ID: 1142964694

View in Genome Browser
Species Human (GRCh38)
Location 17:3573286-3573308
Sequence GGGTGGTCCTGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 11, 3: 44, 4: 548}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142964694_1142964699 -4 Left 1142964694 17:3573286-3573308 CCTTCTTCCCTCCAGGACCACCC 0: 1
1: 0
2: 11
3: 44
4: 548
Right 1142964699 17:3573305-3573327 ACCCAGACCACAGCCAAGCACGG 0: 1
1: 0
2: 2
3: 22
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142964694 Original CRISPR GGGTGGTCCTGGAGGGAAGA AGG (reversed) Intronic
900101765 1:964948-964970 GCGTGCTCCTGGGGGGAAGGCGG - Exonic
900490991 1:2949080-2949102 GGCTGGCCCTGGAGGGCAGCTGG - Intergenic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
901558516 1:10050803-10050825 GGGAGGCCGAGGAGGGAAGATGG - Intronic
902378113 1:16039744-16039766 TGGTGGTGCTGGAGGGATGTCGG - Intergenic
902383202 1:16062240-16062262 TGGTGGTGCTGGAGGGATGTCGG - Intronic
902400240 1:16153453-16153475 GGGTGCTGCTGATGGGAAGAGGG - Intronic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
902992856 1:20201722-20201744 GGGAGCTCCTGGAGGGCAGTGGG - Intergenic
903282325 1:22257139-22257161 TTGTGATCCTGCAGGGAAGAAGG - Intergenic
903888950 1:26557131-26557153 GGCTGGTACAGGAGGGAAGCCGG + Intronic
904330611 1:29755763-29755785 GGGAGGGCCTGGCTGGAAGAAGG - Intergenic
904416063 1:30361832-30361854 GGGAGGGCCTGGCTGGAAGAAGG + Intergenic
904599422 1:31665478-31665500 GGATGGTCCTGGGGAGAAGAGGG - Intronic
904699258 1:32348606-32348628 GGCTGGGCTGGGAGGGAAGATGG - Intergenic
905425596 1:37881421-37881443 GTGTGGTGCTCCAGGGAAGAGGG - Intronic
905861611 1:41355622-41355644 GGGAGGGCCTGGTGGGAGGAGGG + Intergenic
906257140 1:44359083-44359105 TGGTGGTCATGGTGGGAAGAGGG - Intergenic
906417664 1:45633629-45633651 GGGTGGTGCTGGAGGGACTCTGG + Exonic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
907497556 1:54854931-54854953 GGGCAGAGCTGGAGGGAAGAGGG - Intronic
908486299 1:64597086-64597108 GGGGGGTGCTGGAGGGGAGGCGG + Intronic
909471217 1:76030519-76030541 GGGTGTTCCTTGAGGTTAGAAGG + Intergenic
911053956 1:93695139-93695161 GGGTGGGCAGGGAAGGAAGAAGG - Intronic
912420721 1:109540563-109540585 TGAAGGTCCTGGAGGTAAGAGGG + Intronic
912723443 1:112039191-112039213 TGGTGGTTCAGGAGGGAAGCAGG - Intergenic
915008253 1:152660807-152660829 GGCTGGTCCCTGAGGGAACATGG + Intergenic
915010704 1:152683532-152683554 GGGTGGTCCCTGAGGGAGCATGG + Intergenic
915276819 1:154794755-154794777 AGGTGGCACTGGAGGGAGGAAGG + Intronic
915313467 1:155015910-155015932 AGGTGGTCCTGGAGGGACTGGGG + Intronic
916099994 1:161386388-161386410 GGGTGGGCCTGTAGGTAAGGTGG + Intergenic
916763591 1:167839015-167839037 AGGTGGTGCTGTAGTGAAGATGG - Intronic
918725033 1:187910167-187910189 TGATGGTCCTGATGGGAAGAAGG + Intergenic
918824223 1:189301034-189301056 GGGTGGGCCTGGAGGAAAGAAGG - Intergenic
919397111 1:197064849-197064871 GGGCAGTCATGGATGGAAGAAGG + Intronic
919896698 1:202013479-202013501 TGGTGGTCCTGGAGAGGAGGAGG + Intronic
919920205 1:202162763-202162785 GGAAGGTTCTGGAGGGGAGAGGG - Intergenic
920052668 1:203173103-203173125 GGGATTTCCTGGAGAGAAGAGGG - Intronic
920137022 1:203778242-203778264 GGGTGCTTCTAGAGGGAAGGAGG - Intergenic
920285407 1:204875297-204875319 GGGAGGCACTGAAGGGAAGATGG + Intronic
920741447 1:208584903-208584925 GGGTGGTCCTAGAGGGTGCAGGG - Intergenic
922505517 1:226123376-226123398 GGGAGGGCCTGGAGAGGAGAGGG - Intergenic
922756129 1:228097837-228097859 GGGAGGTCCTGGGGGAAGGAAGG - Exonic
922799622 1:228359246-228359268 GGATGGACCTGGAGGGGAGACGG + Intronic
1063128343 10:3155063-3155085 GGGAGGGCCTGTATGGAAGATGG - Intronic
1063223990 10:3997479-3997501 GGGAGGTCCAGGTGGGCAGATGG - Intergenic
1063439372 10:6060023-6060045 GAGTGGTCTTGGAGGGAGCAGGG - Intronic
1064103464 10:12482282-12482304 GGGTGGTTCTGGAGGGAATGAGG + Intronic
1064779846 10:18822948-18822970 GGGTGGTTCTGGAGGAAGGAAGG + Intergenic
1065874528 10:29985450-29985472 GGTTGGAGCTGGAGGAAAGATGG - Intergenic
1066782088 10:38962218-38962240 GGGTATTTCTGAAGGGAAGAGGG - Intergenic
1067048877 10:43000809-43000831 GGGCGCTCCTGGAGGGCAGAGGG - Intergenic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067234426 10:44436172-44436194 GGGTGGGCCAGGAGACAAGAGGG - Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067426861 10:46217214-46217236 GGGTTGCCCTGGAGGGTAGGAGG + Intergenic
