAAACTAGCTGGG - Intergenic
1096409549 12:51367100-51367122 CTGAAAATACAAAATTAGCTGGG + Intronic
1096458305 12:51805987-51806009 CTGAAAATAAAAAATTAGCTGGG - Intronic
1096700187 12:53378028-53378050 CTAAAAATATAAAACTAGCCAGG - Intergenic
1096967407 12:55639199-55639221 CTGAAAATACAGAATTAGCCGGG - Intergenic
1097044435 12:56176980-56177002 CTAAAAATACAAAACTAGCTGGG - Intronic
1097109584 12:56648284-56648306 CTGAAAATACAAAATTAGCTGGG + Intergenic
1097229556 12:57501522-57501544 CTGAAAATACAGAAATGGCTAGG + Intronic
1097974815 12:65672977-65672999 CTGAAAATATAGAACCTCCTGGG - Intergenic
1098066139 12:66619179-66619201 CTGTGAATAGAGAAATAGTTTGG + Intronic
1098132927 12:67369233-67369255 CTGAAAATACAAAATTAGCTGGG + Intergenic
1098276719 12:68819650-68819672 CTAAAAATATAAAATTAGCTGGG - Intronic
1098374219 12:69796137-69796159 CTAAAAATATAAAATTAGCTGGG + Intronic
1098417155 12:70247315-70247337 CTGAAAATACAAAATTAGCTGGG - Intronic
1098511431 12:71318634-71318656 CTAAAAATATAAAATTAGCTGGG + Intronic
1098533955 12:71574050-71574072 CTTTTAATATAGAACTGACTTGG - Intronic
1098558657 12:71847934-71847956 CTAAAAATACAAAACTAGCTGGG + Intronic
1098995288 12:77112237-77112259 CTTTAAATATAAAAATAGATAGG - Intergenic
1100312949 12:93414286-93414308 CTAAAAATATAAAATTAGCTAGG + Intronic
1100457645 12:94767858-94767880 CTAAAAATATAAAATTAGCTGGG + Intergenic
1100516196 12:95330262-95330284 CTAAAAATATAAAATTAGCTGGG - Intergenic
1100524389 12:95406042-95406064 CTAAAAATACAAAACTAGCTGGG + Intergenic
1100626769 12:96342800-96342822 CTAAAAATATAAAATTAGCTGGG + Intronic
1101021234 12:100556304-100556326 CTAAAAATATAAAATTAGCTGGG + Intronic
1101382664 12:104228139-104228161 CTAAAAATATAAAATTAGCTGGG + Intronic
1101994543 12:109515528-109515550 CTAAAAATATAGAATTAGCTGGG - Intronic
1102049404 12:109851759-109851781 CTAAAAATATAGAATTAGCCAGG - Exonic
1102286676 12:111663290-111663312 CTAAAAATATAAAACTAGCCAGG + Intronic
1102334308 12:112064871-112064893 CTAAAAATACAGAATTAGCTGGG + Intronic
1102696094 12:114800637-114800659 CTAAAAATACAAAACTAGCTTGG - Intergenic
1102858044 12:116311957-116311979 CCATAAATAAAGAAATAGCTGGG - Intergenic
1102920466 12:116788086-116788108 CTAAAAATATAAAATTAGCTGGG - Intronic
1103355449 12:120316481-120316503 CTAAAAATACAGAATTAGCTGGG + Intergenic
1103648753 12:122416737-122416759 CTAAAAATATAAAACTAGCCGGG + Intronic
1103651531 12:122436610-122436632 CTAAAAATATAAAATTAGCTGGG + Intergenic
1103777130 12:123374415-123374437 CTAAAAATACAGAATTAGCTGGG + Intergenic
1103813779 12:123636754-123636776 CTGAAAATACAAAATTAGCTGGG + Intronic
1104023645 12:125010613-125010635 CTGAAAATACAAAATTAGCTGGG + Intronic
1104451140 12:128869028-128869050 CTAAAAATATAAAATTAGCTGGG - Intronic
1105058791 12:133129338-133129360 CTAAAAATACAGAATTAGCTGGG + Intronic
1105381820 13:19894504-19894526 CTGAAAATACAAAATTAGCTGGG - Intergenic
1105756938 13:23474599-23474621 CTAAAAATACAGAATTAGCTGGG + Intergenic
1106221413 13:27748887-27748909 CTGTCTATATAAGACTAGCTGGG - Intergenic
1106322484 13:28655053-28655075 CTAAAAATATAAAATTAGCTGGG - Intergenic
1106329763 13:28729376-28729398 CTAAAAATATAAAATTAGCTGGG - Intergenic
1106446110 13:29832816-29832838 CTGTAAGTATAGAACATGCTGGG - Intronic
1106497287 13:30291872-30291894 CTAAAAATATAAAACTAGCCGGG + Intronic
1107391770 13:39972411-39972433 ATGGAAATATAGGACTGGCTGGG - Intergenic
1107498534 13:40953135-40953157 CTGAAAATACAGAATTAGCTGGG - Intronic
1107521033 13:41181553-41181575 CTGAAAATACAAAATTAGCTGGG + Intergenic
1108205677 13:48087202-48087224 CTGAAAATACAAAATTAGCTGGG + Intronic
1108211097 13:48140696-48140718 CTGAAAATACAAAATTAGCTGGG + Intergenic
1108224656 13:48275808-48275830 CTGTACATCTAGAAATGGCTGGG - Intergenic
1108374691 13:49803134-49803156 CTGAAAATACAAAATTAGCTGGG - Intergenic
1108426034 13:50301406-50301428 CTAAAAATATAAAATTAGCTGGG + Intronic
1108721513 13:53137346-53137368 CTGTTTATATAGAGATAGCTGGG + Intergenic
1109277031 13:60314544-60314566 CAGTAAGTATAGAACCAGTTAGG + Intergenic
1109336283 13:60999037-60999059 CTGAAAATAAAAAATTAGCTGGG - Intergenic
1109542215 13:63794023-63794045 CTGAAAATATAAAATTAGCTGGG + Intergenic
1110111279 13:71749143-71749165 CTGAAAATACAAAATTAGCTGGG - Intronic
1110944707 13:81397625-81397647 CTAAAAATACAGAATTAGCTGGG + Intergenic
1111499329 13:89095183-89095205 AATTAAAGATAGAACTAGCTGGG + Intergenic
1111591256 13:90350199-90350221 CTGAAAATACAAAATTAGCTGGG + Intergenic
1111591544 13:90353818-90353840 CTAAAAATACAGAATTAGCTGGG + Intergenic
1112021611 13:95376604-95376626 CTGAAAATATAAAATTAGCCGGG - Intergenic
1112139095 13:96618395-96618417 CTGAAAATAAAGAACCAGCCAGG - Intronic
1112190063 13:97168124-97168146 CTGAAAATACAAAATTAGCTGGG - Intergenic
1112313748 13:98342861-98342883 CTAAAAATATAAAATTAGCTTGG + Intronic
1112316655 13:98369084-98369106 CTAAAAATATAAAATTAGCTGGG - Intronic
1112372458 13:98805919-98805941 CTAAAAATATATAATTAGCTGGG - Intronic
1112514559 13:100041706-100041728 CTAAAAATATAAAACTAGCTGGG + Intergenic
1112622019 13:101062762-101062784 CTAAAAATACAAAACTAGCTGGG - Intronic
1112837548 13:103534255-103534277 CAAAAAATACAGAACTAGCTAGG + Intergenic
1112873162 13:104000750-104000772 CTAAAAATACAAAACTAGCTGGG - Intergenic
1113141597 13:107158262-107158284 CTAAAAATACAGAATTAGCTGGG + Intergenic
1113366514 13:109681580-109681602 CTAAAAATATAAAATTAGCTGGG - Intergenic
1113491302 13:110694185-110694207 CTAAAAATACAGAATTAGCTGGG - Intronic
1113494728 13:110717664-110717686 CTGAAAATACAGAATTAGCCGGG + Intronic
1114310307 14:21460772-21460794 CTGAAAATACAAAATTAGCTGGG - Exonic
1114440581 14:22743548-22743570 CTGAAAATACAAAATTAGCTGGG - Intergenic
1114480689 14:23032281-23032303 CTAAAAATATAAAATTAGCTGGG + Intronic
1115226484 14:31108249-31108271 CTGAAAATACAGAATTAGCCAGG - Intronic
1115256900 14:31412710-31412732 CTGAAAATATAAAATTAGCTGGG + Intronic
1115588131 14:34835830-34835852 CTGAAAATACAAAATTAGCTGGG - Intronic
1116286673 14:42982105-42982127 CTGTACATATACAAATAGCATGG - Intergenic
1116567950 14:46475026-46475048 CTGTAAATATAGGACTAATGTGG - Intergenic
1116925825 14:50635868-50635890 CTAAAAATACAGAAGTAGCTGGG - Intronic
1117134136 14:52716590-52716612 CTGAAAATACAAAATTAGCTGGG + Intronic
1117138770 14:52765376-52765398 CTAAAAATATAAAATTAGCTGGG - Intronic
1117172072 14:53110812-53110834 CTAAAAATATAAAATTAGCTGGG + Intronic
1117345863 14:54831846-54831868 CTGAAAATACAAAATTAGCTGGG - Intergenic
1117407836 14:55421622-55421644 CTGAAAATACAAAATTAGCTGGG - Intronic
1118027562 14:61785239-61785261 CTGAAAATACAAAACTAGCTGGG + Intronic
1118190305 14:63574212-63574234 CTAAAAATATAAAATTAGCTGGG - Intergenic
1118989382 14:70784120-70784142 CTAAAAATACAAAACTAGCTGGG + Intronic
1119275237 14:73349424-73349446 CTAAAAATACAAAACTAGCTGGG + Intronic
1119473716 14:74914871-74914893 CTGAAAATACAAAATTAGCTGGG - Intronic
1119691851 14:76679232-76679254 CTAAAAATATAAAATTAGCTGGG + Intergenic
1119801673 14:77450803-77450825 CAGTAAACATATAACTGGCTAGG - Intronic
1119810469 14:77513732-77513754 CTGAAAATACAAAATTAGCTGGG + Intronic
1119810763 14:77517083-77517105 CTAAAAATACAAAACTAGCTGGG + Intronic
1120235732 14:81888752-81888774 CTGTAAGAAGAGAACCAGCTGGG + Intergenic
1120347126 14:83305175-83305197 TTGTAAATAGAGAACAAACTTGG - Intergenic
1120538752 14:85729832-85729854 CTAAAAATATAAAATTAGCTGGG - Intergenic
1120630473 14:86883934-86883956 CTGAAAATAAAAAATTAGCTGGG - Intergenic
1120731342 14:88005414-88005436 CTTTAAATTTAGAACTAATTAGG + Intronic
1120752660 14:88212277-88212299 CTAAAAATACAGAATTAGCTGGG + Intronic
1120795628 14:88630189-88630211 CTAAAAATACAGAATTAGCTAGG - Intronic
1120924931 14:89788322-89788344 CTAAAAATACAGAATTAGCTGGG + Intergenic
1120924956 14:89788456-89788478 CTAAAAATACAGAATTAGCTGGG + Intergenic
1121057594 14:90872522-90872544 CTGTTTATATCAAACTAGCTAGG + Intronic
1121112152 14:91319862-91319884 CTAAAAATACAAAACTAGCTGGG + Intronic
1121633048 14:95434816-95434838 CTGAAAATACAAAATTAGCTGGG - Intronic
1121871212 14:97409286-97409308 CTGTTCATATAGGCCTAGCTGGG - Intergenic
1121910934 14:97791839-97791861 CTAAAAATACAGAATTAGCTGGG + Intergenic
1122118489 14:99539307-99539329 CTAAAAATATAAAATTAGCTGGG + Intronic
1122473777 14:101991309-101991331 CTAAAAATATATAATTAGCTGGG + Intronic
1122731347 14:103801009-103801031 CTAAAAATACAGAATTAGCTGGG - Intronic
1122907702 14:104809722-104809744 CTGAAAATACAAAATTAGCTGGG - Intergenic
1123517835 15:21046052-21046074 CTGAAAATACAGAATTAGCCGGG + Intergenic
1123773641 15:23555352-23555374 CTAAAAATATAAAATTAGCTGGG + Intergenic
1123953187 15:25305276-25305298 CTGAAAATATAAAATTAGCCGGG + Intergenic
1124942502 15:34231199-34231221 CTGAAAATACAAAATTAGCTGGG + Intronic
1124984458 15:34592571-34592593 CTAAAAATATAAAATTAGCTGGG - Intergenic
1125066206 15:35488264-35488286 CTGAAAATGTGGAAGTAGCTTGG - Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1125291391 15:38151944-38151966 CTGAAAATAGAAAATTAGCTGGG - Intergenic
1125568895 15:40699302-40699324 CTAAAAATATAAAATTAGCTGGG - Intronic
1125828822 15:42697112-42697134 CTGGAAATATACAACAAACTGGG - Intronic
1125902365 15:43360472-43360494 CTAAAAATATAAAATTAGCTGGG + Exonic
1126135430 15:45385310-45385332 GTGTAAATAGAGAATCAGCTTGG - Intronic
1126258998 15:46664731-46664753 ATGTAAATTTACAGCTAGCTGGG + Intergenic
