ID: 1142964438

View in Genome Browser
Species Human (GRCh38)
Location 17:3571990-3572012
Sequence CTCTCCCAATGCCAGCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142964438_1142964444 7 Left 1142964438 17:3571990-3572012 CCCTACAGCTGGCATTGGGAGAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1142964444 17:3572020-3572042 TGCTCATGACCAGCCCCTCATGG 0: 1
1: 0
2: 0
3: 20
4: 161
1142964438_1142964447 18 Left 1142964438 17:3571990-3572012 CCCTACAGCTGGCATTGGGAGAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1142964447 17:3572031-3572053 AGCCCCTCATGGAGGCCCTGAGG 0: 1
1: 0
2: 0
3: 27
4: 280
1142964438_1142964451 22 Left 1142964438 17:3571990-3572012 CCCTACAGCTGGCATTGGGAGAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1142964451 17:3572035-3572057 CCTCATGGAGGCCCTGAGGCAGG 0: 1
1: 0
2: 3
3: 50
4: 401
1142964438_1142964445 10 Left 1142964438 17:3571990-3572012 CCCTACAGCTGGCATTGGGAGAG 0: 1
1: 0
2: 1
3: 16
4: 146
Right 1142964445 17:3572023-3572045 TCATGACCAGCCCCTCATGGAGG 0: 1
1: 1
2: 0
3: 7
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142964438 Original CRISPR CTCTCCCAATGCCAGCTGTA GGG (reversed) Intronic
900577751 1:3392113-3392135 CTCTCCCAAGGCCAGGTGAGAGG + Intronic
902415339 1:16235565-16235587 CTCCACCACTGCTAGCTGTATGG - Intronic
904450888 1:30610745-30610767 CTCTGCCATTGCCAGCTGTGTGG + Intergenic
912219584 1:107657655-107657677 CTCTCCCTATGGTAGCTGTGTGG - Intronic
915324624 1:155074784-155074806 CTCTCCCTATGTTAGCTGTTAGG + Intergenic
918118526 1:181517324-181517346 CTCTCCCCATGCCACCTGCCAGG - Intronic
919534654 1:198772836-198772858 CTCTCACAATGCTGGCTTTAAGG + Intergenic
922128988 1:222758083-222758105 CTGTCCCACAGCCAGCTGGATGG - Intergenic
1064743091 10:18453192-18453214 CTCTCCCCACGACAGCTGGAGGG + Intronic
1065410123 10:25416969-25416991 CTCACCCAGTGCCAGCAGGAAGG + Intronic
1065652498 10:27907261-27907283 CTCTCTCACTGCAGGCTGTAAGG + Intronic
1066692627 10:38045865-38045887 CTCACCTAGGGCCAGCTGTAAGG - Intronic
1067000149 10:42603236-42603258 CTCACCTAGGGCCAGCTGTAAGG + Intronic
1070077733 10:73154381-73154403 CTGCCACAATGCCAGCTGGAAGG + Exonic
1070444224 10:76479343-76479365 CTCTCACAAAGCCAGCTTCATGG + Intronic
1073667387 10:105549096-105549118 CTCTCTCAGTCCCAGTTGTAGGG + Intergenic
1074644789 10:115435435-115435457 CTCACCAGATGCCAGCTGTTTGG + Intronic
1084620099 11:70263939-70263961 CTATCCCAACGCCAGGTATAGGG - Intergenic
1084953759 11:72680659-72680681 CACTCCCACTGCCAACTCTAAGG + Intergenic
1087088541 11:94244566-94244588 CTCTCTCCATGCCAGGTGTCAGG - Intergenic
1088045174 11:105442487-105442509 CTCTCCCAATGCCCTCTCTCAGG - Intergenic
1089680901 11:120118350-120118372 CTCTCCCACTCCCAGCTGTGGGG - Intronic
1090674739 11:128980681-128980703 CTCTTCCAATGTCAGCAGTTTGG + Exonic
1090828049 11:130401788-130401810 CTCTCCCAATGCGAGCTCAGCGG + Intergenic
1091249690 11:134132697-134132719 CCCTCCCTATGCCAGGAGTATGG + Intronic
1091997758 12:5008356-5008378 TTTTCCCAATGCCAGGTGAAAGG - Intergenic
1092965981 12:13642846-13642868 CTCTGCCAAAGCCAGCTCCATGG - Intronic
1096860763 12:54526285-54526307 CTCTGCCACTGCCAGCTGTGTGG + Intronic