1067722536 10:48739943-48739965 GGGGGTTCCTTGGGGGAAGAGGG + Intronic
1067758844 10:49027600-49027622 GGGTCGGGCTGGAGGGAAGGTGG - Intronic
1068910358 10:62373646-62373668 GGGATGTCCTGAAGAGAAGACGG - Intergenic
1069333478 10:67321000-67321022 GGGTGGAGCAGGAGGGAGGATGG - Intronic
1069826373 10:71257424-71257446 GGGTGGGCCTGGAGGGGGAAGGG - Intronic
1070191944 10:74119009-74119031 GAGTGGCCCTGCTGGGAAGATGG - Exonic
1071471008 10:85984081-85984103 GGGAGGTCATGGAGGAGAGATGG - Intronic
1071543795 10:86511824-86511846 GGGAGGCCGAGGAGGGAAGATGG + Intronic
1072086563 10:92085282-92085304 GTCTGGTCATGGTGGGAAGATGG + Intronic
1072686961 10:97543196-97543218 GGGAGCGCCTGGTGGGAAGAGGG + Intronic
1072913252 10:99521868-99521890 GGGTGGGCCTGGAGGGAAAGGGG - Intergenic
1073464948 10:103689267-103689289 GGGTCTTCCTGGAGAGATGAAGG + Intronic
1074439069 10:113459148-113459170 GGGAGGGCATGGAGGGAAGGAGG - Intergenic
1075138228 10:119806751-119806773 GGGTGGGCTTGGAGGTGAGAGGG - Intronic
1076145665 10:128118071-128118093 GGCTGCTCCTCTAGGGAAGAAGG + Intronic
1076283130 10:129267380-129267402 GGTTACCCCTGGAGGGAAGAGGG + Intergenic
1076454307 10:130578761-130578783 GGGTAGTCCTGGAGTGACGGTGG + Intergenic
1076637535 10:131892041-131892063 GGCTGGGCTTGGAGGGAAGCTGG + Intergenic
1077138692 11:1014034-1014056 GGGTGGGCATGGAGCGAGGAGGG + Intronic
1077268969 11:1666244-1666266 AGGGGGTCCTGGAGGGCAGGGGG - Intergenic
1077271633 11:1684600-1684622 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271647 11:1684634-1684656 AGGGGGTCCAGGAGGGCAGAGGG + Intergenic
1077271681 11:1684712-1684734 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271695 11:1684746-1684768 AGGGGGTCCAGGAGGGCAGAGGG + Intergenic
1077271723 11:1684807-1684829 AGGGGGTCCTGGAGGGCAGGGGG + Intergenic
1077271729 11:1684824-1684846 AGGGGGTCCCGGAGGGCAGAGGG + Intergenic
1077271744 11:1684858-1684880 AGGGGGTCCCGGAGGGCAGAGGG + Intergenic
1077271767 11:1684909-1684931 AGGGGGTCCAGGAGGGCAGAGGG + Intergenic
1077340277 11:2023337-2023359 GGGCTGTGCTGGCGGGAAGATGG + Intergenic
1077540823 11:3145743-3145765 GGGAGGCCCTGGTGGGAAGTGGG + Intronic
1077546098 11:3170700-3170722 TGGTGGTGCTGGAGGCAAGGAGG + Intergenic
1078186453 11:9055732-9055754 GGCTGGGCCTGGAGGGGAGCAGG - Intronic
1078233919 11:9466678-9466700 GGGAGGCCAAGGAGGGAAGACGG - Intronic
1078496051 11:11818110-11818132 ATGTGGTCCTGATGGGAAGATGG + Intergenic
1078564704 11:12404440-12404462 GGTGGGCCCAGGAGGGAAGAGGG + Intronic
1078657360 11:13254101-13254123 GTGTGGTCTTGTAGGGAACATGG - Intergenic
1078916072 11:15780093-15780115 CGCTGCTCCAGGAGGGAAGAGGG - Intergenic
1080249700 11:30219170-30219192 GTGTGCTGCTGGAGGTAAGAAGG - Intergenic
1081419098 11:42851163-42851185 GGGTGGTTTTGGAGGGTGGAAGG + Intergenic
1081570134 11:44285784-44285806 GGGAGGTCCTGGAGGAAGAAGGG - Intronic
1081571441 11:44293881-44293903 GGATGGCTCTGGAGGGAGGAGGG + Intronic
1081584713 11:44376448-44376470 GGGTTTTCCTGGGGGTAAGAAGG + Intergenic
1081651818 11:44828880-44828902 GGGTCGTGATGGAGAGAAGAGGG - Intronic
1081720208 11:45283379-45283401 GGATGTTCCTTGAGGAAAGAAGG - Intronic
1082785618 11:57314678-57314700 GGGAGGACGTGGAGAGAAGAGGG + Intronic
1083097766 11:60269060-60269082 GGGTCCTACTGGAGGGTAGAGGG - Intergenic
1083159173 11:60844079-60844101 GGCTGGTTCAGGTGGGAAGAGGG + Intronic
1083583595 11:63840204-63840226 GGGAGCTCCTGGAGCAAAGAAGG - Intronic
1083780770 11:64916254-64916276 GGGAGGCCCTGGAGGAAAGGTGG - Intronic
1083842611 11:65313528-65313550 GGGAGGTCCGGATGGGAAGAAGG - Intergenic
1084959679 11:72709969-72709991 TGGTACTCCTGGAGGGCAGATGG + Exonic
1085027480 11:73244992-73245014 GAGTGGGCCTGGAGGGGAGGAGG + Intergenic
1085462176 11:76700792-76700814 GGGTGGCTCTGGAGGCAAGAGGG + Intergenic
1085472129 11:76765088-76765110 GGCTGGCCCTGGAGGGACCATGG + Intergenic
1088182227 11:107126105-107126127 GGATGGTCCAGGAGGGAGGAAGG - Intergenic
1089255705 11:117192805-117192827 ATGCGGTCCTGGAGGGAAGCAGG - Exonic
1089256542 11:117197218-117197240 GGGTGGACCAGGTGGGACGAAGG - Exonic
1089383998 11:118056259-118056281 GGGTCATCCTGGAGAGATGATGG + Intergenic
1089456389 11:118628233-118628255 GGGTGGTCCGGGTGGGCAGCGGG - Exonic