1126626951 15:50694360-50694382 CTAAAAATACAAAACTAGCTGGG + Intergenic
1126650773 15:50919369-50919391 CTAAAAATACAGAATTAGCTGGG + Intronic
1126726086 15:51633973-51633995 CTAAAAATACAAAACTAGCTGGG - Intergenic
1126768535 15:52032843-52032865 CTAAAAATACAGAATTAGCTGGG - Intronic
1127116459 15:55732653-55732675 CTGAAAATACAAAACTAGCCGGG - Intronic
1127184089 15:56459827-56459849 CTAAAAATACAGAATTAGCTGGG + Intronic
1127426397 15:58863210-58863232 CTGAAAATACAGAATTAGCCAGG - Intergenic
1127432111 15:58920460-58920482 CTAAAAATATAAAATTAGCTGGG + Intronic
1127460464 15:59194011-59194033 CTAAAAATATAGAAGTAGCCAGG + Intronic
1127511952 15:59651336-59651358 CTAAAAATATAAAATTAGCTGGG - Intronic
1127573856 15:60271525-60271547 CTGAAAATACAAAATTAGCTGGG - Intergenic
1128025622 15:64434236-64434258 CTAGAAATATAAAATTAGCTGGG + Intronic
1128031161 15:64481479-64481501 CTAAAAATACAGAATTAGCTAGG - Intronic
1128051130 15:64665743-64665765 CTAAAAATATAAAATTAGCTGGG + Intronic
1128066680 15:64769262-64769284 CTAAAAATACAGAATTAGCTGGG + Intronic
1128196525 15:65762166-65762188 CTGAAAATACAAAATTAGCTGGG - Intronic
1128204512 15:65838868-65838890 CTAAAAATACAGAATTAGCTAGG - Intronic
1128945673 15:71818768-71818790 CTGAAAATACAAAATTAGCTGGG - Intergenic
1129005203 15:72367102-72367124 CTGAAAATACAAAATTAGCTGGG - Intronic
1129008120 15:72391588-72391610 CTAAAAATATAAAATTAGCTGGG - Intergenic
1129017152 15:72478434-72478456 ATGTAACTATATAAGTAGCTAGG + Intronic
1129308031 15:74682859-74682881 CTAAAAATACAAAACTAGCTGGG + Intronic
1129327007 15:74805647-74805669 CTAAAAATATAAAATTAGCTGGG + Intergenic
1129713098 15:77831420-77831442 CTAAAAATACAAAACTAGCTGGG - Intergenic
1130007300 15:80112097-80112119 CTAAAAATAAAGAATTAGCTGGG + Intronic
1130242411 15:82207880-82207902 CTGGAAATAGAAAATTAGCTGGG - Intronic
1130608548 15:85339452-85339474 CTAAAAATACAAAACTAGCTGGG + Intergenic
1130963880 15:88682860-88682882 CTAAAAATACAAAACTAGCTGGG + Intergenic
1131171266 15:90179909-90179931 CTATAAATACAAAATTAGCTGGG + Intronic
1131180535 15:90236197-90236219 CTAAAAATACAAAACTAGCTGGG - Intronic
1131805126 15:96114191-96114213 TTAAAAATATAAAACTAGCTGGG - Intergenic
1131868745 15:96739527-96739549 CTGCAAAGATAGAGCTAGTTAGG - Intergenic
1132174170 15:99695696-99695718 CTAAAAATACAGAATTAGCTGGG + Intronic
1132351677 15:101143158-101143180 ATGTCAATAAAGACCTAGCTGGG + Intergenic
1132489984 16:222789-222811 CTGAAAATACAAAATTAGCTGGG - Intronic
1133289660 16:4711262-4711284 CTAAAAATATAAAATTAGCTGGG - Intronic
1133535214 16:6695256-6695278 CTGAAAATAAAAAATTAGCTGGG + Intronic
1133569680 16:7028424-7028446 CTAAAAATATAAAATTAGCTGGG + Intronic
1134148208 16:11784691-11784713 CTGAAAATACAAAATTAGCTGGG + Intronic
1134260902 16:12650072-12650094 CTAAAAATACAAAACTAGCTGGG + Intergenic
1134284330 16:12847095-12847117 CTGAAAATACAAAACGAGCTTGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135280099 16:21146919-21146941 CTAAAAATATAAAATTAGCTGGG - Intronic
1135711091 16:24717929-24717951 CTAAAAATATAAAATTAGCTGGG - Intergenic
1135969992 16:27065394-27065416 CTGAAAATACAAAATTAGCTGGG + Intergenic
1136102332 16:28005272-28005294 CTAAAAATACAGAATTAGCTGGG - Intronic
1136147526 16:28324056-28324078 CTAAAAATATAAAATTAGCTGGG + Intergenic
1136262258 16:29087019-29087041 CTAAAAATACAAAACTAGCTGGG + Intergenic
1136273367 16:29162208-29162230 CTAAAAATATAAAATTAGCTGGG - Intergenic
1136372014 16:29842464-29842486 CTAAAAATACAAAACTAGCTGGG - Intronic
1136635405 16:31518743-31518765 CTAAAAATATAAAATTAGCTGGG - Intergenic
1137044640 16:35643798-35643820 CTGAAAATACAAAATTAGCTGGG - Intergenic
1137242333 16:46666427-46666449 CTGAAAATACAAAATTAGCTGGG - Intronic
1137275792 16:46932659-46932681 CTAAAAATACAAAACTAGCTGGG - Intergenic
1137630019 16:49936583-49936605 CTGAAAATAAAAAATTAGCTGGG + Intergenic
1138373547 16:56546733-56546755 CTGAAAATATGAAATTAGCTGGG - Intergenic
1138490757 16:57374977-57374999 CTAAAAATATAAAATTAGCTGGG + Intronic
1138612075 16:58133267-58133289 CTAAAAATATAAAATTAGCTGGG - Intergenic
1138662035 16:58526660-58526682 CTAAAAATATAAAATTAGCTGGG + Intronic
1138683731 16:58706439-58706461 CTAAAAATATAAAATTAGCTGGG - Intergenic
1139143884 16:64301067-64301089 CTGAAAATATAAAATTAGCCAGG - Intergenic
1139158214 16:64470415-64470437 CTGGAAATACAGATCTACCTTGG + Intergenic
1139181202 16:64750678-64750700 CTAAAAATACAAAACTAGCTGGG - Intergenic
1139329942 16:66179914-66179936 CTGCAAATATAGACCTTGCAGGG + Intergenic
1139397033 16:66648495-66648517 CTAAAAATATAAAATTAGCTGGG + Intronic
1139399049 16:66665581-66665603 CTAAAAATACAAAACTAGCTGGG + Intronic
1139543372 16:67635648-67635670 CTAAAAATATAAAATTAGCTGGG - Intronic
1139566183 16:67778186-67778208 CTAAAAATACAAAACTAGCTGGG + Intronic
1139717345 16:68824156-68824178 CTGAAAATACAAAATTAGCTGGG - Intronic
1139733847 16:68970504-68970526 CTAAAAATATAAAATTAGCTGGG + Intronic
1139787588 16:69406563-69406585 CTAAAAATATAAAATTAGCTGGG - Intronic
1139832747 16:69813321-69813343 CTAAAAATATAAAATTAGCTGGG - Intronic
1139854336 16:69968639-69968661 CTAAAAATACAAAACTAGCTGGG - Intergenic
1139883316 16:70191553-70191575 CTAAAAATACAAAACTAGCTGGG - Intergenic
1139913272 16:70411831-70411853 CTGAAAATACAAAATTAGCTGGG + Intronic
1140369192 16:74403968-74403990 CTAAAAATACAAAACTAGCTGGG + Intergenic
1140430274 16:74897046-74897068 CTGTTAATATGGAAATTGCTTGG + Intronic
1140520671 16:75578429-75578451 CTGAAAATACAAAATTAGCTGGG - Intergenic
1140591885 16:76363321-76363343 CTGAAAATAAAAAATTAGCTGGG - Intronic
1140660439 16:77186677-77186699 CTAAAAATATAAAATTAGCTGGG - Intergenic
1141179796 16:81744730-81744752 CTGTAAAAAAAAAATTAGCTGGG - Intronic
1141334640 16:83142940-83142962 CTGAAAATACAAAATTAGCTGGG + Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141388599 16:83645800-83645822 CTGTAAATCTAGCACAGGCTTGG + Intronic
1142042223 16:87901746-87901768 CTAAAAATACAAAACTAGCTGGG - Intronic
1142301955 16:89264022-89264044 CTAAAAATATAAAATTAGCTGGG - Intergenic
1142428380 16:90012618-90012640 CTAAAAATACAGAATTAGCTGGG - Intronic
1142463035 17:108752-108774 CTGAAAATACAGAATTAGCCAGG - Intergenic
1142479689 17:211442-211464 CTAAAAATACAGAATTAGCTGGG + Intergenic
1142628440 17:1207486-1207508 CTAAAAATATAAAATTAGCTGGG + Intronic
1142738288 17:1915607-1915629 CTAAAAATACAAAACTAGCTGGG - Intergenic
1142739064 17:1919947-1919969 CTGAAAATACAAAATTAGCTGGG + Intergenic
1142886732 17:2917429-2917451 CTAAAAATATAAAATTAGCTGGG - Intronic
1142956864 17:3528547-3528569 CTGTAAATATAGAACTAGCTGGG - Intronic
1142969073 17:3599076-3599098 CTAAAAATACAGAATTAGCTGGG + Intergenic
1143046024 17:4080498-4080520 CTAAAAATATAAAATTAGCTGGG - Intronic
1143139007 17:4730198-4730220 CTAAAAATACAGAATTAGCTGGG - Intergenic
1143194999 17:5069344-5069366 CTGAAAATACAAAATTAGCTGGG - Intergenic
1143304732 17:5937386-5937408 CTAAAAATACAAAACTAGCTGGG - Intronic
1143386326 17:6533121-6533143 CTGAAAATAGAAAATTAGCTGGG - Intronic
1143526352 17:7475178-7475200 CTGAAAATAAAAAATTAGCTGGG + Intronic
1143649313 17:8253698-8253720 CTAAAAATATAAAATTAGCTGGG - Intronic
1143797239 17:9346964-9346986 CTAAAAATATACAACTAGCTGGG + Intronic
1143825177 17:9599900-9599922 CTGAAAATACAAAATTAGCTGGG - Intronic
1144075525 17:11716242-11716264 CTGAAAATACAAAATTAGCTGGG - Intronic
1144163675 17:12586395-12586417 CTGAAAATATAAAATTAGCTGGG + Intergenic
1144567090 17:16368672-16368694 CTGAAAATACAAAATTAGCTGGG + Intergenic
1144694020 17:17289080-17289102 CTCAAAATAAAGAAATAGCTGGG - Intergenic
1144929720 17:18849531-18849553 CTAAAAATATAAAATTAGCTGGG + Intronic
1145038323 17:19556717-19556739 CTGAAAATACAAAATTAGCTGGG - Intronic
1145186831 17:20802132-20802154 GTAAAAGTATAGAACTAGCTTGG - Intergenic
1145226965 17:21137616-21137638 CTAAAAATATAAAACTAGCCTGG - Intronic
1145232293 17:21182407-21182429 CTAAAAATACAAAACTAGCTGGG - Intronic
1145373979 17:22330633-22330655 CTAAAAATATAAAATTAGCTGGG - Intergenic
1145944706 17:28764585-28764607 CTGAAAATACAAAATTAGCTGGG + Intronic
1146082320 17:29791694-29791716 CTTTAGATTTAGAAATAGCTTGG + Intronic
1146117726 17:30156678-30156700 CTAAAAATATAAAATTAGCTGGG - Intronic
1146391191 17:32424733-32424755 CTAAAAATACAGAATTAGCTGGG + Intergenic
1147052767 17:37808863-37808885 CTGCAAATACAAAATTAGCTGGG - Intergenic
1147218899 17:38916698-38916720 CTAAAAATATAAAATTAGCTCGG + Intronic
1147225818 17:38976162-38976184 CTAAAAATATAAAATTAGCTGGG - Intergenic
1147287280 17:39412387-39412409 CTAAAAATACAGAATTAGCTGGG - Intronic
1147356238 17:39899821-39899843 CTAAAAATACAGAATTAGCTGGG - Intergenic
1147397102 17:40152480-40152502 CTAAAAATACAAAACTAGCTGGG - Intronic
1147709451 17:42451908-42451930 CTAAAAATATAAAATTAGCTGGG + Intergenic
1147756187 17:42769615-42769637 CTAAAAATATAAAATTAGCTGGG + Intergenic
1147791560 17:43017001-43017023 CTGAAAATACAAAATTAGCTGGG + Intronic
1148063448 17:44852076-44852098 CTAAAAATATAAAATTAGCTAGG - Intronic
1148205931 17:45780093-45780115 CTAAAAATATAAAATTAGCTGGG - Intergenic
1148329860 17:46807319-46807341 CTGAAAATACAAAATTAGCTGGG + Intronic
1148401927 17:47370900-47370922 CTAAAAATACAAAACTAGCTGGG - Intronic
1148570476 17:48664291-48664313 CTGAAAATACAAAATTAGCTGGG - Intergenic