1098544363 12:71694952-71694974 CTCCCCCAATGCTATCTGTTAGG + Intronic
1099919770 12:88943111-88943133 ATCTCCCAATACTAGCTCTATGG + Intergenic
1100397796 12:94199724-94199746 CTTTCCCAGTGCCAACTGTCTGG - Intronic
1103165192 12:118764494-118764516 GTTTCCCAATTCCAGCTGTGTGG + Intergenic
1104564782 12:129870832-129870854 CACTCCAGATGCCAGCTGTAGGG - Intronic
1105236259 13:18556075-18556097 CTCTCCCCATGCTGGCTCTAGGG + Intergenic
1106787706 13:33123655-33123677 CTCACCCACAGCCAGCTGCAAGG + Intronic
1108452361 13:50579869-50579891 CTCTTTCAGTGCCGGCTGTATGG - Intronic
1110470520 13:75854658-75854680 CTCTCTCCATGGCAGCTGTTAGG + Intronic
1113224471 13:108144322-108144344 GTCTCCCAGTGCCTCCTGTAGGG + Intergenic
1115456493 14:33609869-33609891 ATGTCCTAATGCCAGCTGTGGGG + Intronic
1117963399 14:61184107-61184129 CTCTCCCAAAGCCAGTCTTAGGG - Intergenic
1119441395 14:74631130-74631152 TCCTCCCCATGCCAGCTGGACGG + Intergenic
1126260731 15:46687343-46687365 TTCTCCAAATGCCAGCTGTAGGG + Intergenic
1126892124 15:53217865-53217887 ATCTCCAAGTGCCAGCTGTGTGG + Intergenic
1129727667 15:77909789-77909811 CTCTCCAACTGCCAGCTGATTGG + Intergenic
1130258682 15:82337805-82337827 CTCTCCAACTGCCAGCTGATTGG + Intergenic
1130270003 15:82441279-82441301 CTCTCCAACTGCCAGCTGATTGG - Intergenic
1130462336 15:84168592-84168614 CTCTCCAACTGCCAGCTGATCGG - Intergenic
1130473957 15:84247514-84247536 CTCTCCAACTGCCAGCTGATCGG - Intergenic
1130481369 15:84361582-84361604 CTCTCCAACTGCCAGCTGATCGG - Intergenic
1130490336 15:84426193-84426215 CTCTCCAACTGCCAGCTGATTGG + Intergenic
1130501928 15:84504951-84504973 CTCTCCAACTGCCAGCTGATCGG + Intergenic
1130596238 15:85252154-85252176 CTCTCCAACTGCCAGCTGATCGG - Intergenic
1132185300 15:99798174-99798196 CTCTCCAACTGCCAGCTGATTGG - Intergenic
1132233104 15:100199736-100199758 CTCTCCCAAGGTCACCTGGATGG + Intronic
1132431687 15:101766388-101766410 CTCTCCAACTGCCAGCTGATTGG + Intergenic
1132571386 16:645901-645923 CTCTCCCAAGCCCAGCTTCATGG + Intronic
1132826726 16:1908979-1909001 CTCTCCGCATGGCAGCTGGAGGG - Intergenic
1132881133 16:2162197-2162219 CCCTTCCAATGCCACCTGGAAGG - Intronic
1133129040 16:3664850-3664872 CTCTGCCATAGCCAGCTGTGAGG - Exonic
1133524292 16:6589306-6589328 TTCACCCAGAGCCAGCTGTATGG + Intronic
1134628676 16:15741294-15741316 CAGTCCCAATCCCAGCTGTGTGG + Intronic
1139293210 16:65876483-65876505 CTGTCCCAGTGCCAGGTGTTGGG + Intergenic
1142275699 16:89117774-89117796 CTCTCCCTGTGCCATCTGTCTGG - Intronic
1142803969 17:2362037-2362059 CACTCCCAATGCCAGCATTCTGG + Intronic
1142964438 17:3571990-3572012 CTCTCCCAATGCCAGCTGTAGGG - Intronic
1144273293 17:13640772-13640794 TTCTCCCAAGGCCAGCTCTGAGG + Intergenic
1145784321 17:27584316-27584338 CTCTCCCAGTGCATGCTGTTAGG + Intronic
1146930992 17:36777970-36777992 TTCAACAAATGCCAGCTGTATGG - Intergenic
1147169033 17:38607393-38607415 CTCTCCCTCTGCCAACTGGATGG + Intergenic
1147319642 17:39637975-39637997 CTGTCCCAATGGCCGCTGGATGG - Intronic
1151053020 17:71000860-71000882 TTCTCCAATTACCAGCTGTAAGG + Intergenic
1153652098 18:7249854-7249876 ATCTCCCAAGCCCAGTTGTAGGG + Intergenic
1154307305 18:13239981-13240003 CTCTCCTCATGCCAGTTGTAGGG + Intronic