1089532110 11:119136907-119136929 GTGGGCTCCTGGAGGGAGGAGGG + Intergenic
1089609072 11:119659484-119659506 GGGTGGTGCTGGAGGGATGGAGG + Intronic
1090079455 11:123602082-123602104 GGGAGGTCCAGGAGAGAAGGAGG + Intronic
1202823262 11_KI270721v1_random:78526-78548 GGGCTGTGCTGGCGGGAAGATGG + Intergenic
1091467954 12:702032-702054 GCCTGGGCCTGGAGGGAGGAAGG + Intergenic
1091657356 12:2355338-2355360 GGGAGGTCCTGGATGGGGGATGG - Intronic
1091828666 12:3534035-3534057 AGGTGGGCAAGGAGGGAAGAAGG + Intronic
1092161023 12:6315679-6315701 GGGGGCTCATGCAGGGAAGATGG - Intronic
1093093246 12:14944330-14944352 GGGTGGCATTGGAGGGAAGGGGG - Intronic
1093980381 12:25469312-25469334 GCCTGGTCTTGGAGGGCAGAGGG + Intronic
1094210607 12:27885934-27885956 GGTTGGTTGTGGAGGGATGAAGG + Intergenic
1096518265 12:52170264-52170286 GAGTGGGCATGGAGGGAGGAAGG + Exonic
1096716221 12:53493072-53493094 GGGTGGTCCGGGTGGGGAAAGGG + Intronic
1098534534 12:71579769-71579791 GGGTGGACTTGGGGGGAAGTGGG - Intronic
1098567319 12:71951143-71951165 GGGTGGTACTGAGGGTAAGAAGG - Intronic
1101270574 12:103139700-103139722 GGGTGGTACTGGAGGGCTTAGGG + Intergenic
1101382594 12:104227504-104227526 GGGAGGCCCAGGAGGGAGGATGG - Intronic
1101479776 12:105085087-105085109 GGGAGGCCGAGGAGGGAAGATGG + Intergenic
1102053187 12:109878186-109878208 GGCTGGTTTTGGAGGAAAGAGGG - Intronic
1102547257 12:113665964-113665986 GGGTGATCCTGGGGGGTCGAGGG - Intergenic
1103240552 12:119409793-119409815 GGGGGGCCTTGGAGGGAGGAGGG - Intronic
1103723508 12:122986860-122986882 GGGAGGCCCAGGAGGGAGGAAGG - Intronic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1104952927 12:132450557-132450579 GGGTGGGCCTGGAGTGACCAAGG + Intergenic
1105035575 12:132918104-132918126 GGGTGGTCCTGCAAGGAAGGGGG + Intronic
1105623827 13:22093997-22094019 GGATGGTGCTGGAGGGAAGGTGG + Intergenic
1106923327 13:34588188-34588210 GGGAGGTCGTGAAGGGAGGAAGG - Intergenic
1108000911 13:45904913-45904935 GGCTGGTCTGGGAGGGAAGAAGG - Intergenic
1108326410 13:49336708-49336730 TAGTGGCCCTGGAAGGAAGATGG - Intronic
1108676340 13:52740154-52740176 GGGTGGGGGTGGGGGGAAGATGG + Intergenic
1109450829 13:62512480-62512502 GAGTGGACCTGGAGAGGAGAGGG - Intergenic
1111779427 13:92702834-92702856 GGGAAGTCATGGAGGGAGGAGGG - Intronic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112707790 13:102091549-102091571 GGCTGGTATTTGAGGGAAGAAGG - Intronic
1112872452 13:103991850-103991872 TGGAAGACCTGGAGGGAAGAAGG - Intergenic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1114263007 14:21052486-21052508 GGGAGGACTTGCAGGGAAGAGGG + Intronic
1115437797 14:33396004-33396026 GGGTGGGGCTGGAGGGAATGGGG - Intronic
1115776399 14:36720060-36720082 GGGTGGGCCTGGCTGGCAGAGGG - Intronic
1115975769 14:38995429-38995451 GGGTGGGCATAAAGGGAAGAGGG - Intergenic
1116621029 14:47203359-47203381 TTGTGGTCCTGAAAGGAAGAAGG + Intronic
1117062911 14:51981155-51981177 GAATGGTCCTGAAGGGAGGAAGG + Intergenic
1117345395 14:54827081-54827103 GGGAGGTCTTGGAGGGAGTAAGG - Intergenic
1117804530 14:59477462-59477484 GGGTGGACTTTGAGGGAGGAAGG - Intronic
1117838266 14:59830120-59830142 GGGTGCTGCTGGTGGGCAGAGGG - Intronic
1117996960 14:61487094-61487116 GGGTGGTGCTGGAGATAAGTGGG + Intronic
1118138461 14:63053098-63053120 GGGTGTGCTTGGTGGGAAGAAGG + Intronic
1118206664 14:63729195-63729217 GGGAGGTCGAGGAGGGAGGATGG + Intergenic
1119428879 14:74552839-74552861 AGCTGGCCCTGGAGGGTAGATGG - Intronic
1120777401 14:88452696-88452718 GGGGTATACTGGAGGGAAGATGG - Intronic
1120789010 14:88562507-88562529 GGGTGGCCCTGGAAGAAGGAAGG + Intergenic
1120838877 14:89065244-89065266 GGGTGAGCCTGGATGGGAGATGG + Intergenic
1122175599 14:99916071-99916093 TGGTGGTCCAGGAGGGCTGAAGG + Intronic
1122651771 14:103230374-103230396 GGATGGTCATGGAGCGGAGAGGG + Intergenic
1122810367 14:104284735-104284757 GGGAGGTCCAGGAGGCAATACGG - Intergenic
1122859839 14:104577592-104577614 GGGTGGTCCTGGAAGGTGGCCGG - Intronic
1122861985 14:104586826-104586848 GGGTGTTGGAGGAGGGAAGAGGG + Intronic
1122916359 14:104860803-104860825 GGGTGGTGATGGAGGGTGGAGGG - Intergenic
1123432713 15:20232172-20232194 GGGTGGACCTGGAGGGGAATAGG - Intergenic
1124632784 15:31346911-31346933 GGGTGGGCCAGCAGGGGAGAGGG + Intronic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1125329186 15:38565210-38565232 GAGAGGCCCTGGAGGGGAGAAGG - Intronic
