ID: 1142959506

View in Genome Browser
Species Human (GRCh38)
Location 17:3543691-3543713
Sequence CCCCGTAGGCAGCTCTGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142959506 Original CRISPR CCCCGTAGGCAGCTCTGGCG GGG (reversed) Intronic
900244322 1:1630544-1630566 ACGCGAAGGCAGCTCGGGCGCGG - Exonic
900393146 1:2442565-2442587 CCCCTTTCTCAGCTCTGGCGAGG + Intronic
900984328 1:6064780-6064802 CCCAGAAGGCAGCTCTGACCAGG + Intronic
901098593 1:6701984-6702006 GCGCCTAGGCAGCCCTGGCGGGG + Intergenic
901190119 1:7404714-7404736 TCCCGTAGGCGGCTCTGGTGAGG - Intronic
903950616 1:26994041-26994063 CCCCGGAGGGGGCTCTGGCGCGG + Exonic
904701952 1:32362969-32362991 GCCCGATGGCAGCTCTGGAGTGG + Intronic
906145611 1:43558476-43558498 CCTCGTATGCAGTCCTGGCGGGG - Intronic
911040215 1:93585247-93585269 TCCCTTATGCAGCTCTGGCCAGG - Intronic
914012803 1:143792421-143792443 CCCGATAGGCACCTCTGGGGCGG + Intergenic
914165026 1:145168762-145168784 CCCGATAGGCACCTCTGGGGCGG - Intergenic
914651428 1:149701030-149701052 CCCGATAGGCACCTCTGGGGCGG + Intergenic
914908182 1:151763538-151763560 CGCCGCAGGCAGCACTGGCGGGG - Exonic
915265002 1:154710427-154710449 CCCCGTGGGGAGATCTGGGGAGG - Intronic
916629118 1:166592931-166592953 CCCAGTAGGCAGGACTGGCATGG - Intergenic
920253615 1:204639041-204639063 CCCCCTGGGTAGCTCTGGAGAGG + Intronic
924787324 1:247210591-247210613 CTCCGGAGGCAGCTGTGGGGAGG + Intergenic
1063614155 10:7587892-7587914 CCCCGTCGGCCCCTCTGGCTAGG + Intronic
1067669686 10:48307208-48307230 CCCCGGAGGCAGCCAGGGCGCGG - Intronic
1068523885 10:58106377-58106399 CCCCGCAGGCAGGGCTGGCCAGG + Intergenic
1069951025 10:72018172-72018194 TCCAGGGGGCAGCTCTGGCGTGG - Intergenic
1075287738 10:121201794-121201816 CCAGGTAGGCAGCTCTGGGAAGG - Intergenic
1075567479 10:123515148-123515170 CCCCCGAGGCTGCTCTGGAGAGG + Intergenic
1075782655 10:125027015-125027037 CCCCGAAGGCAGCACAGGGGTGG - Exonic
1076401605 10:130188977-130188999 CCCTGAAGGCAGGTCTGACGCGG + Intergenic
1076488904 10:130843239-130843261 CCCCAGAGGCAGCTTTAGCGGGG + Intergenic
1094090600 12:26644950-26644972 CCCCGTAGGCAGCTCTGGAATGG - Intronic
1101834923 12:108288466-108288488 CCCCAGAGTCAGCTCTGGTGGGG - Exonic
1102344370 12:112149833-112149855 CCTCCTGGGCAGCTCTGGTGAGG - Exonic
1104717231 12:131024167-131024189 CCCCCCAGGCCGCTCTGCCGGGG - Intronic
1104722520 12:131052814-131052836 AGCCGTAGGTAGCTCTGGAGGGG + Intronic
1104987023 12:132603035-132603057 CCCAGAAGGCCGCTCTGGCACGG + Intergenic
1105851616 13:24340529-24340551 CCCCGAAGGCAGGTGTGGTGGGG + Intergenic
1109647514 13:65278046-65278068 CTCAGTAGGCAGTTCTGGCTTGG + Intergenic
1114670694 14:24409329-24409351 CCCTGTTGGCAGCACTGGAGCGG - Exonic
1119651867 14:76389559-76389581 CCATGGAGGCAGCTCTGGCTTGG + Intronic
1120506185 14:85355730-85355752 CCCCCTAGGCAGCTTTGGGATGG + Intergenic
1122902305 14:104786937-104786959 CCCCCTGGGCAGGCCTGGCGGGG - Intronic
1128086285 15:64888815-64888837 CCCTGGAGTCAGCTCTGACGAGG - Intronic
1130088317 15:80797139-80797161 TCCCGTAGGCAGTTCTGGCCAGG - Intronic
1130221400 15:82022591-82022613 CCCAGTAGGTAGCTGTGGGGGGG - Intergenic
1132566896 16:627689-627711 CCACGTAGGCGGCACTGGCCTGG - Exonic
1132658201 16:1049970-1049992 CCCTGGAGGCAGCCCTGGGGAGG + Intergenic
1132891664 16:2207780-2207802 GCCCGTAGGCTGCTGTGGCGTGG + Intronic
1136398383 16:30005127-30005149 CCCCCAGGGCAGCTCTGGGGAGG - Intronic
1136605567 16:31331212-31331234 CATCGTGGGCAGCTCTGTCGGGG + Exonic
1137584941 16:49658714-49658736 CCCTGAAGGCAGCTGTGGCAGGG + Intronic
1138480145 16:57297362-57297384 CTCTGGAGGCAGCTCTGGCCAGG - Intergenic
1138491970 16:57382296-57382318 GCCCGTCGGCAGCTCTGGGGAGG - Exonic