1148608750 17:48949775-48949797 CTAAAAATACAGAATTAGCTGGG - Intergenic
1148643207 17:49203740-49203762 CTAAAAATATAAAATTAGCTGGG + Intronic
1148920917 17:51032771-51032793 CTAAAAATACAAAACTAGCTGGG + Intronic
1148925537 17:51081580-51081602 CTAAAAATATAAAATTAGCTGGG + Intronic
1148928562 17:51109021-51109043 CTAAAAATATAAAAGTAGCTGGG - Intronic
1148947318 17:51275034-51275056 CTGAAAATACAAAATTAGCTGGG + Intronic
1148994177 17:51694041-51694063 CTGAAAATACAAAATTAGCTAGG + Intronic
1149155346 17:53622423-53622445 CTGAAAATAAAAAATTAGCTGGG + Intergenic
1149226713 17:54479814-54479836 CTGAAAATATAAAATTAGCTGGG + Intergenic
1149365247 17:55937375-55937397 CTGAAAATACAAAATTAGCTGGG + Intergenic
1149673741 17:58439643-58439665 CTGAAAATACAGAATTAGCTGGG - Intronic
1149674882 17:58450590-58450612 CTAAAAATATAAAATTAGCTGGG + Intronic
1149793224 17:59497300-59497322 CTAAAAATATAAAATTAGCTGGG - Intergenic
1149824385 17:59814139-59814161 CTAAAAATACAGAATTAGCTGGG - Intronic
1149984135 17:61334502-61334524 CTGAAAATACAAAATTAGCTGGG + Intronic
1150340357 17:64361590-64361612 CTGAAAATACAAAATTAGCTGGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150536562 17:66048768-66048790 CTAAAAATACAGAATTAGCTGGG - Intronic
1150898605 17:69242623-69242645 CTAAAAATATAAAATTAGCTGGG - Intronic
1151031839 17:70749680-70749702 CTTTAAAAATAGAACTAAATTGG + Intergenic
1151598928 17:75094523-75094545 CTGAAAATACAAAATTAGCTGGG + Intronic
1151612444 17:75185061-75185083 CTGAAAATACAAAATTAGCTGGG + Intergenic
1151621573 17:75248623-75248645 CTAAAAATACAGAATTAGCTGGG + Intronic
1152080166 17:78182211-78182233 CTAAAAATATAAAATTAGCTGGG + Intronic
1152418338 17:80177532-80177554 CTAAAAATAAAGAATTAGCTGGG + Intronic
1152441153 17:80310711-80310733 CTAAAAATACAGAATTAGCTGGG - Intronic
1152498503 17:80692480-80692502 CTGAAAATACAAAATTAGCTGGG - Intronic
1152620091 17:81358975-81358997 CTGAAAATACAAAATTAGCTGGG + Intergenic
1152692558 17:81726456-81726478 CTAAAAATATAAAATTAGCTGGG - Intergenic
1152825133 17:82459706-82459728 CTAAAAATATAAAATTAGCTGGG + Intronic
1153671014 18:7412040-7412062 CTGAAAATACAAAATTAGCTGGG - Intergenic
1153783440 18:8514151-8514173 CTAAAAATACAAAACTAGCTGGG + Intergenic
1154161370 18:11982631-11982653 CTGAAAATACAAAATTAGCTGGG + Intronic
1154247019 18:12708523-12708545 CTAAAAATACAAAACTAGCTGGG - Intronic
1155043784 18:22086526-22086548 CTAAAAATATAAAATTAGCTGGG + Intergenic
1155108307 18:22688818-22688840 CTGTAAAGAAATACCTAGCTGGG + Intergenic
1155253388 18:23972313-23972335 CTGTAAATATTGGAGTGGCTTGG + Intergenic
1155282064 18:24250335-24250357 CTAAAATTATAAAACTAGCTGGG - Intronic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155606186 18:27608662-27608684 CTGAAAATACAGAATTAGCCCGG + Intergenic
1155961350 18:31998003-31998025 CTGAAAATACAGAATTAGCCAGG - Intergenic
1156442750 18:37207968-37207990 CTGCAAATACAGAATTAGCCAGG - Intronic
1156669499 18:39451335-39451357 CTAAAAATATAAAACTAGCCTGG + Intergenic
1157228103 18:45886817-45886839 CTATAAATACAAAATTAGCTGGG - Intronic
1157348675 18:46864607-46864629 CTAAAAATATAAAATTAGCTGGG + Intronic
1157658359 18:49415764-49415786 CTAAAAATATAAAACTAGCCAGG + Intronic
1157814074 18:50718377-50718399 CTATAAATACAAAATTAGCTGGG - Intronic
1158218759 18:55128482-55128504 GTGCAAATTTAGAACTTGCTTGG - Intergenic
1158574473 18:58624613-58624635 CTGAAAATACAAAATTAGCTGGG - Intronic
1159303778 18:66613425-66613447 CTAAAAATACAAAACTAGCTCGG - Intergenic
1159724218 18:71933927-71933949 GTTTGAATATAGAACTAACTTGG + Intergenic
1159767402 18:72507325-72507347 CTGAAAATACAAAATTAGCTGGG - Intergenic
1159814369 18:73054725-73054747 CTAAAAATACAAAACTAGCTGGG + Intergenic
1159951093 18:74484452-74484474 CTAAAAATACAAAACTAGCTGGG - Intergenic
1159988542 18:74874611-74874633 CTGGAAATGCAGAGCTAGCTGGG - Intronic
1160252194 18:77212257-77212279 CTATAAATACAAAATTAGCTGGG + Intergenic
1160723366 19:607009-607031 CTAAAAATACAAAACTAGCTTGG + Intronic
1160978111 19:1803733-1803755 CTGAAAATACAAAATTAGCTGGG + Intronic
1161047365 19:2142923-2142945 CTAAAAATATAAAATTAGCTTGG - Intronic
1161215262 19:3091896-3091918 CTGAAAATACAGAATTAGCCAGG - Intergenic
1161372616 19:3921734-3921756 CTAAAAATATAAAATTAGCTGGG + Intronic
1161658640 19:5531784-5531806 CTCAAAATATAAAATTAGCTGGG + Intergenic
1161810639 19:6469190-6469212 CTAAAAATACAGAATTAGCTGGG - Intronic
1161931498 19:7343590-7343612 CTGAAAATACAAAATTAGCTGGG + Intergenic
1162057014 19:8070859-8070881 CTAAAAATACAGAATTAGCTGGG + Intronic
1162353222 19:10164302-10164324 CTAAAAATACAGAATTAGCTGGG - Intronic
1162355664 19:10183274-10183296 CTAAAAATATAAAATTAGCTGGG - Intronic
1162523749 19:11196217-11196239 CTAAAAATACAGAATTAGCTAGG - Intronic
1162529278 19:11226495-11226517 CTGAAAATACAAAATTAGCTGGG + Intronic
1162603571 19:11689425-11689447 CTAAAAATACAGAATTAGCTGGG + Intergenic
1162707655 19:12567403-12567425 CTAAAAATATAAAATTAGCTGGG + Intronic
1162767150 19:12926716-12926738 CTGTACAAATAAAATTAGCTGGG - Intronic
1162847712 19:13406292-13406314 CTAAAAATATAGAATTAGCCAGG + Intronic
1162882839 19:13672981-13673003 CTAAAAATACAGAATTAGCTGGG - Intergenic
1162997821 19:14347604-14347626 CTAAAAATACAAAACTAGCTGGG - Intergenic
1163099433 19:15085329-15085351 CTGAAAATACAAAATTAGCTAGG - Intergenic
1163302364 19:16456037-16456059 CTAAAAATATAAAATTAGCTAGG + Intronic
1163474054 19:17514811-17514833 CTAAAAATATAAAATTAGCTGGG - Intronic
1163786208 19:19276210-19276232 CTAAAAATATAAAATTAGCTGGG - Intronic
1163841060 19:19610250-19610272 CTGAAAATACAAAATTAGCTGGG + Intronic
1163948249 19:20560617-20560639 CTAAAAATACAGAATTAGCTGGG + Intronic
1164070127 19:21760019-21760041 CTAAAAATATAAAATTAGCTGGG + Intronic
1164105106 19:22104249-22104271 CTGAAAATACAAAACTAGCCAGG - Intergenic
1164195699 19:22956270-22956292 CTAAAAATAAAGAATTAGCTGGG + Intergenic
1164466445 19:28491102-28491124 CTGAAAATACAAAATTAGCTGGG + Intergenic
1165039094 19:33056271-33056293 CTGAAAATACAAAATTAGCTGGG - Intronic
1165109089 19:33490822-33490844 CTAAAAATATAAAATTAGCTGGG - Intronic
1165250346 19:34527876-34527898 CTAAAAATATAAAATTAGCTGGG - Intergenic
1165432251 19:35779588-35779610 CTGAAAATATAAAATTAGCCGGG - Intronic
1165527467 19:36368305-36368327 CTAAAAATACAGAATTAGCTGGG + Intronic
1165597941 19:37026478-37026500 CTGAAAATACAAAACTAGCAGGG - Intronic
1166089814 19:40501505-40501527 CTGAAAATATAAAATTAGCCAGG + Intronic
1166194500 19:41197032-41197054 CTGAAGATATAAAATTAGCTGGG + Intronic
1166443377 19:42835942-42835964 CTGAAAATACAAAATTAGCTGGG + Intronic
1166451047 19:42901025-42901047 CTGAAAATACAAAATTAGCTGGG + Intronic
1166463063 19:43006596-43006618 CTGAAAATACAAAATTAGCTGGG + Intronic
1166469205 19:43063151-43063173 CTGAAAATACAAAATTAGCTGGG + Intronic
1166480345 19:43166683-43166705 CTGAAAATACAAAATTAGCTGGG + Exonic
1166490157 19:43252228-43252250 CTGAAAATACAAAATTAGCTGGG + Intronic
1166599271 19:44079765-44079787 CTAAAAATACAAAACTAGCTGGG + Intronic
1166718017 19:44981300-44981322 CTATAAATACAAAATTAGCTGGG - Intronic
1166776698 19:45317446-45317468 CTAAAAATACAGAATTAGCTGGG - Intronic
1166971157 19:46568840-46568862 CTAAAAATACAAAACTAGCTGGG - Intronic
1167154995 19:47732920-47732942 CTAAAAATATAAAATTAGCTGGG + Intronic
1167517942 19:49934077-49934099 CTGAAAATACAAAATTAGCTGGG + Intronic
1167661296 19:50797505-50797527 CTGAAAATACAAAACTAGCCAGG + Intergenic
1167763775 19:51465709-51465731 CTAAAAATACAGAATTAGCTGGG + Intergenic
1167848327 19:52182690-52182712 CTCAAAATATAGAAATAGCCGGG - Intergenic
1167890723 19:52537023-52537045 CTAAAAATACAAAACTAGCTGGG + Intronic
1167919877 19:52774266-52774288 CTGAAAATACAAAATTAGCTGGG + Intronic
1168052477 19:53839698-53839720 CTGAAAATACAAAATTAGCTGGG + Intergenic
1168054322 19:53853381-53853403 CTAAAAATACAGAATTAGCTGGG - Intergenic
1168225226 19:54989821-54989843 CTGAAAATACAAAATTAGCTGGG + Intronic
1168650832 19:58091106-58091128 CTAAAAATACAAAACTAGCTGGG + Intronic
1168711804 19:58505258-58505280 CTGAAAATACAAAATTAGCTGGG - Intronic
1168712032 19:58506768-58506790 CTGAAAATACAAAATTAGCTGGG - Intronic
925109997 2:1325992-1326014 CTAAAAATATAAAATTAGCTGGG - Intronic
925249725 2:2421996-2422018 CTAAAAATATAAAATTAGCTGGG + Intergenic
925392132 2:3502609-3502631 CTAAAAATATAAAATTAGCTGGG - Intronic
925533823 2:4894454-4894476 CTAAAAATATGGAAGTAGCTGGG - Intergenic
925622536 2:5807858-5807880 CTGGGAATATAAAACTATCTTGG - Intergenic
925652432 2:6105383-6105405 AAGTAAATATGGAAGTAGCTGGG - Intergenic
926500564 2:13648098-13648120 CTGTAAATATATCTATAGCTTGG + Intergenic
927785926 2:25974863-25974885 CTAAAAATATAAAATTAGCTGGG + Intronic
928147461 2:28792177-28792199 CTAAAAATATAAAATTAGCTGGG + Intronic
928554968 2:32414128-32414150 CTGAAAATACAAAATTAGCTGGG + Intronic
928979696 2:37125171-37125193 CTGAAAATACAAAATTAGCTGGG - Intronic
929277936 2:40045525-40045547 CTAAAAATACAAAACTAGCTGGG - Intergenic
929477875 2:42271053-42271075 CTAAAAATATAAAACTAGCTGGG - Intronic
929479963 2:42296292-42296314 CAGTAGAAATAGAACTAGCTAGG + Intronic
929679724 2:43980390-43980412 CTAAAAATATAAAATTAGCTGGG + Intronic
929766150 2:44845494-44845516 TTTTAAATATAAAAGTAGCTGGG - Intergenic
929926104 2:46211216-46211238 CTAAAAATATAAAATTAGCTGGG - Intergenic
930373826 2:50539349-50539371 ATTTAAATAAATAACTAGCTTGG - Intronic