1154513278 18:15133923-15133945 CTCTCCCCATGCTGGCTCTAGGG - Intergenic
1161166810 19:2792060-2792082 CTGTCCCCATGCCAGCTGCCTGG + Intronic
1161545567 19:4878242-4878264 CCCTCCCAGTGCCAGCTGCCAGG + Intergenic
1162847670 19:13405999-13406021 CTTTCCATATGCCAGCTTTATGG + Intronic
1166543984 19:43623264-43623286 CCCCCCCACTGCCAGCTGCAAGG - Exonic
926612258 2:14958259-14958281 CTCTCCCACAGCCAGCTGCCTGG + Intergenic
928855564 2:35799119-35799141 CTTTCTTAGTGCCAGCTGTAAGG - Intergenic
929676123 2:43931778-43931800 ATCTGCCAATGCCACCTTTAAGG - Intronic
929947098 2:46379952-46379974 CTCTCCCCATCCCACCTGTCCGG - Intronic
932885436 2:75545343-75545365 CTCTCCCAATTCCAGGAGCAAGG - Intronic
933582122 2:84139398-84139420 CTCTCCCAATGCCTAATGTTGGG - Intergenic
937113880 2:119389536-119389558 TTCTCACAGAGCCAGCTGTATGG + Intergenic
938073341 2:128319410-128319432 CTGTCCCAAAGCCAGCCGCAGGG - Intergenic
938513527 2:131978534-131978556 CTCTCCCCATGCTGGCTCTAGGG - Intergenic
943075165 2:183185770-183185792 CTCTCCTCACCCCAGCTGTAGGG + Intergenic
943270012 2:185788112-185788134 CTCTCCCAGTCCCTGCTGAAAGG - Intronic
943278918 2:185905349-185905371 CTCTCCCAATCCCAGCTCTCTGG - Intergenic
944339623 2:198580773-198580795 CTCTCCAAAAGCCTGCTGTGGGG + Intergenic
945046242 2:205784447-205784469 CACTCTCAATGCCAGCTGTGGGG - Intronic
945418218 2:209601000-209601022 TTCTCACAATGACAGCTGTATGG + Intronic
946068494 2:217010704-217010726 CCCAACCAAAGCCAGCTGTAAGG + Intergenic
947958802 2:234217484-234217506 GCCTCCCAATGCCAGGTGGAAGG - Intergenic
1172235843 20:33373570-33373592 CTGTCCCAAGGCAAGCTGTATGG - Intronic
1175949843 20:62577596-62577618 CTCGCCCAAGGGCAGCTGGAGGG + Intergenic
1176215529 20:63946019-63946041 CTCACCCAATGCCAGCGGACAGG + Intronic
1177977921 21:27873382-27873404 CTCTCCCCATGCTGGCTCTAGGG + Intergenic
1178254660 21:31041190-31041212 TTCTCACAGAGCCAGCTGTATGG - Intergenic
1179079076 21:38153507-38153529 CTTTTGCAATGCCAGCTGAAAGG - Intronic
1180147651 21:45930212-45930234 CTATGGCAAGGCCAGCTGTAAGG - Intronic
1180623961 22:17181669-17181691 CTCTCCCCAGGCCAGCAGCAAGG + Intronic
1180900588 22:19369194-19369216 CTCTCCTAAGGCCAGGTGTCAGG - Intronic
1181855024 22:25775249-25775271 CTATCCTGATGCCAGATGTAGGG - Intronic
1183781185 22:39999947-39999969 CTCTCCCAAAGCAAACTGTGTGG - Intronic
1185161585 22:49233099-49233121 CGCTCTCAATACCAGCTATAGGG - Intergenic
1185216940 22:49606635-49606657 TTCTCCGAAAGCCAGTTGTAAGG - Intronic
953425761 3:42796552-42796574 TTCACCCAAAGCCAGCTGTGTGG + Intronic
954417859 3:50402852-50402874 CTCACCCAATGCTATCTGCATGG - Intronic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
963113794 3:141708539-141708561 CTTTCCCAATGACTGCTCTATGG - Intergenic
966316105 3:178647134-178647156 GTCTGCTAATGCCAGTTGTAAGG + Intronic
969344415 4:6562363-6562385 CTCTCCCACTGGCAGCTGTGTGG + Intronic
969592360 4:8129214-8129236 CACTCTCAATGCCATCTTTAAGG + Intronic
969882550 4:10187116-10187138 CTCTCCAAATCCCAGATTTAAGG - Intergenic
970434814 4:16023220-16023242 CTCTCCCCAAGCCAGCTCTCAGG + Intronic
971104018 4:23501495-23501517 CTTTCCCAAAGCCAGCTGTTTGG + Intergenic
975994146 4:80295056-80295078 CTTTTCCAATCCCAGCTGTAAGG - Intronic