1141410609 16:83830310-83830332 CCCCATACGCAGCACTGGCCAGG - Intergenic
1142959506 17:3543691-3543713 CCCCGTAGGCAGCTCTGGCGGGG - Intronic
1151147270 17:72053050-72053072 CTCCAGAGGCAGCTCTCGCGGGG - Intergenic
1151809315 17:76427966-76427988 CAGAGTAGGCAGCTCTGGGGAGG - Intronic
1152706525 17:81846392-81846414 CCCGGGAGGCAGCCCTGGCCCGG + Intronic
1160749737 19:728158-728180 GCCCGCAGGAAGCTCGGGCGGGG + Intronic
1161114479 19:2489064-2489086 CACCGGAGGGAGCGCTGGCGAGG - Intergenic
1162736355 19:12749039-12749061 CCCCCTAGCCAGCTCTGGCTTGG - Intergenic
1164596036 19:29531056-29531078 CCTGGTAGGCAGCTCTGGGGCGG + Intronic
926213749 2:10890814-10890836 CCCCCTGGGGAGCTCTGGAGTGG - Intergenic
929052924 2:37853260-37853282 CTCAGTCGGCAGGTCTGGCGTGG - Intergenic
929133689 2:38602817-38602839 CCCGGGAGGAAGCTCTGGAGCGG + Exonic
929996273 2:46828110-46828132 CCCAGTGGGCAGCTCTGCCCTGG + Intronic
937349862 2:121153917-121153939 GCCAGTGGGCAGCTCTGGAGGGG + Intergenic
938282077 2:130071587-130071609 CCCCGTAAGCAGGTGTGGCCAGG + Intergenic
938332703 2:130460159-130460181 CCCCGTAAGCAGGTGTGGCCAGG + Exonic
938357104 2:130660512-130660534 CCCCGTAAGCAGGTGTGGCCAGG - Intergenic
938379138 2:130826925-130826947 CCCCACAGCCAGCTCTGGCCAGG + Intergenic
938433538 2:131267318-131267340 CCCCGTAAGCAGGTGTGGCCAGG - Intronic
949044825 2:241867555-241867577 CCACGTAAGCAGCTCTTGCAGGG + Intergenic
1169140416 20:3224459-3224481 GCCCACAGGCAGCTCTGGAGAGG + Intergenic
1171147574 20:22799080-22799102 CCCAGTAAGCCGCTCTGGTGGGG + Intergenic
1174130910 20:48342755-48342777 CCTCGAAGGCAGCCCTGGGGAGG + Intergenic
1174606784 20:51767565-51767587 CCCCGAGGGCAGCTTAGGCGCGG - Intronic
1175339406 20:58218674-58218696 CCCCCTTGGCATCTCTGTCGTGG + Exonic
1176890796 21:14316239-14316261 CACTGTAGACAGCTCTGGCCAGG - Intergenic
1178877708 21:36425457-36425479 CCCTGGAGGCTGCTCTGGCCTGG - Intergenic
1179647322 21:42783959-42783981 CGCCTTATGCAGCTCAGGCGGGG - Intergenic
1182096718 22:27630677-27630699 ACCCACAGGCAGCTCTGGGGTGG - Intergenic
1184310129 22:43635927-43635949 CCACGCAGGCAGCTCTGTCTGGG - Intronic
1185068198 22:48642374-48642396 CCCCACAGGCAGCCCTGGTGCGG + Intronic
1185128337 22:49023993-49024015 CCCGGCAGGCAGCCCTGTCGTGG + Intergenic
949560344 3:5195775-5195797 CCACGTTGGCAGCTCAGGCATGG - Intronic
952743861 3:36760166-36760188 CCTCCTAGGCAGGTCTGGCCTGG - Intergenic
953886453 3:46717138-46717160 CCCCACAGCCAGCTCAGGCGAGG + Intronic
964110147 3:153079130-153079152 CCCCCTAGGCAGCGCTGGAGGGG - Intergenic
968837120 4:2973163-2973185 CCCCGTGGGCTGCACTGACGTGG + Intronic
987140315 5:14939148-14939170 CCCACTAGGCAGCTCTGTCTTGG - Intergenic
998443572 5:142181428-142181450 CCCCGCAAGCAGCCCTGGCAGGG - Intergenic
1002099723 5:176851425-176851447 CCCCGGCCCCAGCTCTGGCGGGG + Intronic
1002437217 5:179238922-179238944 CCCAGTAGGCAGATCTAGAGAGG + Intronic
1019524923 7:1476555-1476577 CCCCGCAGGCAGGTCTTGGGAGG - Exonic
1019530431 7:1500353-1500375 CACCGTGGGCAGCACTGGCCGGG + Exonic
1019916208 7:4134425-4134447 CCCAGCAGACAGCTGTGGCGAGG + Intronic
1060189114 9:121581138-121581160 CCCCTGAGGCAGCTCAGGTGAGG + Intronic
1062601153 9:137319139-137319161 CCCCGTGGGCAGCTCCAGGGCGG + Intronic
1062633291 9:137477067-137477089 CCCAGAAGGCAGCCCTGGCCTGG + Intronic
1189325201 X:40107463-40107485 CCGCCTGAGCAGCTCTGGCGCGG - Intronic
1190598007 X:52065951-52065973 CCCCTTGGTCAGCTCTGCCGAGG + Intronic
1190610817 X:52188122-52188144 CCCCTTGGTCAGCTCTGCCGAGG - Intronic
1195884645 X:109625521-109625543 CCCCTAAGGCAGCTCTGCCTTGG + Intronic
1198518811 X:137432288-137432310 CTCCCAAGGCAGCTCTGGTGGGG + Intergenic