1125513349 15:40304470-40304492 AGGTGTTCATGGAGGGAAGAAGG - Intronic
1125603669 15:40928528-40928550 GCGTGGTCCCGGAGGTAGGAGGG - Intergenic
1125760837 15:42094470-42094492 GGCTGGGCCTGGAGTGAAGCTGG - Exonic
1127504181 15:59582242-59582264 GGGAGGCCCAGGTGGGAAGACGG - Intergenic
1127697340 15:61463278-61463300 GGGAGGTGCTGGAGAGGAGATGG - Intergenic
1128382076 15:67120554-67120576 GGGTGGTCTAGAAGGGCAGATGG + Intronic
1128382702 15:67125145-67125167 GGGTGGGCCTGGATGGCATACGG - Intronic
1128739638 15:70074600-70074622 TGCTGGTGCTGGAGGGAAGAGGG + Exonic
1128986276 15:72224048-72224070 GAGTGGTCTTTGAGGGAAGTAGG - Intronic
1129156162 15:73719493-73719515 ACATGGTGCTGGAGGGAAGAGGG - Intergenic
1129712014 15:77825279-77825301 GGGTGGTGCTGGAGGCAGCAGGG + Intergenic
1130512621 15:84601783-84601805 GGGAGGCCGAGGAGGGAAGATGG - Intronic
1130985812 15:88843692-88843714 ATGGGGTCCTAGAGGGAAGAGGG + Intronic
1131074042 15:89483793-89483815 GGGTGGTACTGGATGGAAGGAGG + Intronic
1131399111 15:92110466-92110488 AGGTGGGCGTGGAGGGAACAGGG - Intronic
1131850750 15:96541034-96541056 GAAGGGTCCGGGAGGGAAGAAGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1132329698 15:101003798-101003820 GGCTGGGCCTGGAGCTAAGAGGG - Intronic
1132496717 16:266829-266851 GGGTGGGGCTGGAGGGAGAAGGG + Intronic
1132943095 16:2518181-2518203 TGGTGGCCCTGGAGGGCAGCTGG + Intronic
1133036074 16:3035144-3035166 GGGTGGGCCTGGAGAGGACAAGG - Intronic
1133054494 16:3138770-3138792 GGGTCGTCCCGGAGAGACGACGG + Exonic
1133148228 16:3806755-3806777 AGGGGGCCTTGGAGGGAAGATGG - Intronic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1135152583 16:20021926-20021948 AGGGGGTCCTACAGGGAAGACGG - Intergenic
1135955292 16:26951840-26951862 GGGTGGGCCTGGGGAGAACAAGG + Intergenic
1136283937 16:29230483-29230505 GCGAGGTCATGGAGGGAACAGGG - Intergenic
1136573949 16:31112304-31112326 GGGAGGTCCTGCAGGGAATGCGG - Exonic
1136851918 16:33618941-33618963 GGGTGGACCTGGAGGGGAATAGG + Intergenic
1137463993 16:48691435-48691457 GGGTGGTGGTGGGGGGAAGCAGG + Intergenic
1137614026 16:49836367-49836389 GGGTTGGCATGGAGGGAAGGGGG + Intronic
1138429618 16:56960560-56960582 GGCTGGGCCTGGAGAGAAAAGGG - Intergenic
1138506366 16:57480262-57480284 GGGTGGGGCAGGAGGGTAGAGGG - Intronic
1138554006 16:57761831-57761853 GGATGGTTCTGGGGGGAGGAGGG - Intronic
1139701223 16:68709309-68709331 GGGAGGCCCAGGAGGGAGGATGG - Intronic
1139752593 16:69118828-69118850 AGGTGGTCCTGGAGGGAAAATGG + Exonic
1139823923 16:69742238-69742260 GGGTGGTCCTGGAGACGACACGG + Exonic
1139947547 16:70651542-70651564 GGGAGGTCCTGCAGGGACAAAGG + Intronic
1140038438 16:71389241-71389263 GAGTGGTCCAGGAGGCTAGAAGG + Intronic
1140197745 16:72869295-72869317 GGCTGGTCCTTGAAGGATGATGG - Intronic
1141610587 16:85178876-85178898 GGGTGGGCAGGGAGGGATGAGGG + Intronic
1141826212 16:86482177-86482199 GCCTGGGCCTGCAGGGAAGAGGG + Intergenic
1141951351 16:87341970-87341992 GGGAGGTCAAGGTGGGAAGACGG + Intronic
1142088969 16:88199993-88200015 GCGAGGTCATGGAGGGAACAGGG - Intergenic
1142283492 16:89161216-89161238 GGGAGGTGCTGAAGGGATGAAGG - Intergenic
1142298565 16:89243000-89243022 GGAAGGTCCTGGAGGGAGGGTGG - Intergenic
1142561311 17:811134-811156 AGGTGGCACAGGAGGGAAGAAGG + Intronic
1142961105 17:3553099-3553121 GGGAGGGCCTGGAGGGATGGCGG - Intronic
1142964694 17:3573286-3573308 GGGTGGTCCTGGAGGGAAGAAGG - Intronic
1143315756 17:6032214-6032236 AGCTGGTCATGGAAGGAAGAAGG - Intronic
1144761859 17:17711520-17711542 GGATGGAGCTGGAGGGAAGTGGG + Intronic
1145266416 17:21381636-21381658 GGGAGGTCCTGGAGAGAGGGTGG - Intronic
1145898027 17:28471939-28471961 GGGCGGTCCTAGAGGTCAGAGGG - Intronic
1146644342 17:34567154-34567176 GGGTGGTGCTGAATGGAAGGAGG - Intergenic
1146893770 17:36526361-36526383 GGGAGGTCTTGGGGGCAAGAGGG - Intronic
1147316892 17:39625322-39625344 AGGAGGTCCTGAAAGGAAGAAGG - Intergenic
1148241224 17:46000543-46000565 GGGAGCACCTGGCGGGAAGAGGG + Intronic
1148518128 17:48241364-48241386 GGGTGGTACTGAAGGGAAGCAGG + Intronic
1148606167 17:48930605-48930627 AGGTGTTCCTGGAGGGAAAAGGG + Exonic
1148747647 17:49927501-49927523 GGGAGGCCCTGGAGGGCAGGGGG - Intergenic
1150266478 17:63835377-63835399 GGGAGGTTCTGGAGGGAAGGAGG - Intronic