930789769 2:55313227-55313249 CTAAAAATACAAAACTAGCTGGG - Intronic
931249454 2:60517150-60517172 CTTTAAAAATAGAACTAGGGTGG + Intronic
931381184 2:61754998-61755020 CTGAAAATAAAAAATTAGCTGGG - Intergenic
931410244 2:62023063-62023085 CTAAAAATATAAAATTAGCTGGG + Intronic
931563892 2:63593253-63593275 CTAAAAATACAGAATTAGCTGGG - Intronic
931697745 2:64884369-64884391 CTAAAAATATAAAATTAGCTGGG - Intergenic
931745507 2:65288426-65288448 CTAAAAATATAAAATTAGCTGGG - Intergenic
931754785 2:65363077-65363099 CTAAAAATATAAAATTAGCTGGG + Intronic
931879962 2:66558116-66558138 CTAAAAATATAAAATTAGCTGGG + Intronic
932292456 2:70594029-70594051 CTAAAAATACAAAACTAGCTGGG - Intergenic
932301392 2:70669735-70669757 CTGTGAAAATAGAAGTTGCTAGG - Intronic
932665881 2:73698627-73698649 CTGAAAATACAAAATTAGCTGGG - Intergenic
932765027 2:74464118-74464140 CTGAAAATATAAAATTAGCCGGG - Intronic
932835242 2:75029907-75029929 ATTTAAATATATAAATAGCTTGG - Intergenic
932938124 2:76130347-76130369 CTGAAAATACAAAATTAGCTGGG - Intergenic
933363180 2:81314280-81314302 CTAAAAATACACAACTAGCTGGG + Intergenic
933562535 2:83906397-83906419 CTAAAAATACAAAACTAGCTGGG + Intergenic
933699052 2:85241604-85241626 CTAAAAATATAAAATTAGCTGGG - Intronic
933716200 2:85362755-85362777 CTAAAAATACAAAACTAGCTGGG + Intronic
933826306 2:86164216-86164238 CTAAAAATATAAAATTAGCTGGG - Intronic
934105223 2:88689223-88689245 CTAAAAATATAAAATTAGCTGGG - Intergenic
934668153 2:96188434-96188456 CTGAAAATACAAAATTAGCTGGG - Intronic
935017286 2:99195919-99195941 CTGAAAATACAGAATTAGCCAGG + Exonic
935132291 2:100269542-100269564 CTGAACCTATAGAAGTAGCTTGG - Intergenic
935167470 2:100581868-100581890 CTAAAAATATAAAATTAGCTGGG + Intergenic
935190293 2:100772237-100772259 CTGCAAATATAAAATCAGCTGGG - Intergenic
936121269 2:109747585-109747607 CTAAAAATATAAAATTAGCTGGG + Intergenic
936223427 2:110623886-110623908 CTAAAAATATAAAATTAGCTGGG - Intergenic
936267236 2:111020019-111020041 CTAAAAATATAAAATTAGCTGGG - Intronic
936282106 2:111151063-111151085 CTAAAAATACAAAACTAGCTGGG - Intronic
936437337 2:112519967-112519989 CTGAAAATACAAAATTAGCTGGG + Intronic
936994004 2:118394914-118394936 CTGAAAATACAAAACTAGCCGGG - Intergenic
937196063 2:120157606-120157628 CTAAAAATATAAAATTAGCTGGG + Intronic
937435039 2:121873410-121873432 CTGAAAATACAAAATTAGCTGGG - Intergenic
937598529 2:123699676-123699698 CTAAAAATATAAAATTAGCTGGG + Intergenic
937940939 2:127285527-127285549 CTAAAAATATAAAATTAGCTGGG + Intronic
938185795 2:129230695-129230717 CTAAAAATATAAAATTAGCTGGG + Intergenic
939665853 2:144950553-144950575 CTAAAAATACAAAACTAGCTGGG - Intergenic
939916612 2:148052369-148052391 CTGAAAATACACAATTAGCTGGG - Intronic
940066341 2:149633963-149633985 CTAAAAATATGGAACTAGCTGGG + Intergenic
940185540 2:150980997-150981019 CTGAAGATGTAGAACTATCTAGG - Intergenic
941176675 2:162205672-162205694 CTAAAAATATAAAACTAGCCGGG - Intronic
941477307 2:165965981-165966003 CTGTAAAAATACAAATAGCCTGG - Intergenic
941689066 2:168479767-168479789 CTGAAAATACAAAATTAGCTGGG - Intronic
941743739 2:169064374-169064396 CTGAAAATATAAAATTAGCCAGG - Intergenic
941792326 2:169566213-169566235 TTAAAAATATAGAACCAGCTGGG - Intronic
942033769 2:171990550-171990572 ATGTATATATAAAATTAGCTGGG - Intronic
942514376 2:176736790-176736812 CTAAAAATATAAAATTAGCTGGG - Intergenic
942583910 2:177453430-177453452 CTAAAAATATAGTATTAGCTGGG - Intronic
943346529 2:186744686-186744708 CTAAAAATACAAAACTAGCTGGG - Intronic
943484417 2:188461479-188461501 CTAAAAATACAAAACTAGCTGGG - Intronic
943999503 2:194814625-194814647 CTAAAAATATAAAATTAGCTAGG - Intergenic
944235454 2:197437825-197437847 CTGAAAATAAAAAATTAGCTGGG - Intergenic
944293034 2:198029859-198029881 CTGAAAATACAAAATTAGCTGGG - Intronic
944480496 2:200152796-200152818 CTGTAAAGAGAGAAAGAGCTTGG - Intergenic
944664325 2:201947076-201947098 CTGAAAATACAAAATTAGCTGGG + Intergenic
944753111 2:202731894-202731916 CTGAAAATATAAAATTAGCTGGG - Intronic
944979983 2:205106308-205106330 CTATAAATACAAAATTAGCTGGG - Intronic
945018173 2:205541980-205542002 CTAAAAATATAAAATTAGCTAGG + Intronic
945026029 2:205620787-205620809 CTGGAAAGAAAGATCTAGCTAGG + Intergenic
945438001 2:209841511-209841533 CTAAAAATATAAAATTAGCTGGG - Intronic
946223920 2:218252060-218252082 CTAAAAATACAGAATTAGCTAGG + Intronic
946246756 2:218392223-218392245 CTGAAAATACAAAATTAGCTGGG - Intronic
946281240 2:218667005-218667027 CTAAAAATATAAAATTAGCTGGG + Intronic
946641158 2:221784822-221784844 CTAGAAATATAAAATTAGCTGGG + Intergenic
947116152 2:226773283-226773305 ATGTATATATAGAAACAGCTGGG + Intronic
947166876 2:227271631-227271653 CTGAAAATACAAAATTAGCTGGG - Intronic
947314682 2:228843018-228843040 CTAAAAATATAAAATTAGCTGGG + Intergenic
947561186 2:231153950-231153972 CTAAAAATATAAAATTAGCTGGG + Intronic
947676690 2:231988002-231988024 CTAAAAATACAAAACTAGCTGGG - Intronic
948063948 2:235062668-235062690 CTAAAAATATAAAATTAGCTGGG + Intergenic
948401293 2:237687441-237687463 CTAAAAATACAAAACTAGCTGGG + Intronic
1169166011 20:3424561-3424583 CTAAAAATATAAAATTAGCTGGG + Intergenic
1169184481 20:3602800-3602822 CTAAAAATACAAAACTAGCTGGG + Intronic
1169373481 20:5046624-5046646 CTAAAAATACAGAATTAGCTGGG + Intergenic
1169436852 20:5600525-5600547 CTGAAAATAAAAAATTAGCTGGG + Intronic
1169439253 20:5620380-5620402 CTGAAAATACAAAATTAGCTGGG - Intergenic
1169440777 20:5632155-5632177 CTGAAAATACAAAACTAGCCGGG - Intergenic
1169441263 20:5635828-5635850 CTAAAAATACAGAATTAGCTGGG + Intergenic
1169453055 20:5728757-5728779 CTATAAATACAAAATTAGCTGGG - Intergenic
1170477086 20:16726217-16726239 CTATAAATACAAAATTAGCTGGG - Intergenic
1171005426 20:21460885-21460907 CTGAAAATACAAAAGTAGCTGGG + Intergenic
1171453921 20:25255892-25255914 CTAAAAATACAAAACTAGCTGGG - Intronic
1172086910 20:32392441-32392463 CTAAAAATACAGAATTAGCTGGG - Intronic
1172366274 20:34352330-34352352 CTAAAAATATAAAATTAGCTGGG + Intergenic
1172504634 20:35452581-35452603 CTAAAAATATAAAATTAGCTAGG - Intronic
1172585286 20:36079032-36079054 CTAAAAATATAAAATTAGCTGGG + Intergenic
1172642874 20:36451919-36451941 CTAAAAATACAAAACTAGCTGGG - Intronic
1172668690 20:36618743-36618765 CTAAAAATATAAAATTAGCTAGG + Intronic
1172812313 20:37657400-37657422 CTAAAAATACAAAACTAGCTGGG + Intergenic
1173286723 20:41678666-41678688 CTGAAAATACAAAATTAGCTGGG + Intergenic
1173780653 20:45754088-45754110 CTAAAAATATAAAATTAGCTGGG - Intronic
1174005102 20:47404223-47404245 CTGAAAATACAAAATTAGCTGGG + Intergenic
1174347311 20:49939891-49939913 CTAAAAATATAAAATTAGCTGGG + Intronic
1174426917 20:50438339-50438361 CTATAAATACAAAATTAGCTGGG + Intergenic
1174486528 20:50864930-50864952 CTAAAAATATAAAACTAGCCAGG + Intronic
1174642056 20:52053235-52053257 CTAAAAATATAAAATTAGCTGGG + Intronic
1175613795 20:60374883-60374905 CTGAAAATACAAAATTAGCTGGG + Intergenic
1176261521 20:64183979-64184001 CTGAAAATACAAAATTAGCTGGG - Intronic
1176894914 21:14365859-14365881 CTTTAAATATAGCATTAGGTTGG + Intergenic
1177053029 21:16262893-16262915 CTATAAATACAAAATTAGCTGGG - Intergenic
1177167814 21:17622748-17622770 TTGTAAATATTGAACTATCATGG + Intergenic
1177441989 21:21137595-21137617 CTAAAAATACAAAACTAGCTGGG + Intronic
1177525357 21:22283596-22283618 CTGTTATGATAGAACTAGGTAGG - Intergenic
1177652415 21:23974931-23974953 CTGAAAATAAAAAATTAGCTGGG + Intergenic
1177811872 21:25933440-25933462 CTGTATATTTAAAAATAGCTAGG - Intronic
1177830280 21:26131066-26131088 CTAAAAATATAAAATTAGCTGGG + Intronic
1177996013 21:28098720-28098742 CTGAAAATACAAAAGTAGCTGGG - Intergenic
1178308231 21:31508550-31508572 CTGAAAATACAAAATTAGCTGGG - Intronic
1178415906 21:32404961-32404983 CTGAAAATACAAAATTAGCTGGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1178990637 21:37352676-37352698 CTAAAAATATAAAATTAGCTGGG + Intergenic
1179550160 21:42138734-42138756 CTAAAAATACAAAACTAGCTGGG - Intronic
1179672330 21:42958445-42958467 CTGAAAATACAAAATTAGCTGGG + Intergenic
1179676596 21:42987219-42987241 CTAAAAATACAAAACTAGCTGGG + Intronic
1180458731 22:15538285-15538307 CTGAAAATATAAAATTAGCCAGG - Intergenic
1180510968 22:16088825-16088847 CTGAAAATACAAAATTAGCTGGG - Intergenic
1180747458 22:18100234-18100256 CTAAAAATATAAAATTAGCTGGG - Exonic
1180792087 22:18580701-18580723 CTGAAAATACAAAATTAGCTGGG + Intergenic
1181103382 22:20556459-20556481 CTAAAAATATAAAATTAGCTGGG - Intronic
1181229647 22:21414608-21414630 CTGAAAATACAAAATTAGCTGGG - Intergenic
1181249002 22:21520258-21520280 CTGAAAATACAAAATTAGCTGGG + Intergenic
1181641009 22:24198568-24198590 CTGAAAATACAAAATTAGCTCGG + Intergenic
1181819499 22:25464539-25464561 CTGAAAATACAAAATTAGCTGGG - Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182402176 22:30087020-30087042 CTGAAAATACAAAATTAGCTGGG - Intronic
1182598210 22:31438881-31438903 CTAAAAATACAAAACTAGCTGGG - Intronic
1182633242 22:31703956-31703978 CTAAAAATACAGAATTAGCTGGG - Intronic
1183207621 22:36430589-36430611 CTAAAAATACAAAACTAGCTGGG - Intergenic
1183268892 22:36848613-36848635 CTGAAAATACAAAATTAGCTGGG + Intergenic
1183577901 22:38703811-38703833 CTACAAATACAAAACTAGCTGGG - Intergenic
1183939873 22:41287823-41287845 CTAAAAATATAAAATTAGCTGGG + Intergenic
1184018992 22:41807997-41808019 CTGAAAATACAGAATTAGCTGGG + Intronic
