ID: 1142957305

View in Genome Browser
Species Human (GRCh38)
Location 17:3530649-3530671
Sequence GTCTCTCGTCACCACCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142957305_1142957308 -4 Left 1142957305 17:3530649-3530671 CCAGGCAGGTGGTGACGAGAGAC 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1142957308 17:3530668-3530690 AGACACCACGCCCTACAGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 155
1142957305_1142957310 3 Left 1142957305 17:3530649-3530671 CCAGGCAGGTGGTGACGAGAGAC 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1142957310 17:3530675-3530697 ACGCCCTACAGGGAGGCCCGTGG 0: 1
1: 0
2: 0
3: 5
4: 96
1142957305_1142957315 15 Left 1142957305 17:3530649-3530671 CCAGGCAGGTGGTGACGAGAGAC 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1142957315 17:3530687-3530709 GAGGCCCGTGGGACTTCGGTAGG 0: 1
1: 0
2: 0
3: 3
4: 67
1142957305_1142957311 4 Left 1142957305 17:3530649-3530671 CCAGGCAGGTGGTGACGAGAGAC 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1142957311 17:3530676-3530698 CGCCCTACAGGGAGGCCCGTGGG 0: 1
1: 0
2: 0
3: 6
4: 72
1142957305_1142957307 -7 Left 1142957305 17:3530649-3530671 CCAGGCAGGTGGTGACGAGAGAC 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1142957307 17:3530665-3530687 GAGAGACACCACGCCCTACAGGG 0: 1
1: 0
2: 1
3: 8
4: 170
1142957305_1142957306 -8 Left 1142957305 17:3530649-3530671 CCAGGCAGGTGGTGACGAGAGAC 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1142957306 17:3530664-3530686 CGAGAGACACCACGCCCTACAGG 0: 1
1: 0
2: 1
3: 36
4: 586
1142957305_1142957314 11 Left 1142957305 17:3530649-3530671 CCAGGCAGGTGGTGACGAGAGAC 0: 1
1: 0
2: 1
3: 13
4: 140
Right 1142957314 17:3530683-3530705 CAGGGAGGCCCGTGGGACTTCGG 0: 1
1: 0
2: 1
3: 22
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142957305 Original CRISPR GTCTCTCGTCACCACCTGCC TGG (reversed) Intronic
900638195 1:3675882-3675904 CTCTCCCCTCACCACCTGACAGG - Intronic
903012350 1:20340117-20340139 TTCTCTCGCCCCCTCCTGCCTGG + Intronic
903585953 1:24415484-24415506 GTTGCTCGCCTCCACCTGCCCGG - Intronic
903889372 1:26559177-26559199 GTCACTCGGCACCACCACCCTGG - Intronic
905386343 1:37606797-37606819 GTCTCTCGTCACCAAGAACCTGG + Intergenic
905949730 1:41939395-41939417 GAGACTCGTCAGCACCTGCCTGG - Intronic
907190676 1:52645359-52645381 GTCTCTGGTCTCCACCAGGCTGG - Intronic
909907795 1:81220951-81220973 GCCTCTCGGCACCAACAGCCTGG + Intergenic
910345824 1:86236349-86236371 ATCTCTTTTCACCACCTTCCTGG - Intergenic
914226941 1:145728390-145728412 GTCTATCCTCACCACCAGACTGG - Exonic
914998890 1:152569728-152569750 GTCTCTCTTGACTACCTCCCTGG + Intronic
918184690 1:182116341-182116363 TTCTCTGGTCACCACCACCCTGG - Intergenic
922868526 1:228881435-228881457 GTCTCTCATCTCCACATCCCTGG + Intergenic
924577734 1:245295618-245295640 CACTCTCGTCACCTCCTTCCTGG - Intronic
1069902875 10:71715988-71716010 GTCCCTCGACAGCCCCTGCCGGG - Exonic
1070304936 10:75234415-75234437 AGCTCTGGTCACCTCCTGCCCGG - Intronic
1070386981 10:75934616-75934638 GTCTCTCTTCCCCACTAGCCAGG - Intronic
1071462965 10:85915988-85916010 TTCTCTCGTTCCCACCTGCCAGG + Intronic
1072528428 10:96295631-96295653 GTCTTTCATCACCACCTGGGAGG - Intergenic