1150283688 17:63943891-63943913 GGGTGGTCCTGGAGGCAGGAAGG - Intronic
1150386779 17:64767705-64767727 GGGTGGCCCTAGAGTGGAGAAGG - Intergenic
1151289860 17:73141783-73141805 GGGTGCACTTGGAGGAAAGAGGG + Intergenic
1151341606 17:73474766-73474788 GGGTGACCCTAGAGGGGAGATGG + Intronic
1151402315 17:73863890-73863912 TGGGGGTGCAGGAGGGAAGAGGG - Intergenic
1151961045 17:77405818-77405840 GGATGGGCCTGAAGGAAAGATGG - Intronic
1152315493 17:79578110-79578132 GGGTAGTGGTGGAGGGAAGGGGG + Intergenic
1152462852 17:80450379-80450401 GCGTGGGCCGGGTGGGAAGAGGG - Intergenic
1152469571 17:80483189-80483211 GGGAGGGCCTGGAGGGAGGGAGG + Intergenic
1152763439 17:82121933-82121955 GGGTGGCCTGGGAGGGAAGGCGG - Intronic
1203190713 17_KI270729v1_random:184996-185018 GGGTATTTCTGAAGGGAAGAGGG - Intergenic
1154156279 18:11946951-11946973 GGGAGGTCTAGGAGGGAGGATGG + Intergenic
1154387081 18:13903694-13903716 GGGTGGTTCTGGAGGGAGGTGGG + Intronic
1155563761 18:27110011-27110033 GGGTGGTCTGGGAAGGCAGATGG + Intronic
1157328446 18:46686013-46686035 GGATGGGGCTGGAGAGAAGAAGG + Intronic
1157555265 18:48609330-48609352 AGGTGGGCCTTGAGGGAAAAGGG + Intronic
1157566019 18:48679858-48679880 GGGTGGCCTGGGAGGGGAGAGGG + Intronic
1158614023 18:58969336-58969358 GGGTGGTTCAGGGAGGAAGATGG + Intronic
1160175936 18:76594041-76594063 GGGAAGTTTTGGAGGGAAGATGG - Intergenic
1160560263 18:79751339-79751361 GGCAGGTCCAGGAGGGAAGGAGG + Intronic
1160589766 18:79936979-79937001 GTGGGGTCCTTGAGGGCAGAAGG + Intronic
1160867196 19:1261175-1261197 GGCGGGGCCTGGACGGAAGAGGG + Intronic
1160972459 19:1775634-1775656 GAGTGGGCATGGAGGGAGGAAGG - Exonic
1161104474 19:2436660-2436682 GGGTGGCCGTGGAGGCGAGAGGG - Intronic
1161398534 19:4057820-4057842 GGGTGGAACTGGCGGGAAGTAGG - Intronic
1161723492 19:5915977-5915999 GGGTGGTGGTGGAGAGAACAGGG + Exonic
1161841867 19:6686719-6686741 GGGTTGGCCTGGAGGGGTGAAGG - Intronic
1161950291 19:7463975-7463997 GGGCGGCCCTGGAGGCAGGAGGG - Intronic
1162057072 19:8071260-8071282 GGGTGGCCCGAGAGGGAAGGAGG + Intronic
1163862432 19:19749302-19749324 GGACGGTCCTGGAGGGCAAAGGG + Intergenic
1165028955 19:32983542-32983564 GGGTGGACCTGGAGGGGAACAGG - Intronic
1165072326 19:33262605-33262627 GGGGGGTCCTGGGGGCTAGAAGG - Intergenic
1165834495 19:38745837-38745859 GGGTCCACTTGGAGGGAAGAAGG - Intronic
1166317473 19:41997226-41997248 GGCGGGCCCTGGAGGGAAGTCGG + Intronic
1166343042 19:42150199-42150221 GGGTGGTCTTGGGGGGCACAGGG - Intronic
1166349800 19:42191143-42191165 GGGTGGACCTGGAGGGCAAATGG - Intronic
1167017402 19:46850125-46850147 GAGAGGACCTGGAGGTAAGATGG - Intronic
1167117362 19:47496039-47496061 AGGTGGTCTTGGAGGCAACAGGG + Intronic
1167436520 19:49481563-49481585 AGGTGGGCCAGGAGGGAAGAAGG + Intronic
1167674850 19:50877718-50877740 GGATGGTGCTGGACAGAAGAAGG + Intronic
1167691071 19:50983808-50983830 GGGTGCACCTGTAGGGGAGAGGG - Exonic
1167946363 19:52992312-52992334 GAGTGGTGCTGGTGGCAAGAGGG - Intergenic
1167982245 19:53284694-53284716 GGGTGGTCCAGGCTGGAGGACGG - Intergenic
1167983900 19:53299279-53299301 GGGTGGTCCAGGCTGGAGGACGG + Intergenic
1168064092 19:53909530-53909552 GGAGGGTCCTGGGAGGAAGAAGG + Intronic
1168127393 19:54293374-54293396 AGCAGGTGCTGGAGGGAAGAGGG + Intergenic
1168172964 19:54601474-54601496 AGCAGGTGCTGGAGGGAAGAGGG - Intronic
1168334085 19:55586996-55587018 GGCTGTTCCTGAAAGGAAGAAGG + Intergenic
1168713497 19:58514501-58514523 GGGAGGTCCTGGAGAGGAGGGGG - Intronic
1202703175 1_KI270713v1_random:3374-3396 GGAAGGCCCTGGAGAGAAGAAGG - Intergenic
925149702 2:1606655-1606677 GGGAGGTCCTGAAAGGAGGAAGG + Intergenic
925266335 2:2569074-2569096 GGCTGGGGCTGGACGGAAGAGGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926221763 2:10941022-10941044 GGGTGGTCCTAGAGGCAGCAGGG - Intergenic
926316817 2:11715980-11716002 GGGTGGACCTGGAGGCAGGGGGG + Intronic
926730843 2:16034375-16034397 GTGTGGTCCTGGGGGGTGGAGGG + Intergenic
927129554 2:20046934-20046956 ATGTTCTCCTGGAGGGAAGAGGG - Intronic
927212012 2:20644876-20644898 GTGTGGTCCTGGGAGGAAGCGGG - Intronic
927428614 2:23007993-23008015 GGGTGGGGCTGAAGGGGAGAGGG + Intergenic
927846385 2:26474492-26474514 AGGTGGGACTGCAGGGAAGAGGG - Exonic
928592116 2:32827712-32827734 GGGTGGTACTGACGGGAAAATGG + Intergenic
929261480 2:39871183-39871205 ATGTGGTCTTGGAGAGAAGATGG - Intergenic