1184539312 22:45109614-45109636 CTAAAAATACAGAATTAGCTGGG - Intergenic
1184581541 22:45421132-45421154 CTGAAAATACAAAATTAGCTGGG + Intronic
949556686 3:5159439-5159461 CTGAAAATACAAAATTAGCTGGG + Intronic
949721715 3:6997956-6997978 CTAAAAATATAAAATTAGCTGGG + Intronic
949942285 3:9164156-9164178 CTGAAAATACAGAATTAGCCAGG - Intronic
949971339 3:9407837-9407859 CTGAAAATAGAAAATTAGCTGGG + Intronic
950372112 3:12539944-12539966 CTAAAAATATAAAATTAGCTGGG - Intronic
950802018 3:15560253-15560275 CTGAAAATACAGAATTAGCTGGG - Intergenic
951297944 3:20962392-20962414 CTGAAAATACAAAATTAGCTGGG + Intergenic
951443268 3:22747332-22747354 CTACAAATATAAAATTAGCTAGG - Intergenic
952092242 3:29901797-29901819 CTGGAAAAATAGAAGTGGCTGGG + Intronic
952327431 3:32334137-32334159 CTGAAAATACAAAATTAGCTGGG - Intronic
952330587 3:32361140-32361162 CTAAAAATATAAAATTAGCTGGG - Intronic
952385457 3:32838383-32838405 CTAAAAATATAAAATTAGCTGGG - Intronic
952417282 3:33101055-33101077 CTGAAAATATAAAAGTAGCGGGG - Intergenic
952444478 3:33367240-33367262 CTGAAAATATAAAATTAGCCAGG - Intronic
952488150 3:33837079-33837101 CTAAAAATACAAAACTAGCTGGG - Intronic
952771126 3:37001837-37001859 CAGTAAATATAGTCCTATCTAGG + Intronic
952784315 3:37137555-37137577 CTCTGAATAGAGAACTAGATAGG + Intronic
952934376 3:38384225-38384247 CTAAAAATACAAAACTAGCTGGG - Intronic
953689368 3:45104890-45104912 CTGAAAATACAAAATTAGCTGGG + Intronic
953863966 3:46567421-46567443 CTAAAAATATAAAATTAGCTGGG + Intronic
954020311 3:47734916-47734938 CTAAAAATATAAAATTAGCTGGG - Intronic
954027541 3:47795126-47795148 CTAAAAATACAAAACTAGCTGGG - Intergenic
954043306 3:47906994-47907016 CTAAAAATACAAAACTAGCTGGG - Intronic
954072851 3:48155641-48155663 CTAAAAATATAAAATTAGCTGGG + Intergenic
954072878 3:48155775-48155797 CTAAAAATATAAAATTAGCTGGG + Intergenic
954251350 3:49369904-49369926 CTGAAAATACAAAATTAGCTGGG + Intronic
954718813 3:52542311-52542333 CTAAAAATATAAAATTAGCTGGG + Intronic
955180128 3:56660022-56660044 CTAAAAATATAAAATTAGCTTGG - Intronic
955207204 3:56907140-56907162 CTGAAAATACAAAATTAGCTGGG - Intronic
955385629 3:58477388-58477410 CTAAAAATACAAAACTAGCTGGG - Intergenic
955738234 3:62062136-62062158 CTAAAAATATAAAATTAGCTGGG + Intronic
955804021 3:62715300-62715322 CCGGAAATATAAAATTAGCTGGG - Intronic
955909243 3:63843277-63843299 CTGGAAATACAAAATTAGCTGGG - Intronic
956110505 3:65865799-65865821 CTAAAAATACAGAATTAGCTGGG - Intronic
956242619 3:67147331-67147353 CTAAAAATACAAAACTAGCTGGG + Intergenic
956652483 3:71517817-71517839 CTGCAAAGATACAACTAACTAGG + Intronic
956985819 3:74698964-74698986 CTGAAAATATAAAATTAGCCAGG + Intergenic
957439486 3:80225299-80225321 CTAAAAATACAGAAATAGCTGGG + Intergenic
958730591 3:97956654-97956676 CTGAAAATACAAAATTAGCTGGG - Intronic
959569966 3:107872700-107872722 CTAAAAATATAAAATTAGCTGGG - Intergenic
959833107 3:110888648-110888670 ATGTAAATATAGATATAGTTTGG + Intronic
959833804 3:110894906-110894928 CTGTAGAAAGAGAACTTGCTGGG - Intergenic
960106928 3:113807967-113807989 CTAAAAATACAGAATTAGCTGGG + Intronic
960274882 3:115717468-115717490 CTAAAAATATAAAAGTAGCTGGG - Intronic
961118820 3:124355874-124355896 CTGAAAATATAAAATTAGCAGGG - Intronic
961157326 3:124691265-124691287 CTAAAAATACAGAATTAGCTGGG + Intronic
961694916 3:128698058-128698080 CTAAAAATATAAAATTAGCTGGG - Intergenic
961695718 3:128702941-128702963 CTAAAAATATAAAATTAGCTGGG + Intergenic
962024874 3:131537442-131537464 CTAAAAATATAAAATTAGCTGGG - Intronic
962571717 3:136720013-136720035 GTGAAAATATAAAATTAGCTGGG + Intronic
962582832 3:136813675-136813697 CTAAAAATATAAAATTAGCTGGG - Intergenic
962704055 3:138026482-138026504 CTGAAAATACAAAATTAGCTGGG + Intronic
962873917 3:139521032-139521054 CTGAAAATACAAAATTAGCTGGG + Intronic
962911953 3:139860517-139860539 CTGTTAATATTGCACTGGCTGGG + Intergenic
963097079 3:141555098-141555120 CTAAAAATACAGAATTAGCTGGG + Intronic
963155800 3:142095149-142095171 CTGAAAATACATAATTAGCTGGG - Intronic
963241405 3:143006592-143006614 CTGAAAATACAAAATTAGCTGGG + Intronic
963739822 3:149066205-149066227 CTGAAAATACAAAATTAGCTGGG - Intronic
963783831 3:149513098-149513120 CTAAAAATATAAAATTAGCTGGG + Intergenic
964084701 3:152802275-152802297 CTAAAAATATAAAATTAGCTGGG - Intergenic
964090125 3:152866067-152866089 CTGTAAGGATAGTACTTGCTTGG + Intergenic
964342476 3:155722321-155722343 CTGAAAATACAAAATTAGCTGGG - Intronic
964572402 3:158123166-158123188 CTAAAAATACAAAACTAGCTGGG - Intronic
964750212 3:160047486-160047508 CTAAAAATACAGAATTAGCTGGG + Intergenic
965920727 3:173909837-173909859 CTGAAAATACAAAATTAGCTGGG - Intronic
966027366 3:175300901-175300923 CTAGAAATATAAAATTAGCTGGG - Intronic
966028343 3:175313899-175313921 CTAAAAATAAAAAACTAGCTGGG + Intronic
966184827 3:177218073-177218095 CTAAAAATACAAAACTAGCTGGG - Intergenic
966350261 3:179026545-179026567 CTGAAAATACAAAATTAGCTGGG - Intronic
966418697 3:179716083-179716105 CTAAAAATACAGAATTAGCTTGG - Intronic
966841716 3:184094736-184094758 CTAAAAATACAGAATTAGCTGGG + Intergenic
967044847 3:185727055-185727077 CTAAAAATACAAAACTAGCTGGG + Intronic
967045576 3:185733593-185733615 CTAAAAATACAAAACTAGCTGGG + Intronic
967287395 3:187886588-187886610 CTGAAAATACAAAATTAGCTGGG - Intergenic
967458397 3:189716957-189716979 CTGAAAATACAAAATTAGCTGGG - Intronic
967463887 3:189779884-189779906 CAGGAAATATAGAACTAAATTGG + Intronic
967519221 3:190408677-190408699 CAATTAATATAGAACTAACTGGG - Intronic
967648839 3:191960685-191960707 CTGAAAATATAAAATTAGCCAGG - Intergenic
968006270 3:195245319-195245341 CTAAAAATACAAAACTAGCTGGG - Intronic
968637505 4:1688784-1688806 CTGAAAATACAAAATTAGCTAGG - Intergenic
968784619 4:2610896-2610918 CTAAAAATACACAACTAGCTGGG - Intronic
969853787 4:9983027-9983049 CTGAAAATACAAAATTAGCTGGG - Intronic
970559737 4:17270750-17270772 CTAAAAATATAAAATTAGCTGGG + Intergenic
970988657 4:22187944-22187966 CTAAAAATACAGAATTAGCTGGG + Intergenic
971314520 4:25556285-25556307 CTACAAATATAAAATTAGCTGGG - Intergenic
971837391 4:31786161-31786183 CTGTAAATACAGATAAAGCTTGG - Intergenic
971921079 4:32940406-32940428 CTAAAAATATAAAATTAGCTAGG - Intergenic
972126917 4:35779043-35779065 CTGAAAATATAAAATTAGCCAGG - Intergenic
972391194 4:38615343-38615365 CTAAAAATATAAAACTAGCTGGG + Intergenic
972566428 4:40273248-40273270 CTAAAAATATAAAATTAGCTGGG + Intergenic
972608306 4:40633907-40633929 CTAAAAATACAAAACTAGCTGGG - Intergenic
972640485 4:40920708-40920730 CTAAAAATATAAAATTAGCTGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974627632 4:64444653-64444675 CAGTAAACATAAACCTAGCTGGG + Intergenic
974813338 4:66973808-66973830 CAGGAAACATAGCACTAGCTGGG + Intergenic
974882577 4:67778165-67778187 CTGAAAATACAAAATTAGCTGGG - Intergenic
975277761 4:72521286-72521308 TTGTAAATATTGACCTAGCACGG - Intronic
975457555 4:74609926-74609948 CTGAAAATATGAAATTAGCTGGG - Intergenic
975565304 4:75748066-75748088 CTGAAAATACAAAATTAGCTGGG - Intronic
975935111 4:79570247-79570269 CTAAAAATACAGAATTAGCTGGG - Intergenic
976046254 4:80951659-80951681 CTTTAAAAATAGAATTTGCTGGG - Intronic
976169284 4:82286217-82286239 CTGAAAATACAAAATTAGCTGGG - Intergenic
976300837 4:83514060-83514082 CTGAAAATACAAAATTAGCTGGG + Intronic
976314175 4:83641788-83641810 CTGAAAATACAAAATTAGCTGGG + Intergenic
976499571 4:85771868-85771890 CTAAAAATATAAAATTAGCTGGG - Intronic
976875914 4:89853342-89853364 CTATAAATACAAAATTAGCTGGG - Intergenic
977210343 4:94211109-94211131 CTAAAAATATAAAATTAGCTGGG + Intronic
977369666 4:96119782-96119804 CTGAAAATATAAAATTAGCCGGG + Intergenic
977894420 4:102347358-102347380 CTGGAAATAAACAACTTGCTGGG - Intronic
978504709 4:109444059-109444081 CTAAAAATACAAAACTAGCTGGG + Intronic
980312973 4:131158748-131158770 CTCTATATATAGAAGTAGATGGG - Intergenic
981296367 4:143137029-143137051 CTGAAAATGTACAAATAGCTGGG + Intergenic
981406187 4:144372450-144372472 CTGAAAATACAAAATTAGCTGGG + Intergenic
981724894 4:147836934-147836956 ATCTAAAAATAGAACTAGTTAGG + Intronic
981938884 4:150260879-150260901 CTAAAAATATAAAATTAGCTGGG + Intergenic
982168881 4:152642078-152642100 CTGAAAATACAAAATTAGCTGGG - Intronic
982280311 4:153677568-153677590 CTGAAAATACAAAATTAGCTGGG - Intergenic
982337708 4:154258536-154258558 CTAAAAATATAAAACTAGCCTGG - Intronic
982757853 4:159245477-159245499 CTGTCACTAAAGAACTATCTTGG + Intronic
982854170 4:160360932-160360954 CTAAAAATACAGAATTAGCTGGG - Intergenic
983236051 4:165180568-165180590 CTAAAAATATAAAATTAGCTGGG - Intronic
983297359 4:165882777-165882799 CTAAAAATATAAAACTAGCCGGG - Intronic
984459363 4:180013655-180013677 CTGTAAATATAAAAATGGGTAGG + Intergenic
984672684 4:182509774-182509796 CTAAAAATACAAAACTAGCTGGG + Intronic
985368311 4:189257752-189257774 CTAAAAATACAAAACTAGCTAGG - Intergenic
985765111 5:1773901-1773923 CTAAAAATATAAAAATAGCTGGG + Intergenic
987047944 5:14124963-14124985 CTGAAAATACAAAATTAGCTGGG + Intergenic
987183471 5:15389921-15389943 CTAAAAATATAAAATTAGCTGGG - Intergenic
987489554 5:18560290-18560312 CTGAAAATACAAAATTAGCTGGG - Intergenic
988292422 5:29305621-29305643 CTAAAAATACAGAATTAGCTAGG - Intergenic
988575220 5:32416451-32416473 CTAAAAATACAGAATTAGCTGGG + Intronic
988791604 5:34613510-34613532 CTAAAAATATAAAATTAGCTGGG - Intergenic