982213546 4:153060438-153060460 ATCACCAAATGCCAGCTGAATGG - Intergenic
982340957 4:154298130-154298152 CTCTCACAATGACAGTTGTCTGG + Exonic
985294715 4:188423499-188423521 CTCTCACAATTCCAGCCTTATGG - Intergenic
988497394 5:31756840-31756862 CTCTTCCAATGCCTGCCCTAGGG - Intronic
998159587 5:139805935-139805957 CTCTCCCTGTGGCAGCTGGAGGG - Intronic
998491711 5:142552173-142552195 CTCTCCAAAAGCCAACTGTTAGG + Intergenic
1001561458 5:172671931-172671953 CTCTCCACTTGCCAGCTGTGTGG + Intronic
1002918971 6:1552402-1552424 CTCTCCCAATTACATCTGCAGGG + Intergenic
1003333165 6:5146452-5146474 CTCTCCCTTTTCCAGCTCTATGG - Intronic
1005693797 6:28332922-28332944 ATCTCCCAATGCCAAATGTTTGG - Intronic
1007693250 6:43716267-43716289 CTCTCCCCCTGGCAGCTGTTTGG - Intergenic
1012425557 6:99110412-99110434 CTCTCACAATTCAAGCAGTAGGG + Intergenic
1014759678 6:125342680-125342702 CTCCCCCAAAGCCAGGTGTGGGG - Intergenic
1016733279 6:147449048-147449070 CTCTCCTCATGCCAGCTGAATGG - Intergenic
1018634392 6:165848287-165848309 CTCCCCAAATGGCAGCTGTGTGG - Intronic
1020264382 7:6550910-6550932 CTCTCCCAGGGCCAGAGGTAAGG - Intronic
1024477196 7:49825678-49825700 CTCTGCTAATCCCAGCTGTAAGG + Intronic
1025190731 7:56893642-56893664 CTGTCCCAAGGCCAGCAGGAGGG + Intergenic
1025681212 7:63683282-63683304 CTGTCCCAAGGCCAGCAGGAGGG - Intergenic
1026393864 7:69930906-69930928 CTATCCCAGTGCCATCTTTAAGG + Intronic
1026954008 7:74365492-74365514 CTCTCTCAATGACAGCTGGTAGG - Intronic
1029202893 7:98850946-98850968 CTGCCCCAATGCCAGCTTTGTGG - Intronic
1033804049 7:144935018-144935040 CTCTCCAAAGACCAGCTCTAAGG + Intergenic
1034555674 7:151849031-151849053 CTCTCCCAATGGCTCCTGCAGGG + Intronic
1039868145 8:41523608-41523630 AACACCCAATGCCAGCTGCATGG - Intergenic
1044921383 8:97172983-97173005 CTTTCCAAATGGCAGCTTTAAGG - Intergenic
1045695992 8:104809391-104809413 ATATACCAATGTCAGCTGTACGG - Intronic
1047515854 8:125554410-125554432 TTTTCCCACTCCCAGCTGTATGG + Intergenic
1047976607 8:130136835-130136857 CTGTTCCAATGCCAACTGTGAGG + Intronic
1049272009 8:141700963-141700985 GGCTCCCACTGCCAGCTGTGGGG - Intergenic
1053509021 9:38671490-38671512 CCCTGCCTATGCCAGGTGTATGG - Intergenic
1054972011 9:71098928-71098950 CTCTCCCAGAGCCATCAGTATGG + Intronic
1056892926 9:90513136-90513158 CTCTCCAAAAGCCAGATTTAGGG + Intergenic
1057261617 9:93587694-93587716 CTCCCCCAGTGCCAGTTGGAGGG + Intronic
1057365886 9:94420340-94420362 CTCCCCCAATCCCAGCTCTGTGG - Intronic
1060590300 9:124812059-124812081 CTGTCCCAATGCCAGCTCCCTGG + Exonic
1062641628 9:137521577-137521599 CTGTCCCGATGCCAGCTGCATGG + Intronic
1186806221 X:13142956-13142978 CACTCCCAATGCCTGCTGCAAGG + Intergenic
1190714057 X:53089059-53089081 CTCCCCCAAGCCCAGCTCTAGGG - Intergenic
1193600698 X:83505977-83505999 CTCGCCCAAAGGCAGCTGCAAGG + Intergenic
1195153457 X:102097624-102097646 CTCCCCCAGTGCTAGCTCTAAGG + Intergenic
1196506193 X:116446227-116446249 CTCTCTTAATGGTAGCTGTAAGG + Intronic
1196521479 X:116678693-116678715 CTCTCTTAATGGTAGCTGTAAGG - Intergenic
1198891554 X:141402898-141402920 CTCCCCCTATACCAGCTGTGCGG - Intergenic
1201558763 Y:15292572-15292594 CTCTTTCATTTCCAGCTGTAGGG + Intergenic