1074903921 10:117843700-117843722 GTCTCTCATCACCCCCAGACAGG + Intergenic
1075009787 10:118857768-118857790 GTCTCACCTGTCCACCTGCCTGG - Intergenic
1076550746 10:131276707-131276729 TTTTCTCTACACCACCTGCCAGG + Intronic
1076616178 10:131756445-131756467 GCTCCTCGCCACCACCTGCCTGG + Intergenic
1078510258 11:11979573-11979595 GTCCCTCCTCACCAACTTCCTGG - Intronic
1082773133 11:57224285-57224307 GTCTCAGGCCACCCCCTGCCTGG + Intergenic
1083053820 11:59800756-59800778 GTCTTTCCTCCCCACCTTCCAGG + Intronic
1083727680 11:64636983-64637005 TTCTCTCCTCAGCACCTCCCTGG - Intronic
1083954695 11:65976935-65976957 CCCACTGGTCACCACCTGCCAGG - Intronic
1086033585 11:82389252-82389274 GCCGCTCACCACCACCTGCCTGG - Intergenic
1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG + Intronic
1094492745 12:30971137-30971159 GCCTCTCATCCCAACCTGCCTGG + Intronic
1095925536 12:47575568-47575590 GGCTATCATCACCACCTTCCAGG + Intergenic
1098543963 12:71690383-71690405 GTCTCAAGTGATCACCTGCCTGG + Intronic
1099103873 12:78477335-78477357 GTCTCTGGTCACCTCCTGGGAGG + Intergenic
1099687402 12:85907882-85907904 GCCTCTGGCCACCTCCTGCCAGG + Intergenic
1101441393 12:104706689-104706711 GGCTCTCAACACCACCTGCCTGG + Intronic
1103320025 12:120087052-120087074 TGCTCTCGGCGCCACCTGCCGGG + Intronic
1106428591 13:29657874-29657896 GTCTCTGGCCAGCACCAGCCTGG - Intergenic
1106821263 13:33467237-33467259 GTCTCCCGTCACCCCCAGACAGG - Intergenic
1113812837 13:113152996-113153018 GTCTCTCCTCCCCACTGGCCCGG - Intergenic
1120135912 14:80868059-80868081 GTCTCCCCCCACCCCCTGCCAGG - Intronic
1120844077 14:89111453-89111475 GTCACCTCTCACCACCTGCCTGG - Intergenic
1121095910 14:91217901-91217923 GTTTCTCTCCAGCACCTGCCTGG + Intronic
1123043036 14:105498283-105498305 GTCACTCCTCCACACCTGCCTGG + Intronic
1125502605 15:40248751-40248773 GTCTCACGTGACAGCCTGCCTGG + Intronic
1127555989 15:60088264-60088286 GTCTCTCATCACCACCTGTTTGG - Intergenic
1128698680 15:69788230-69788252 GCCCCTCATCATCACCTGCCTGG + Intergenic
1129279217 15:74470693-74470715 GTCTCTCATCACCCCCAGACGGG - Intergenic
1129675203 15:77629577-77629599 GTCTCTTCTCAACCCCTGCCTGG + Intronic
1130743150 15:86622899-86622921 GTCTCTCATCACCTCCAGACGGG - Intronic
1130914154 15:88291505-88291527 GTCTCTCATCACTGCCTGACTGG + Intergenic
1132645707 16:998403-998425 GGCTCTGGGCGCCACCTGCCTGG - Intergenic
1135324854 16:21519870-21519892 GCCGCTCTTCCCCACCTGCCCGG - Intergenic
1136403551 16:30030880-30030902 GCCTCCCCTCCCCACCTGCCTGG - Exonic
1142037059 16:87868927-87868949 GCCGCTCTTCCCCACCTGCCCGG - Exonic
1142160109 16:88552961-88552983 GTCACACGTGACCACCAGCCGGG - Intergenic
1142250421 16:88989393-88989415 GTCTGTCGTCGCCACCTGGGAGG - Intergenic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1148163168 17:45463323-45463345 CTCTCTGCTCCCCACCTGCCTGG - Intronic
1151705265 17:75764011-75764033 GTCTCTCCTCACCACCTCTGAGG - Exonic
1152091349 17:78249478-78249500 GTCTCTCCTCTCCACCTCCCAGG - Intergenic
1152792449 17:82288775-82288797 GTGTATGGTCTCCACCTGCCGGG - Intergenic
1155087561 18:22472945-22472967 TTCCCTCCTCACCACCTGGCTGG - Intergenic
1160700008 19:501694-501716 GCCTCCCGACACCACCTCCCCGG + Exonic