929417980 2:41762931-41762953 GGATGGACCTGGAGAGATGAAGG - Intergenic
929539449 2:42809063-42809085 GGATGGTCCTGGACTGTAGAAGG - Intergenic
929638889 2:43555648-43555670 GGGTAGTTCTGGTGGGAATATGG - Intronic
929975103 2:46626095-46626117 GGGGACTACTGGAGGGAAGAGGG - Intergenic
930687697 2:54326728-54326750 GAGTGGTCATGGGGTGAAGATGG - Intergenic
931223141 2:60306306-60306328 GGGTGGGAGTGGAGGGAGGAAGG - Intergenic
931640087 2:64374380-64374402 GGAGGGTCCTGGGGAGAAGATGG - Intergenic
932174351 2:69585969-69585991 GGGTGGTGCCAGAGGGAAGGTGG - Intronic
932688104 2:73890796-73890818 TGGGGATTCTGGAGGGAAGAGGG - Intergenic
932893128 2:75613060-75613082 GGGAGGTGCTGGTGGGAGGAAGG - Intergenic
934529582 2:95076748-95076770 GGGTGTTCCGGGAGGGAGGGAGG - Intergenic
935989226 2:108704551-108704573 TGGTGTTCCTGCAGGGCAGAGGG - Intergenic
936328270 2:111524063-111524085 GGGGGCTTCTGGAGGGGAGAAGG + Intergenic
936562358 2:113552096-113552118 GGGTGGGCATGGAGGGGAGAGGG - Intergenic
937225982 2:120368995-120369017 GAGAGGTCCTGGATGGAAGGAGG + Intergenic
937305450 2:120867795-120867817 GGGGGGAGCTGGAGGGAAGGAGG + Intronic
937980408 2:127611407-127611429 GGGTGGACATGGGGGGAAGCAGG + Intronic
938069262 2:128299926-128299948 GGGTGGCTCTGGTGGGCAGAGGG + Intronic
938228193 2:129635868-129635890 GGGTGGCCATGGAGGGCGGATGG - Intergenic
938245934 2:129778142-129778164 TGGTGGACCTGCAGTGAAGAGGG - Intergenic
938663848 2:133513501-133513523 GAGTGGATCTGGAGGGAAAATGG + Intronic
938928276 2:136064083-136064105 AGGTGGTCCTGAAGGGACGAGGG + Intergenic
940985741 2:160050322-160050344 GGGCAGTGCTGGAAGGAAGACGG + Intronic
941536342 2:166726560-166726582 GGATGGTGCTGGTGGGAAGGTGG + Intergenic
941918397 2:170827115-170827137 GGCTATTTCTGGAGGGAAGAAGG - Intronic
942143425 2:173001370-173001392 GGGTTGTCTTCGAGGGAATAGGG - Intronic
942186090 2:173426412-173426434 GGCTGGTCCTGGAAGGAAGAAGG + Intergenic
942535782 2:176961895-176961917 GGGTGGCCCAGGAGGGAGGAGGG + Intergenic
942958987 2:181807048-181807070 GGGTCTTCCTGGAGGGTGGAAGG + Intergenic
943842377 2:192599181-192599203 CCATGATCCTGGAGGGAAGAGGG - Intergenic
944201030 2:197107725-197107747 ATGTGGTCCTGGAGGACAGAGGG + Intronic
945282874 2:208052867-208052889 GGGTGGGACTAGAGGGAAAATGG - Intergenic
945412507 2:209528092-209528114 GGGTGGGCAGGGGGGGAAGATGG - Intronic
945784116 2:214212385-214212407 GGGTGGTCGGGGAGGTGAGAAGG - Intronic
945804915 2:214478741-214478763 GGGTGTTCCTCAAGGCAAGAGGG - Intronic
945988363 2:216372205-216372227 GGGTGGTGCTGGAAGGGAGGTGG + Intergenic
946301619 2:218827736-218827758 GGGATGTCCTGGAGTGAACAGGG - Intronic
946564235 2:220945667-220945689 GGGGGGTCAGGGAGGCAAGATGG - Intergenic
946884780 2:224211988-224212010 GGGTGGGAGTGGAGGGAGGAGGG - Intergenic
947621861 2:231595896-231595918 GGCAGCTCCTGGAGGGAAGCAGG - Intergenic
947628041 2:231633368-231633390 GGGTGGTGCTGGATGTCAGATGG + Intergenic
947941923 2:234064274-234064296 GGGTGGACGTGGAGTGCAGAAGG - Intronic
948635157 2:239329967-239329989 GGGGTGTCCTGGTGGGAGGAGGG + Intronic
948808645 2:240463650-240463672 GGGTGGTGCTGCAGGGTTGAGGG + Intronic
948868926 2:240788678-240788700 GGGTCATCCTGGAAGGAGGAAGG + Intronic
948877128 2:240835580-240835602 GGGTCATCCTGAGGGGAAGAGGG + Intergenic
949019743 2:241734525-241734547 GGCTGGGCCTGGAGGGCAGGCGG + Intergenic
1168947888 20:1776950-1776972 GGAGGGCCCTGGTGGGAAGATGG + Intergenic
1169027876 20:2385382-2385404 GGGTTGTCTTGTAGGGAGGAGGG + Intronic
1169224701 20:3848703-3848725 GGGTTGTCAGGGAGGGAAGGAGG - Intronic
1169236570 20:3934409-3934431 GGGAGGCTCTGGAAGGAAGAGGG - Intronic
1169770208 20:9191741-9191763 TGGAGGTGCTGGAGGGGAGAAGG - Intronic
1171990106 20:31689475-31689497 TGGTGGTCCTGGAAGAAACAAGG + Intronic
1172402649 20:34663142-34663164 GGGAGGTCAAGGTGGGAAGATGG - Intronic
1172611282 20:36254501-36254523 GCCAGGGCCTGGAGGGAAGAGGG + Intronic
1172620583 20:36316012-36316034 GGCTGGTCCTGGAGGCCAGCGGG + Intronic
1172782859 20:37447561-37447583 GGCTGGTCTGGGAGGAAAGAAGG - Intergenic
1173176968 20:40771856-40771878 TGGGGGTCCTGGAGGGAGGAGGG - Intergenic
1173495524 20:43514864-43514886 GGGTGGTCCTGGGGTGGAGAAGG + Intronic
1174553166 20:51375846-51375868 GGGTGAACCTGGAGGGCAAATGG + Intergenic
1174618456 20:51855122-51855144 GGTTAGGCCTGGAGGGAAGTGGG - Intergenic