988801822 5:34702865-34702887 CTGAAAATATAGAATTAGCCAGG - Intronic
988822523 5:34901599-34901621 CTAAAAATACAGAATTAGCTGGG + Intergenic
989153354 5:38321345-38321367 CTGTAAATACAGACGAAGCTTGG + Intronic
989388484 5:40876530-40876552 CTAAAAATACAGAATTAGCTGGG + Intergenic
989569018 5:42927665-42927687 CTGAAAATACAAAATTAGCTGGG + Intergenic
989788473 5:45361471-45361493 CTGAAAATACAAAATTAGCTGGG - Intronic
990192511 5:53275736-53275758 CTGTAAAAAGAGAACTTGCAGGG + Intergenic
990215448 5:53526971-53526993 CTAAAAATACAAAACTAGCTGGG - Intergenic
990258139 5:53992883-53992905 CTAAAAATATAAAATTAGCTGGG + Intronic
990696953 5:58429097-58429119 CTGTAAATTAAGACCTAGCATGG + Intergenic
991061329 5:62379499-62379521 CTAAAAATACAGAATTAGCTGGG + Intronic
991441984 5:66660225-66660247 CTGAAAATACAAAATTAGCTGGG + Intronic
991720182 5:69488103-69488125 CTGAAAATACAAAATTAGCTGGG + Intergenic
991770913 5:70040040-70040062 CTTAAAATACAGAATTAGCTGGG - Intronic
991850207 5:70915457-70915479 CTTAAAATACAGAATTAGCTGGG - Intronic
991911024 5:71561238-71561260 CTAAAAATATAAAATTAGCTGGG + Intronic
992109044 5:73475152-73475174 CTCAAAATATAAAATTAGCTGGG + Intergenic
992287085 5:75247101-75247123 CTAAAAATACAAAACTAGCTGGG - Intergenic
992453879 5:76898308-76898330 CTAAAAATACAAAACTAGCTAGG - Intronic
992494032 5:77274115-77274137 GTCTAAAGATAGAACTAGCTGGG - Intronic
992591255 5:78298282-78298304 CTAAAAATATAAAATTAGCTGGG - Intergenic
992667793 5:79027999-79028021 CTGAAAATACAAAATTAGCTGGG - Intronic
993150969 5:84161907-84161929 CTCTAAATTTAGAACTAGGTTGG + Intronic
993483023 5:88448672-88448694 CTGAAAATACAAAAATAGCTGGG + Intergenic
993483043 5:88448805-88448827 CTGAAAATACAAAATTAGCTGGG + Intergenic
993514490 5:88813835-88813857 CTTTGAAAATAGAATTAGCTGGG - Intronic
993681164 5:90879784-90879806 CTGAAAATACAAAATTAGCTGGG + Intronic
994005693 5:94834981-94835003 CTAAAAATACAAAACTAGCTGGG - Intronic
994296769 5:98099278-98099300 CTAAAAATACAAAACTAGCTGGG - Intergenic
994365177 5:98907425-98907447 CTGAAAATACAAAACTGGCTGGG + Intronic
994373782 5:98995449-98995471 CTAAAAATACACAACTAGCTGGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994937430 5:106272965-106272987 CTGAAAATACAAAATTAGCTGGG + Intergenic
995408425 5:111828189-111828211 CTAAAAATATAAAATTAGCTGGG - Intronic
995625539 5:114072129-114072151 CTAAAAATATAAAATTAGCTGGG + Intergenic
995938771 5:117552217-117552239 CTGTACATAGTGAATTAGCTAGG - Intergenic
996607568 5:125341902-125341924 CTAAAAATATAAAATTAGCTGGG - Intergenic
996708725 5:126523048-126523070 CTGAAAATACAAAATTAGCTGGG - Intergenic
996996791 5:129706406-129706428 CTGAAAATACAAAATTAGCTGGG + Intronic
997012363 5:129893719-129893741 CTGAAAATACAAAAATAGCTGGG - Intergenic
997146778 5:131443103-131443125 CTAAAAATACAGAATTAGCTGGG - Intronic
997763198 5:136470769-136470791 CTGGAACTGAAGAACTAGCTTGG - Intergenic
997776325 5:136610119-136610141 CTAAAAATACAGAATTAGCTGGG + Intergenic
997863316 5:137439273-137439295 CTGTCCTTATAGAACTAGTTAGG - Intronic
997954169 5:138265377-138265399 CTAAAAATATAAAATTAGCTGGG - Intronic
997957189 5:138288234-138288256 CTAAAAATATAAAATTAGCTGGG - Intronic
998084760 5:139310960-139310982 CTAAAAATATAAAATTAGCTGGG - Intronic
998259084 5:140614345-140614367 CTAAAAATACAGAATTAGCTGGG + Intergenic
998469044 5:142369051-142369073 CTGTTAATATAAAAATAACTAGG - Intergenic
998564932 5:143208453-143208475 CTGTATATATATAAATAGCATGG - Intronic
998634286 5:143935221-143935243 CTAAAAATATAAAATTAGCTGGG + Intergenic
998696115 5:144641817-144641839 CTAAAAATACAAAACTAGCTGGG - Intergenic
998727653 5:145036290-145036312 CTGAAAATACAAAATTAGCTAGG - Intergenic
998825181 5:146094241-146094263 CTGAAAATACAAAATTAGCTGGG - Intronic
998826126 5:146103318-146103340 CTAAAAATACAGAATTAGCTGGG - Intronic
998834319 5:146189385-146189407 CTAAAAATACAGAATTAGCTGGG - Intergenic
999168907 5:149576082-149576104 CTGAAAATACAAAATTAGCTGGG + Intronic
999386776 5:151159131-151159153 CTAAAAATACAGAATTAGCTGGG - Intergenic
999408889 5:151332860-151332882 CTGTAAATACAGAACTTTCCAGG + Intronic
999879054 5:155840848-155840870 CTGAAAATACAAAATTAGCTGGG + Intergenic
1000086293 5:157890190-157890212 CTAAAAATATAAAATTAGCTGGG + Intergenic
1000323354 5:160152725-160152747 CTAAAAATACAGAATTAGCTGGG - Intergenic
1000917440 5:167099532-167099554 CTAAAAATATAAAATTAGCTGGG + Intergenic
1000977590 5:167782150-167782172 CTTAAAATATAAAATTAGCTGGG + Intronic
1001210673 5:169807460-169807482 CTGGAAATAGAGGAATAGCTGGG + Intronic
1001404478 5:171466244-171466266 CTAAAAATATAAAATTAGCTGGG - Intergenic
1001472909 5:172027830-172027852 CTAAAAATACAAAACTAGCTGGG - Intergenic
1002007174 5:176244880-176244902 CTAAAAATATAAAATTAGCTGGG - Intronic
1002197004 5:177506848-177506870 CTAAAAATACAGAAGTAGCTGGG - Intronic
1002904196 6:1435622-1435644 CTAAAAATACAAAACTAGCTGGG + Intergenic
1003487199 6:6589958-6589980 CTAAAAATATAAAATTAGCTGGG + Intronic
1003821725 6:9905626-9905648 CTAAAAATACAAAACTAGCTGGG - Intronic
1004227801 6:13803220-13803242 CTGAAAATACAAAATTAGCTGGG - Intronic
1004302367 6:14470040-14470062 CTGAAAATACAAAATTAGCTAGG + Intergenic
1004380428 6:15127797-15127819 CTAAAAATATAAAATTAGCTGGG + Intergenic
1004387848 6:15187952-15187974 CTAAAAATATAAAACTAGCCAGG - Intergenic
1004394184 6:15233873-15233895 CTGAAAATACAAAATTAGCTGGG - Intergenic
1004556522 6:16703856-16703878 CTAAAAATACAAAACTAGCTGGG + Intronic
1004948432 6:20641016-20641038 CTGTATATAAAGAAATAGTTTGG + Intronic
1005263066 6:24082506-24082528 CTGAAAATACAAAATTAGCTAGG + Intergenic
1005310300 6:24552764-24552786 CTGAAAATACAAAATTAGCTGGG - Intronic
1005323027 6:24674218-24674240 CTATAAATATAAAATTAGTTGGG - Intronic
1005473648 6:26186434-26186456 CTAAAAATAAAAAACTAGCTGGG - Intergenic
1005728253 6:28670812-28670834 CTGAAAATACAAAATTAGCTGGG - Intergenic
1005954434 6:30653956-30653978 CTAAAAATATAAAATTAGCTGGG + Intronic
1005990931 6:30901526-30901548 ATATATATATAAAACTAGCTGGG + Intergenic
1006181985 6:32159270-32159292 CTAAAAATACAAAACTAGCTGGG + Intronic
1006362733 6:33595957-33595979 CTAAAAATACAAAACTAGCTGGG - Intergenic
1006490787 6:34385843-34385865 CTGAAAATACAAAACTAGCCAGG - Intronic
1006559945 6:34902407-34902429 CTAAAAATACAAAACTAGCTGGG - Intronic
1006598065 6:35208005-35208027 GTGGAAATATAGGACTAGATAGG + Intergenic
1006769098 6:36536695-36536717 CTAAAAATACAGAATTAGCTGGG - Intronic
1006895356 6:37465105-37465127 CTGAAAATACAAAATTAGCTGGG + Intronic
1007459122 6:42004413-42004435 CTGTATATATAGGACTATTTAGG - Intronic
1007531433 6:42546474-42546496 CTAAAAATATAAAATTAGCTGGG + Intergenic
1007676196 6:43597274-43597296 CTAAAAATACAAAACTAGCTGGG - Intronic
1008199457 6:48568220-48568242 CTAAAAATATAAAATTAGCTGGG + Intergenic
1009218191 6:60948287-60948309 CTAAAAATACAGAATTAGCTGGG - Intergenic
1010228611 6:73514808-73514830 CTGAAAATACAAAATTAGCTGGG - Intergenic
1010258540 6:73789054-73789076 CTGTAAATACAGAAACATCTGGG + Intronic
1010394218 6:75372204-75372226 CTAAAAATATAAAATTAGCTGGG + Intronic
1010440393 6:75887478-75887500 CTAAAAATACAAAACTAGCTGGG + Intronic
1010937743 6:81882053-81882075 ATGTAAATATAGAAATGTCTAGG + Intergenic
1010943889 6:81952288-81952310 CTAAAAATATAAAATTAGCTAGG + Intergenic
1010996566 6:82540403-82540425 CTGAAAATACAAAACCAGCTGGG - Intergenic
1011421422 6:87177164-87177186 CTAAAAATACAGAATTAGCTGGG + Intronic
1011660278 6:89588842-89588864 CTAAAAATATAAAATTAGCTGGG + Intronic
1011911304 6:92443700-92443722 CTGTAACTATAGAACCAGTTTGG + Intergenic
1012216999 6:96599354-96599376 CTAAAAATATAAAATTAGCTGGG - Intronic
1012393131 6:98766147-98766169 CTAAAAATACAAAACTAGCTGGG + Intergenic
1012552667 6:100478527-100478549 CTAAAAATATAAAACTAGCCGGG + Intergenic
1013120980 6:107140206-107140228 CTAAAAATATAAAATTAGCTGGG + Intergenic
1013282701 6:108653613-108653635 CAGTAAAAATAGCAATAGCTGGG - Intronic
1013446468 6:110233641-110233663 CTAAAAATACAAAACTAGCTGGG - Intronic
1013511828 6:110851621-110851643 CTAAAAATATAAAATTAGCTGGG - Intronic
1013914369 6:115317173-115317195 CTATAAATACAAAATTAGCTGGG + Intergenic
1014122558 6:117741862-117741884 ATGAAAATATAAAACTTGCTTGG + Intergenic
1014157251 6:118125683-118125705 ATGTTAAGATAGAACCAGCTTGG - Intronic
1014451358 6:121585494-121585516 CTGAAAATACAGAATTAGCTGGG + Intergenic
1014460868 6:121693870-121693892 CTAAAAATACAGAATTAGCTGGG + Intergenic
1015335786 6:132036537-132036559 CTGGAAAGAAAGAACTAGCTGGG - Intergenic
1015550169 6:134403488-134403510 CTAAAAATATAAAATTAGCTGGG - Intergenic
1015550183 6:134403572-134403594 CTAAAAATATAAAATTAGCTGGG - Intergenic
1015663925 6:135605652-135605674 CTGTAAAAATAGTGCTTGCTTGG + Intergenic
1015695197 6:135972071-135972093 CTGAAAATACACAATTAGCTGGG + Intronic
1016031186 6:139340275-139340297 CTGAAAATACAAAATTAGCTGGG - Intergenic
1016206795 6:141477666-141477688 TTGTAAATATAGAAATTCCTAGG + Intergenic
1016456682 6:144237995-144238017 CTGAAAATACAAAATTAGCTGGG - Intergenic
1016555831 6:145336678-145336700 CTGAAAATACAAAATTAGCTGGG + Intergenic
1017198908 6:151731193-151731215 CTAAAAATATAAAATTAGCTGGG + Intronic
1017385362 6:153876476-153876498 CTAAAAATACAGAATTAGCTGGG + Intergenic
1017453003 6:154571981-154572003 CTAAAAATACAAAACTAGCTAGG - Intergenic
1017535179 6:155339961-155339983 CTAAAAATATAAAATTAGCTGGG - Intergenic