1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG + Exonic
1160700025 19:501742-501764 GTCTCCCGACACCACCTCCCAGG + Exonic
1160700032 19:501766-501788 GCCTCCCGACACCACCTCCCCGG + Exonic
1161655414 19:5511390-5511412 CTCTCTCATCACTAGCTGCCTGG + Intergenic
1161717035 19:5882102-5882124 GCCCCTCATCACCACCTCCCAGG + Intronic
1161976305 19:7609742-7609764 GTCTCTCATCACCCCCAGCTGGG - Intronic
1162364935 19:10242827-10242849 GGTTCTCGCCAACACCTGCCTGG + Intergenic
1164323709 19:24173946-24173968 GTCTCTCATCACCACCAGATGGG - Intergenic
1164670415 19:30069191-30069213 CTCTCCCCTCACCAGCTGCCAGG + Intergenic
1165813585 19:38627309-38627331 GTGTGTCGTCACTTCCTGCCCGG + Intronic
1165918386 19:39275809-39275831 GTCTACTGTCACCTCCTGCCTGG - Intergenic
1166177589 19:41085983-41086005 GTCTCTCCCCACCCCCTCCCTGG + Intergenic
1167241822 19:48348376-48348398 CTCTCTCCTCCCCACCCGCCTGG + Intronic
1168636349 19:58000128-58000150 GTGTCTGGTCACAACCTTCCTGG + Intronic
926457257 2:13082217-13082239 TTCTCCAGTCACCACCTGTCTGG + Intergenic
926518866 2:13884182-13884204 GTCTCTAGTCACCATGTGCCTGG + Intergenic
931836977 2:66109267-66109289 GCCTCTAGTAACCACCAGCCAGG - Intergenic
938027136 2:127959434-127959456 GTCTCTCATTACAACCTGGCCGG - Intronic
938135881 2:128756041-128756063 GTCCCACGGGACCACCTGCCAGG + Intergenic
947746201 2:232508490-232508512 GCCCCTCCTCCCCACCTGCCAGG - Intergenic
947944742 2:234091882-234091904 TGCTCTCGTCACCACGAGCCTGG - Intergenic
1170684397 20:18555971-18555993 GTCTCCCGTCACCCCCAGCTGGG - Intronic
1173589122 20:44210565-44210587 GTCTCCCGACGCCTCCTGCCTGG - Intronic
1173806034 20:45925894-45925916 GTCTCCCTTCCCCAGCTGCCAGG + Intergenic
1175963540 20:62648794-62648816 GCCTCTTGTCCCCACCGGCCAGG + Intronic
1176102977 20:63372888-63372910 CGCACTCGTCCCCACCTGCCTGG + Intronic
1176723679 21:10413123-10413145 GTCTGTCGCCACCAACTGCAGGG + Intergenic
1178503007 21:33141144-33141166 GTCTCAGGTTACCACCTGCCGGG - Intergenic
1179002644 21:37477557-37477579 GGCTCTCGACACCATCTGACAGG - Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179521960 21:41951489-41951511 GTCTCTCCTGACCTCCTGCCTGG - Intronic
1180304835 22:11065900-11065922 GTCTGTCGCCACCAACTGCAGGG + Intergenic
1181305707 22:21916269-21916291 GCCTCACGTCACCTCTTGCCTGG + Intergenic
1182711729 22:32327506-32327528 GTCTCTCTTCAGCTCCTCCCTGG - Intergenic
1184399255 22:44264294-44264316 GTCTCTCTTCAGCTCCTCCCTGG - Intronic
1184469978 22:44690865-44690887 GTCTCCCGCCACGCCCTGCCAGG - Intronic
1184749657 22:46478014-46478036 GTCTCCAGACAACACCTGCCAGG + Intronic
1185140772 22:49099983-49100005 GTGGCTCCTCACAACCTGCCTGG - Intergenic
949895436 3:8764700-8764722 GACTCTGGCCACCACCAGCCTGG - Intronic
950451092 3:13066362-13066384 CTCTGTTGTCACCAGCTGCCCGG - Intronic
952890874 3:38039689-38039711 GGCACGCGTCAGCACCTGCCAGG + Intronic
953494712 3:43376058-43376080 GCCTCTTGTCACCAACTGGCTGG + Intronic
955533110 3:59894929-59894951 GTCTGTTCTCATCACCTGCCAGG - Intronic
960273441 3:115699456-115699478 GTGTCTAGACACCAGCTGCCTGG - Intronic
964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG + Intronic
966727227 3:183118598-183118620 ATCTATTCTCACCACCTGCCAGG - Intergenic