1174767432 20:53267196-53267218 GGATAGGCCTCGAGGGAAGATGG + Intronic
1175014538 20:55775210-55775232 GGAGGGTGGTGGAGGGAAGAGGG + Intergenic
1175178258 20:57126820-57126842 GGGTGGGCCTGCTGGGGAGAGGG + Intergenic
1175340266 20:58224526-58224548 CAGTGGCCCTGGAGGGAAGCAGG - Intronic
1175817822 20:61892847-61892869 GGCTGGTCTTAGAGGGAAGGAGG + Intronic
1176083179 20:63284170-63284192 GGGAGGTGCTGGAGGGAGGGCGG + Intronic
1176131649 20:63498973-63498995 GGCCGGTCCTGGGGGGCAGAGGG - Intronic
1176180051 20:63745563-63745585 GGCAGGTCCTGGAGGGAAGGAGG + Exonic
1176212472 20:63931689-63931711 GGGTGGGCGTGGAGGCAGGAGGG - Exonic
1176214013 20:63939711-63939733 GCTTGGTCCTGCAGGGGAGAAGG + Intergenic
1176383667 21:6126524-6126546 GGGAGGTCCTGATGGGTAGAGGG + Intergenic
1177444233 21:21170822-21170844 GGGTGTTCCTAGAGGGGGGAAGG + Intronic
1178293356 21:31387773-31387795 AGGTGGGCCTGGAGGGAAGCCGG + Intronic
1178994666 21:37388038-37388060 AGGAGGTCATGAAGGGAAGAGGG - Intronic
1179572598 21:42286776-42286798 GAGAGGTCCTGGAGAGATGAGGG + Intronic
1179585182 21:42370152-42370174 AGGTGGCCCTGGAGGGAGGGAGG + Intergenic
1179739803 21:43411714-43411736 GGGAGGTCCTGATGGGTAGAGGG - Intergenic
1179903429 21:44406792-44406814 GGGTGGTGCTGCCGGGAAGCAGG + Intronic
1180219412 21:46348446-46348468 GGGTGGTCCTCGTGTGCAGATGG + Intronic
1181440556 22:22933335-22933357 GGGTGGGCCTGTGGGGAGGAAGG - Intergenic
1181588480 22:23867782-23867804 TGGTGCTCCTGGAGGGGACATGG + Intronic
1181815446 22:25433380-25433402 GGGAGGTCACGGTGGGAAGATGG + Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1183824278 22:40372453-40372475 GTGTGGTCTGGGAGGGGAGAGGG + Intronic
1184096712 22:42320016-42320038 TGGTGGGAATGGAGGGAAGATGG - Intronic
1184691489 22:46119341-46119363 GGCTGGTCCCCGAGTGAAGAAGG + Intergenic
949241907 3:1883343-1883365 GGGTAGTCCTGGAAAGGAGAGGG - Intergenic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
950112276 3:10426869-10426891 GGGTGGGGGTGGGGGGAAGATGG + Intronic
950125135 3:10505950-10505972 GGGCTGTGCTGGAGGGAAGGGGG + Intronic
950171248 3:10840337-10840359 TGGGGGTCCTGAAGGGTAGAAGG - Intronic
950172860 3:10851596-10851618 AGCAGGGCCTGGAGGGAAGAAGG - Intronic
950426210 3:12925998-12926020 GGGTGGTCCTGGTGGTCAAAGGG + Intronic
950547760 3:13648647-13648669 GGGTGGTCCTTGAGGGAATTTGG + Intergenic
952990948 3:38830152-38830174 GGGAGGTCCTTGAGGGAATAGGG + Intergenic
953038558 3:39234598-39234620 AGGGGGTCCTGAAGGGAGGAAGG + Intergenic
953389966 3:42528220-42528242 GGGTGGGGTGGGAGGGAAGAGGG - Intronic
953631909 3:44625167-44625189 GGGTGGGCGTGCAGGGAAGGCGG + Intronic
953639008 3:44688228-44688250 GGGTGGTAATGGGGGGAATAGGG - Intergenic
954134105 3:48574261-48574283 GGCTGGGCCTGAAGGGAAGCCGG - Exonic
954135248 3:48579397-48579419 GGGTCCCCCTGGAGGGAACAGGG + Exonic
954298655 3:49687661-49687683 GGAAGGCCCTGGAGAGAAGAAGG + Exonic
955169144 3:56546255-56546277 GGGTGGACCCGAAGAGAAGATGG + Intergenic
955776676 3:62440891-62440913 GGGAGGCCCTGGAGGGGAGTGGG + Intronic
956836803 3:73102411-73102433 TGGGGGTGCTGCAGGGAAGAAGG + Intergenic
956978561 3:74610776-74610798 GGGTGAACATGGAGGGAAGTGGG + Intergenic
957151930 3:76497433-76497455 GGGAGGCCATGGCGGGAAGAAGG - Intronic
959539644 3:107524138-107524160 GGGTGGTGGTGGAGGGGAGGAGG + Intronic
961325231 3:126105521-126105543 GGGGGGTCGTGCTGGGAAGAAGG - Intronic
961640309 3:128360728-128360750 GGGTGGGAGTGGAGGGAGGAGGG + Intronic
962271108 3:133978701-133978723 GAGTGGCCCTGGGGAGAAGATGG + Intronic
962319608 3:134379290-134379312 GAGTAATCCTGGAGGGAAGGAGG + Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
962403437 3:135080555-135080577 GAGTGGTCCTGGAGGAGAGGGGG + Intronic
962456621 3:135570886-135570908 GCTTGGACCTGCAGGGAAGATGG - Intergenic
963051134 3:141144965-141144987 GGGTGTTGCTGGAGGAGAGATGG + Intronic
963607675 3:147424784-147424806 GGGCAGACCTGGAGGGAGGAGGG - Intronic
965567968 3:170140952-170140974 GGGTGTGCCTGGTGGGGAGAAGG + Intronic
966942819 3:184757711-184757733 GGGTGGTCCTGAAGTGCAGTGGG + Intergenic
968038259 3:195567051-195567073 AGGTGGGCATGGAGGGAGGAGGG - Intergenic
968504446 4:965430-965452 GGGTGTTCCTGGGGTGAAGTGGG - Intronic
968894392 4:3390191-3390213 AGGTGGTCAGGAAGGGAAGAGGG - Intronic
968901877 4:3435839-3435861 GGCCAGTCCTGGAGGGAACATGG - Intronic