1017817388 6:158025789-158025811 CTAAAAATATAAAATTAGCTGGG + Intronic
1017867773 6:158459267-158459289 CTGAAAATACAAAATTAGCTGGG + Intronic
1017914560 6:158821076-158821098 CTAAAAATACAGAATTAGCTGGG + Intergenic
1018104272 6:160468068-160468090 CTGAAAATATAAAATTAGCCAGG - Intergenic
1018136918 6:160787933-160787955 CTGAAAATACAAAACTAGCTGGG - Intergenic
1019377952 7:705863-705885 CTGAAAATATAAAATTAGCCGGG + Intronic
1019405273 7:880178-880200 CTAAAAATACAGAATTAGCTGGG + Intronic
1019442336 7:1053664-1053686 CTGAAAATACAAAATTAGCTGGG + Intronic
1019554533 7:1622213-1622235 CTGAAAATACAAAATTAGCTGGG + Intergenic
1019694226 7:2435973-2435995 CTGAAAATAAAAAACTAGCTGGG - Intergenic
1019833428 7:3356892-3356914 CTAAAAATATAAAATTAGCTGGG + Intronic
1019978062 7:4600415-4600437 CTAAAAATAAAAAACTAGCTGGG + Intergenic
1020087108 7:5316438-5316460 CTGAAAATACAGAATTAGCCAGG - Intronic
1020090473 7:5336446-5336468 TTGTAAGTATAGAACTGGCTAGG + Intronic
1020161368 7:5774908-5774930 CTAAAAATATAAAATTAGCTGGG - Intronic
1020199758 7:6070334-6070356 CTGAAAATACAAAATTAGCTGGG + Intergenic
1020407497 7:7854192-7854214 CTAAAAATACAGAATTAGCTGGG + Intronic
1020661378 7:10987853-10987875 CTGTTAAAACAGATCTAGCTGGG + Intronic
1020668382 7:11074910-11074932 CTGAAAATATGGAAGCAGCTTGG - Intronic
1020770225 7:12381909-12381931 CTTTAAATTGAGAACTATCTGGG + Intronic
1020844155 7:13261563-13261585 CTAAAAATATAAAATTAGCTGGG - Intergenic
1020895817 7:13938104-13938126 CTGAAAATACAAAATTAGCTGGG - Intronic
1020959456 7:14784532-14784554 CTAAAAATATAGAATTAACTGGG - Intronic
1021511140 7:21433777-21433799 CTAAAAATACAGAATTAGCTGGG + Intronic
1021720385 7:23499164-23499186 CTAAAAATACAGAATTAGCTGGG - Intergenic
1021729612 7:23583983-23584005 CTGAAAATACAAAATTAGCTGGG + Intergenic
1021737021 7:23649529-23649551 CTAAAAATATAAAACTAGCTGGG - Intergenic
1022082777 7:27039444-27039466 CTAAAAATACAAAACTAGCTGGG - Intergenic
1022084274 7:27051306-27051328 CTGAAAATACAAAATTAGCTGGG - Intergenic
1022124301 7:27340757-27340779 CTGAAAATACAAAATTAGCTGGG + Intergenic
1022292486 7:29017470-29017492 CTAAAAATATAAAATTAGCTGGG + Intronic
1023403356 7:39806755-39806777 CTAAAAATATAAAATTAGCTGGG + Intergenic
1023853869 7:44168604-44168626 CTGAAAATACAGAATTAGCCAGG - Intronic
1023911279 7:44558644-44558666 CTAAAAATATAAAATTAGCTGGG - Intergenic
1023936467 7:44743558-44743580 CTAAAAATACAGAATTAGCTGGG - Intergenic
1023944454 7:44792704-44792726 CTAAAAATATAAAATTAGCTGGG + Intergenic
1024269788 7:47633689-47633711 CTGAAAATACAAAATTAGCTGGG - Intergenic
1025222374 7:57124910-57124932 CTATAAATACAAAATTAGCTGGG + Intronic
1025633157 7:63296581-63296603 CTATAAATACAAAATTAGCTGGG + Intergenic
1025649539 7:63451602-63451624 CTATAAATACAAAATTAGCTGGG - Intergenic
1025732828 7:64121582-64121604 CTGAAAATACAAAATTAGCTGGG + Intronic
1026071483 7:67124992-67125014 CTAAAAATATAAAATTAGCTGGG - Intronic
1026170937 7:67953339-67953361 CTGAAAATACAAAATTAGCTGGG + Intergenic
1026451652 7:70534585-70534607 CTAAAAATACAGAATTAGCTGGG - Intronic
1026521334 7:71120728-71120750 CTGTTAACATACAACTTGCTTGG + Intergenic
1026624802 7:71982431-71982453 CTAAAAATATAAAATTAGCTGGG + Intronic
1026637176 7:72094413-72094435 CTAAAAATACAGAATTAGCTGGG - Intronic
1026954237 7:74366713-74366735 CTGAAAATACAAAATTAGCTGGG + Intronic
1027005923 7:74692921-74692943 CTAAAAATACAAAACTAGCTGGG - Intronic
1027007177 7:74705077-74705099 CTTTAAATATAGAATTAGTGGGG - Intronic
1027008465 7:74719757-74719779 CTAAAAATACAAAACTAGCTGGG + Intronic
1027393356 7:77727246-77727268 CTAAAAATATAAAACTAGTTGGG - Intronic
1027783521 7:82550306-82550328 CTACAAATACAAAACTAGCTGGG + Intergenic
1028616783 7:92777405-92777427 CTAAAAATATAAAATTAGCTGGG - Intronic
1029020344 7:97358432-97358454 CTAAAAATATAAAATTAGCTGGG + Intergenic
1029083531 7:97993661-97993683 CTAAAAATATAAAATTAGCTGGG + Intergenic
1029164024 7:98573385-98573407 CTGAAAATACAAAATTAGCTAGG + Intergenic
1029463760 7:100712057-100712079 CTGAAAATACAAAATTAGCTGGG + Intergenic
1029626212 7:101721843-101721865 CTGAAAATACAAAATTAGCTGGG + Intergenic
1030289079 7:107854600-107854622 GTGAAAATATAGATGTAGCTGGG + Intergenic
1030352434 7:108504913-108504935 CTAAAAATACAAAACTAGCTGGG + Intronic
1030377744 7:108772945-108772967 CTAAAAATACAAAACTAGCTGGG + Intergenic
1030727483 7:112942541-112942563 CTATAAATACAGAATTAGCCGGG - Intergenic
1030779260 7:113578209-113578231 CTAAAAATATAAAAGTAGCTGGG + Intergenic
1030942232 7:115667492-115667514 CTGAAAATACAAAATTAGCTGGG + Intergenic
1031290178 7:119924467-119924489 CTGAAAATACAAAATTAGCTGGG - Intergenic
1031423075 7:121572506-121572528 CTAAAAATATAAAATTAGCTGGG - Intergenic
1031441165 7:121796227-121796249 CTGTACATTTAGAACTGACTGGG - Intergenic
1031884628 7:127232996-127233018 CTCTAAATACAAAATTAGCTGGG - Intronic
1032022094 7:128413107-128413129 CTGAAAGTACAAAACTAGCTGGG - Intergenic
1032134193 7:129259913-129259935 CTAAAAATACAAAACTAGCTGGG + Intronic
1032184218 7:129709889-129709911 CTGAAAATACAAAATTAGCTGGG - Intronic
1032186676 7:129732761-129732783 CTGAAAATACAAAAATAGCTGGG - Intronic
1032247076 7:130222316-130222338 CTAAAAATATAAAATTAGCTGGG - Intergenic
1032343099 7:131094104-131094126 CTAAAAATATAAAACTAGCTGGG + Intergenic
1032393385 7:131571469-131571491 CTGAAAATACAAAACTAGCTGGG + Intergenic
1032442312 7:131951329-131951351 CTAAAAATACAGAATTAGCTGGG + Intergenic
1032553961 7:132812368-132812390 CTGAAAATACAAAAATAGCTGGG - Intronic
1032619572 7:133514323-133514345 CTAAAAATATAAAATTAGCTGGG - Intronic
1032684807 7:134222767-134222789 CTGAAAATACAAAATTAGCTAGG - Intronic
1033058459 7:138081741-138081763 CTAAAAATACAGAATTAGCTGGG - Intronic
1033060731 7:138104534-138104556 CTAAAAATATAAAACTAGCCGGG + Intronic
1033114887 7:138616495-138616517 CTAAAAATATAAAATTAGCTGGG - Intronic
1033126040 7:138708209-138708231 CTGAAAATACAAAATTAGCTGGG - Intronic
1033126556 7:138712091-138712113 CTAAAAATATAAAATTAGCTGGG - Intronic
1033167422 7:139052442-139052464 CTGAAAATACAAAATTAGCTGGG + Intronic
1033195917 7:139327192-139327214 CTGAAAATACAAAATTAGCTGGG - Intergenic
1033198430 7:139347424-139347446 CTAAAAATACAGAATTAGCTGGG + Intronic
1033456395 7:141507531-141507553 CTAAAAATATAAAATTAGCTGGG - Intergenic
1033770769 7:144549186-144549208 CTAAAAATATAAAATTAGCTGGG - Intronic
1033798094 7:144871312-144871334 CTAAAAATATAAAATTAGCTGGG - Intergenic
1034183781 7:149158671-149158693 CTGAAAATACAAAATTAGCTGGG + Intronic
1034211064 7:149363614-149363636 CTGAAAATATAAAATTAGCCAGG + Intergenic
1034353767 7:150434590-150434612 CTGAAAATACAAAATTAGCTGGG + Intergenic
1034643032 7:152620095-152620117 CTGAAAATAAAAAATTAGCTGGG + Intergenic
1037071238 8:14652178-14652200 CTGAAAATACAAAATTAGCTGGG + Intronic
1037097748 8:15005490-15005512 CTGAAAATACAAAATTAGCTGGG - Intronic
1037157275 8:15718515-15718537 GTGAAAATATAGACCTGGCTGGG + Intronic
1037176061 8:15947054-15947076 TTGTAAATATAAAATCAGCTGGG - Intergenic
1037466274 8:19163538-19163560 CTGAAAATACAAAATTAGCTGGG + Intergenic
1037597083 8:20363324-20363346 CTGAAAATACAAAATTAGCTGGG - Intergenic
1037794343 8:21979204-21979226 CTGAAAATATAAAATTAGCCGGG - Intronic
1038074582 8:24057394-24057416 CTAAAAATATAAAATTAGCTGGG - Intergenic
1038098574 8:24344450-24344472 CTGTGTATATAGAACAAGATTGG - Intronic
1038322749 8:26543646-26543668 CTAAAAATATAAAATTAGCTGGG - Intronic
1038657330 8:29465761-29465783 CTGTAAATATAGATGAAGCTTGG - Intergenic
1038801037 8:30749230-30749252 CTGAAAATACAAAACTAGCCAGG + Intronic
1039027812 8:33277075-33277097 CTGAAAATACAAAATTAGCTGGG + Intergenic
1039360714 8:36873799-36873821 CTGTAAATATTGGAATTGCTTGG + Intronic
1039533337 8:38284546-38284568 CTAAAAATATAAAATTAGCTGGG - Intronic
1039562519 8:38524091-38524113 CTAAAAATATAAAATTAGCTAGG + Intronic
1039812229 8:41059343-41059365 CTGAAAATACAGAATTAGCCAGG + Intergenic
1039942341 8:42101993-42102015 CTAAAAATACAGAATTAGCTGGG + Intergenic
1040503318 8:48024432-48024454 CTGAAAATACAAAATTAGCTGGG + Intronic
1041232180 8:55764909-55764931 CTAAAAATATAAAATTAGCTGGG + Intronic
1041259719 8:56010414-56010436 TTGTAAACATAGAGCTAGTTGGG - Exonic
1041537991 8:58949563-58949585 CTGCATTTATAGAACTAGTTGGG + Intronic
1041918774 8:63161364-63161386 CTGAAAATATAAAATTAGCCTGG - Intergenic
1042374690 8:68036782-68036804 CTAAAAATATAAAATTAGCTGGG + Intronic
1043239787 8:77918439-77918461 CTGAAAATACAAAATTAGCTGGG - Intergenic
1043457701 8:80428950-80428972 CTAAAAATACAAAACTAGCTAGG - Intergenic
1044062921 8:87661833-87661855 CTAAAAATATAAAACTAGCTGGG + Intergenic
1044488609 8:92784517-92784539 CTGTAACTATAAAAGTAACTTGG - Intergenic
1044591752 8:93919364-93919386 CTGAAAATACAGAATTAGCCGGG + Intronic
1044824762 8:96185339-96185361 CTACAAACATAAAACTAGCTAGG + Intergenic
1044906955 8:97014487-97014509 CTAAAAATATAAAACTAGCTGGG + Intronic
1044916913 8:97123776-97123798 TTTTAAATATAAAAATAGCTAGG + Intronic
1044976397 8:97669753-97669775 CTGAAAATACAAAATTAGCTGGG + Intronic
1045224436 8:100230782-100230804 CTAAAAATATAAAATTAGCTGGG - Intronic
1045303698 8:100937967-100937989 CTAAAAATACAGAATTAGCTGGG + Intronic
1046306850 8:112379306-112379328 CTAAAAATATAAAATTAGCTGGG + Intronic
1046364618 8:113210714-113210736 CTGAAAATACAAAATTAGCTGGG + Intronic