968950259 4:3687827-3687849 GGCTCACGCCACCACCTGCCTGG - Intergenic
969306445 4:6328692-6328714 GTCTCTCAACCCCACCTGCCTGG - Intronic
981367472 4:143919994-143920016 GTCACTCCTCTCCACCTGCTTGG + Intergenic
981377262 4:144030228-144030250 GTCACTCCTCTCCACCTGCTCGG + Intergenic
982646195 4:158027344-158027366 GCCTCTAGTCACCCCCTGCCAGG + Intergenic
984839143 4:184051985-184052007 GTCTCCCTGCCCCACCTGCCAGG - Intergenic
985539862 5:482892-482914 GTCCCTCGTCACCATCCACCCGG + Intronic
987401052 5:17477300-17477322 TTCTGTCTTCACCAGCTGCCAGG + Intergenic
990865177 5:60372298-60372320 CTCTCTGGTTACCACCTGCAAGG + Intronic
994943786 5:106359296-106359318 GTCTCTCGTCACCCCCAGATGGG + Intergenic
997630005 5:135360282-135360304 GTCTCCCTTCCCCAGCTGCCAGG + Intronic
1001821397 5:174713126-174713148 GACTCTAGTCGCCACCAGCCAGG - Intergenic
1005605905 6:27477296-27477318 GCTTCTCGCCACCACCTTCCAGG - Intergenic
1006022057 6:31123121-31123143 GTCTCTCCTGGCCTCCTGCCAGG + Intronic
1006299525 6:33186151-33186173 GTCTCTGGCCCCCACCTACCTGG - Intronic
1010027770 6:71239763-71239785 GGCCCTGGTCACCAGCTGCCTGG + Intergenic
1010585208 6:77650454-77650476 GGCTCTGGTGACCACCTGCGGGG + Intergenic
1018728829 6:166633959-166633981 TGCTCTCGTCTCCACTTGCCTGG - Intronic
1019783664 7:2959591-2959613 GCCTGTCGCCACCACCTCCCCGG - Intronic
1022351731 7:29572532-29572554 TTCTTTCCCCACCACCTGCCTGG + Intergenic
1024101596 7:46037824-46037846 GCCTTTAGTCAACACCTGCCAGG - Intergenic
1026317092 7:69236539-69236561 GACTCTTGTCACATCCTGCCAGG + Intergenic
1031500287 7:122506128-122506150 CTGCCTCGTCACCACTTGCCAGG + Intronic
1031949194 7:127874173-127874195 GTGTCTCTGCCCCACCTGCCAGG + Intronic
1033245845 7:139715620-139715642 CTCTCTCTCCACCACCTGTCTGG + Intronic
1034269228 7:149795625-149795647 GACTATCGTGACCTCCTGCCTGG + Intergenic
1034434346 7:151056050-151056072 GGCTCTGGTCCCCACCTTCCTGG + Intronic
1036171986 8:6496171-6496193 GTCTCTCGTCACCCCCCGATGGG - Intronic
1038662289 8:29507549-29507571 CTCTCTCCTCCCCACCTGCTTGG - Intergenic
1045273197 8:100679382-100679404 TTCTCTCCTCTCCACTTGCCAGG + Intergenic
1045665319 8:104478205-104478227 TTCTCTTGTCTCCACCTCCCAGG + Intergenic
1046584212 8:116131445-116131467 TTCTCTTGTCACCACCTTGCAGG - Intergenic
1046762577 8:118036751-118036773 GTGTCTCTTAACCACCTTCCAGG + Intronic
1047607385 8:126488608-126488630 AGCCCTGGTCACCACCTGCCTGG - Intergenic
1048241647 8:132748373-132748395 GCCTCTTCTCACCATCTGCCAGG - Intronic
1056396556 9:86186756-86186778 GGCCCTGATCACCACCTGCCTGG + Intergenic
1057690128 9:97276517-97276539 GTGGCTCGGCCCCACCTGCCTGG + Intergenic
1057822681 9:98344591-98344613 CTCTCTCTTGACCATCTGCCTGG + Intronic
1061572054 9:131483934-131483956 CTCTGTCCTCACCACCTGCAGGG + Intronic
1061913545 9:133737675-133737697 GTGCCCCTTCACCACCTGCCTGG + Intronic
1062143080 9:134970943-134970965 GTCTCTCGTCACCTCCAGGTGGG + Intergenic
1189144610 X:38643065-38643087 GTCTTTCCTCATCATCTGCCTGG - Intronic
1193016648 X:76741337-76741359 GGCCCTGGTCACCAGCTGCCTGG + Intergenic
1196828706 X:119759774-119759796 GTCTCCTGTAACCACCGGCCTGG + Exonic
1198286249 X:135194683-135194705 CTCTGTTGTCACCACCGGCCTGG + Intergenic