1046639421 8:116710364-116710386 CTGAAAATACAGATCAAGCTGGG - Intronic
1047069165 8:121323204-121323226 CTGAAAATACAAAATTAGCTGGG + Intergenic
1047127775 8:121981579-121981601 CTGAAAATACAAAATTAGCTAGG + Intergenic
1047378760 8:124334462-124334484 CTGAAATTATAAAATTAGCTGGG + Intronic
1047784849 8:128144147-128144169 CTGAAAATACAAAATTAGCTTGG + Intergenic
1047950899 8:129933711-129933733 GTGAAAATATAAAATTAGCTGGG + Intronic
1048079551 8:131110590-131110612 CTAAAAATACAGAATTAGCTGGG - Intergenic
1048531215 8:135252103-135252125 CTAAAAATATAAAATTAGCTGGG + Intergenic
1048675909 8:136779891-136779913 CTGAAAATAAAAAATTAGCTGGG - Intergenic
1048732387 8:137457751-137457773 CAGGCAATATAGAACTGGCTGGG - Intergenic
1048738683 8:137530791-137530813 CTGAAAATGTGGAAGTAGCTTGG + Intergenic
1049105899 8:140612597-140612619 CTATAAATATAAAATTAGCCGGG + Intronic
1049122158 8:140748330-140748352 CTAAAAATACAGAATTAGCTGGG + Intronic
1049649444 8:143758301-143758323 CTGAAAATACAAAATTAGCTGGG + Intergenic
1049764228 8:144346070-144346092 CTAAAAATATAGAATTAGCCAGG + Intergenic
1049765194 8:144352057-144352079 CTAAAAATATAAAATTAGCTGGG - Intergenic
1050112652 9:2232675-2232697 CTAAAAATACAAAACTAGCTGGG + Intergenic
1050238229 9:3605716-3605738 CTAAAAATACAGAATTAGCTGGG - Intergenic
1050457684 9:5849319-5849341 CTGTAAAAATCAAACTAACTGGG - Intergenic
1050470608 9:5985622-5985644 CTGAAAATACAGAATTAGCCGGG + Intronic
1050778994 9:9306400-9306422 CTAAAAATAAAAAACTAGCTGGG + Intronic
1050922812 9:11227723-11227745 CTCAAAACATAGAACTAACTAGG - Intergenic
1050990882 9:12150219-12150241 CTACAAAAATAAAACTAGCTGGG - Intergenic
1051045723 9:12871139-12871161 CTGAAAATACAGAAGTAGCTTGG + Intergenic
1051256072 9:15215394-15215416 CTAAAAATACAAAACTAGCTGGG + Intronic
1052734373 9:32325195-32325217 CTGAAAATACAAAATTAGCTGGG - Intergenic
1052813162 9:33079209-33079231 CTATAAATAATGAACAAGCTTGG - Intergenic
1052908378 9:33857477-33857499 CTAAAAATATAAAACTAGCCAGG - Intronic
1052922090 9:33979412-33979434 CTGAAAATACAAAATTAGCTGGG + Intronic
1053030511 9:34773149-34773171 CTAAAAATACAAAACTAGCTGGG - Intergenic
1053338794 9:37303822-37303844 CTAAAAATACAAAACTAGCTGGG - Intronic
1053431353 9:38043726-38043748 CTAAAAATACAAAACTAGCTGGG + Intronic
1053571825 9:39317916-39317938 CTAAAAATATAAAATTAGCTGGG + Intergenic
1053622353 9:39832749-39832771 CTAAAAATATAAAATTAGCTGGG + Intergenic
1053796805 9:41734015-41734037 CTAAAAATATAAAATTAGCTGGG + Intergenic
1053882786 9:42612433-42612455 CTAAAAATATAAAACTAGCTGGG - Intergenic
1053889883 9:42681869-42681891 CTAAAAATATAAAACTAGCTGGG + Intergenic
1054093381 9:60876624-60876646 CTAAAAATATAAAATTAGCTGGG + Intergenic
1054114864 9:61152545-61152567 CTAAAAATATAAAATTAGCTGGG + Intergenic
1054125320 9:61301095-61301117 CTAAAAATATAAAATTAGCTGGG - Intergenic
1054148385 9:61580854-61580876 CTAAAAATATATAATTAGCTGGG - Intergenic
1054185219 9:61946090-61946112 CTAAAAATATAAAATTAGCTGGG + Intergenic
1054221813 9:62419902-62419924 CTAAAAATATAAAACTAGCTGGG - Intergenic
1054228901 9:62489271-62489293 CTAAAAATATAAAACTAGCTGGG + Intergenic
1054468129 9:65511948-65511970 CTAAAAATATAAAATTAGCTGGG - Intergenic
1054592892 9:67029988-67030010 CTAAAAATATAAAATTAGCTGGG - Intergenic
1054653290 9:67642406-67642428 CTAAAAATATAAAATTAGCTGGG - Intergenic
1054717302 9:68568961-68568983 CTAAAAATATAAAATTAGCTGGG - Intergenic
1054842903 9:69761799-69761821 CTAAAAATATAAAATTAGCTGGG + Intergenic
1055955934 9:81773521-81773543 CTGAAAATACAAAATTAGCTGGG - Intergenic
1056234335 9:84577010-84577032 CTAAAAATACAGAATTAGCTGGG + Intergenic
1056242444 9:84661539-84661561 CTAAAAATATATAATTAGCTGGG - Intergenic
1056342716 9:85653496-85653518 CACTAAATAAAGAACTTGCTGGG + Intronic
1056375947 9:86011079-86011101 CTGAAAATACAAAATTAGCTGGG + Intronic
1056377659 9:86030048-86030070 CTGAAAATACAAAATTAGCTGGG + Intronic
1056644438 9:88398734-88398756 CTGAAAATACAAAATTAGCTGGG - Intronic
1056801163 9:89692886-89692908 CTGAAAATACAAAATTAGCTAGG + Intergenic
1056813586 9:89783146-89783168 CTAAAAATATAAAACTAGCCAGG + Intergenic
1057113438 9:92497461-92497483 CTGAAAATACAAAATTAGCTGGG + Intronic
1057613020 9:96563487-96563509 CTAAAAATACAAAACTAGCTGGG + Intronic
1057827843 9:98384427-98384449 CTAAAAATATAAAATTAGCTGGG + Intronic
1057992491 9:99785037-99785059 GTGTAAATATGGAATTATCTAGG + Intergenic
1058973978 9:110109154-110109176 CTGAAAATAGAAAATTAGCTGGG + Intronic
1059293582 9:113249525-113249547 CTAAAAATATAAAATTAGCTGGG - Intronic
1059491720 9:114673309-114673331 CTAAAAATACAAAACTAGCTGGG + Intergenic
1059852019 9:118352775-118352797 CTGAAAATACAAAATTAGCTGGG + Intergenic
1059959514 9:119551541-119551563 CTAAAAATATAAAATTAGCTGGG + Intergenic
1060504921 9:124190493-124190515 CTAAAAATATAAAATTAGCTGGG + Intergenic
1060535002 9:124378823-124378845 CTGGAAATATGGCATTAGCTTGG - Intronic
1060564694 9:124579847-124579869 CTGAAAATACATAATTAGCTGGG + Intronic
1061114176 9:128598107-128598129 CTGAAAATACAAAATTAGCTGGG - Intronic
1061321294 9:129831583-129831605 CTGAAAATACAAAATTAGCTGGG - Intronic
1061323555 9:129848133-129848155 CTAAAAATATAAAATTAGCTGGG + Intronic
1061439980 9:130595063-130595085 CTGAAAATACAAAATTAGCTGGG + Intronic
1061596966 9:131637062-131637084 CTAAAAATATAAAATTAGCTGGG + Intronic
1061772558 9:132937280-132937302 CTGAAAATACAAAACTAGCCAGG + Intronic
1061803104 9:133122863-133122885 CGAAAAATACAGAACTAGCTGGG - Intronic
1061986581 9:134133602-134133624 CTGAAAATACAAAATTAGCTGGG + Intergenic
1062306498 9:135909919-135909941 CTAAAAATACAAAACTAGCTGGG - Intergenic
1062488791 9:136794284-136794306 CTAAAAATACAGAATTAGCTGGG - Intronic
1062489496 9:136798456-136798478 CTAAAAATACAAAACTAGCTGGG - Intronic
1062512000 9:136911423-136911445 CTGAAAATACAAAATTAGCTGGG - Intronic
1062617533 9:137404697-137404719 CTAAAAATATAAAATTAGCTGGG + Intronic
1062664548 9:137661961-137661983 CTAAAAATATAAAATTAGCTGGG - Intronic
1185496653 X:559689-559711 CTAAAAATATAAAATTAGCTGGG - Intergenic
1185546693 X:951340-951362 CTAAAAATATAAAATTAGCTGGG + Intergenic
1185611011 X:1393577-1393599 CTAAAAATATAAAATTAGCTGGG - Intergenic
1185651627 X:1652141-1652163 CTAAAAATATAAAATTAGCTGGG - Intergenic
1185659409 X:1714887-1714909 CTGAAAATACAAAATTAGCTGGG + Intergenic
1185741515 X:2536736-2536758 CTGAAAATACAAAACTAGCCAGG + Intergenic
1185808385 X:3081237-3081259 CTAAAAATATAAAATTAGCTAGG + Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187063288 X:15808780-15808802 CTAAAAATATAAAATTAGCTGGG - Intronic
1187531497 X:20100858-20100880 CTAAAAATATAAAATTAGCTGGG + Intronic
1187553675 X:20331035-20331057 CTGGAAATATAGAACAAGGTAGG - Intergenic
1187790095 X:22941384-22941406 CTGCAAATATAGAGAGAGCTGGG + Intergenic
1188191297 X:27174415-27174437 CTAGAAATATAAAATTAGCTGGG - Intergenic
1188348884 X:29102503-29102525 CTAAAAATACAGAATTAGCTGGG + Intronic
1189916846 X:45863977-45863999 CTAAAAATATAAAACTAGCCAGG + Intergenic
1189932311 X:46026462-46026484 CTGAAAATACAAAATTAGCTGGG - Intergenic
1190252910 X:48740724-48740746 CTAAAAATATAAAAATAGCTGGG + Intergenic
1190574313 X:51817634-51817656 CTGTACATCTAGAAAAAGCTCGG - Intronic
1190719842 X:53138499-53138521 CTAAAAATACAGAATTAGCTGGG + Intergenic
1192107869 X:68333472-68333494 CTAAAAATACAGAATTAGCTGGG + Intronic
1192481420 X:71489513-71489535 CTGAAAATACAAAATTAGCTGGG + Intronic
1193232437 X:79064232-79064254 CTAAAAATACAGAATTAGCTGGG - Intergenic
1193826784 X:86235970-86235992 CTGAAAATACAAAACTAGCTGGG + Intronic
1194003366 X:88459419-88459441 CTAAAAATATAAAATTAGCTGGG + Intergenic
1194293029 X:92098806-92098828 CTATAAATACAAAATTAGCTGGG - Intronic
1194391999 X:93330408-93330430 CTAAAAATACAGAATTAGCTGGG - Intergenic
1194640349 X:96396563-96396585 CTGAAAATACAAAATTAGCTGGG - Intergenic
1195633101 X:107080415-107080437 CTAAAAATACAAAACTAGCTGGG + Intronic
1195689099 X:107609434-107609456 CTGAAAATACAAAATTAGCTGGG - Intergenic
1195693792 X:107651600-107651622 CTAAAAATATAAAATTAGCTGGG - Intergenic
1195951223 X:110275667-110275689 CTAAAAATATAAAATTAGCTGGG + Intronic
1196432435 X:115641386-115641408 CTAAAAATATAAAACTAGCTGGG - Intronic
1197396868 X:125938421-125938443 TTTTAAATATACATCTAGCTTGG + Intergenic
1197552899 X:127916833-127916855 CTATAAAGAGAGAATTAGCTGGG + Intergenic
1197737620 X:129863413-129863435 CTGAAAATACAAAAATAGCTGGG + Intergenic
1198200426 X:134411111-134411133 CTAAAAATACAAAACTAGCTGGG - Intronic
1198866745 X:141131186-141131208 CTAAAAATATAAAATTAGCTGGG - Intergenic
1198871417 X:141180133-141180155 CTAAAAATATAAAATTAGCTGGG - Intergenic
1199090558 X:143687057-143687079 CTGAAAATACAAAATTAGCTGGG + Intergenic
1200610538 Y:5323356-5323378 CTATAAATACAAAATTAGCTGGG - Intronic
1200773921 Y:7152646-7152668 CTGAAAATACAAAACTAGCTGGG + Intergenic
1201173008 Y:11288786-11288808 CTGCAGATTTAGAACTAACTTGG - Intergenic
1201256950 Y:12117335-12117357 CTAAAAATACAAAACTAGCTGGG - Intergenic
1201360396 Y:13140724-13140746 CTAAAAATATAAAATTAGCTGGG + Intergenic
1201852595 Y:18502807-18502829 CTAAAAATACAAAACTAGCTGGG + Intergenic
1201880726 Y:18817577-18817599 CTAAAAATACAAAACTAGCTGGG - Intronic
1202345940 Y:23927072-23927094 CTAAAAATACAAAACTAGCTGGG - Intergenic
1202524831 Y:25743018-25743040 CTAAAAATACAAAACTAGCTGGG + Intergenic