968937048 4:3617069-3617091 GGGAGGGACAGGAGGGAAGAAGG - Intergenic
969088334 4:4673188-4673210 GCGTGGTCCTGAAGGGGACAGGG - Intergenic
969616087 4:8253288-8253310 GGGTGCTCCTGGAGGTTTGAGGG + Intergenic
969892798 4:10275344-10275366 TTGTGAACCTGGAGGGAAGAGGG + Intergenic
969922844 4:10557237-10557259 GGGAGGTTCTGGAGGGCAAATGG - Intronic
971828804 4:31663189-31663211 GGGTAGGCCTGCTGGGAAGAAGG - Intergenic
971879738 4:32355746-32355768 GGTTGGTCCTGGTAGGCAGATGG - Intergenic
976628162 4:87208575-87208597 GGGAGGCCCAGGGGGGAAGATGG - Intronic
978561011 4:110033207-110033229 GGGTGCTCCAGGAGTAAAGATGG + Intergenic
980088880 4:128420876-128420898 GGGTGGTCCAGGAGGCCACAGGG + Intergenic
980866818 4:138562013-138562035 GGGTGGTCCTGGAGACGACATGG - Intergenic
981229760 4:142338968-142338990 GGAGGGTCCAGGAGGGGAGAAGG + Intronic
982590680 4:157305352-157305374 GGGTGGAACTGGAGAGATGAGGG - Intronic
983508409 4:168580959-168580981 GGGGCCTACTGGAGGGAAGAAGG + Intronic
984256965 4:177400869-177400891 GGGAGGGACTGAAGGGAAGATGG - Intergenic
984935648 4:184887677-184887699 GGGTGGTCCCAGAGGTGAGAAGG - Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
987961357 5:24813559-24813581 GGGTGGTAATGGTGGGAATAAGG + Intergenic
988878388 5:35473338-35473360 GGCTGGGCCTTGAGGCAAGAGGG - Intergenic
989187617 5:38640408-38640430 GGGTGGGGCTTGAGAGAAGAAGG - Intergenic
989459259 5:41678362-41678384 GGGGGATGCTGGGGGGAAGAGGG + Intergenic
989731376 5:44654158-44654180 TGGAGGTCTTGGAGGGAAAATGG - Intergenic
991292343 5:65045013-65045035 GGGTGATGGTGGATGGAAGAGGG - Intergenic
992024073 5:72653687-72653709 GGGAGGCCCTGCAGGGCAGAAGG + Intergenic
992298690 5:75354650-75354672 GGTAGGTACTGGAGAGAAGAAGG - Exonic
993876095 5:93308765-93308787 GGGTGGACTTGGAGAGAGGAAGG + Intergenic
995803344 5:116023610-116023632 GGGTAGTTCTGGAAGGAAAAAGG + Intronic
996654995 5:125925055-125925077 GGGTGGTCCTGAGTGAAAGATGG + Intergenic
997603523 5:135156555-135156577 GGATGGGTCTGGAGGGAACAAGG + Intronic
998137501 5:139681907-139681929 GGGTGGCCTTGGGGGAAAGATGG - Intronic
998165198 5:139838739-139838761 GGGTGGTGCAGGAGGGCAGCAGG - Exonic
998206358 5:140159525-140159547 TGAGGGACCTGGAGGGAAGAGGG - Intergenic
998401865 5:141852547-141852569 GGGGGTTTCTGGAAGGAAGAGGG + Intergenic
999151757 5:149430820-149430842 GGCTGTCCCTGGAGGTAAGAGGG + Intergenic
999255504 5:150207921-150207943 TGGTTGTCGTGGAGGGGAGAGGG + Intronic
999349217 5:150851230-150851252 CGTTGGTCTTGAAGGGAAGATGG + Intronic
999697629 5:154200387-154200409 AGGGGCTCCTGGAGGGAAGGGGG + Intronic
1000833981 5:166133470-166133492 TGGTGGTATTGGAGGGAATAAGG + Intergenic
1001746795 5:174098573-174098595 GGGTGGTCCTGGAAGCGAGAGGG - Intronic
1001791852 5:174464502-174464524 GAGTGGTTCTGGAAGGAGGAAGG - Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002085909 5:176775213-176775235 GTGTGGTGTTGGTGGGAAGACGG - Intergenic
1002098823 5:176847356-176847378 GGGAGGCCCTGGAGGGAGGGCGG - Intronic
1002183432 5:177442982-177443004 AGGTGGGCCTGGAGGGAAGCAGG + Intergenic
1002320188 5:178370623-178370645 GGGAGGTCCAGGCAGGAAGATGG + Intronic
1002435811 5:179230155-179230177 AGGTGGTCCCGGCGGGAGGAGGG + Intronic
1002475311 5:179461863-179461885 GGGAGGTCCTGGAGTGAGAATGG - Intergenic
1002846369 6:948689-948711 TGGTGGTGCTGGAGGGAATTAGG + Intergenic
1003175439 6:3750411-3750433 GGGAGGGCCGGGAGGGGAGAAGG - Intronic
1003263557 6:4546808-4546830 GTGTGGACTTGGAGGGAAGGGGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1004189014 6:13447993-13448015 GGGTGGATTTGGAGGGAGGAGGG + Intronic
1004488947 6:16095525-16095547 GGGTGGACAAGGAGAGAAGAGGG - Intergenic
1005511184 6:26512974-26512996 GGCTGGAGCTGGAGGGAAAAAGG - Intergenic
1006050997 6:31344226-31344248 AGGTGGGCCTGGAGGGAGGGAGG + Intronic
1006106283 6:31718881-31718903 TGGAGGTCCTGGAAGGAAGTGGG + Exonic
1006294712 6:33165037-33165059 GGGAGGGCTGGGAGGGAAGAGGG - Intronic
1006367617 6:33624762-33624784 GGGTGGCCTTGGTGGGCAGATGG + Intronic
1006368947 6:33632788-33632810 GGCTGGTCCTGGAGGGGAGAAGG + Intronic
1006803919 6:36776566-36776588 GGGTGGTCCCAGAGGGATGGGGG + Intronic
1006945051 6:37779320-37779342 GGGTGGAGGGGGAGGGAAGAAGG + Intergenic
1007217480 6:40251531-40251553 GGGGAGTCTTGGAGGGGAGATGG + Intergenic
1007375727 6:41455351-41455373 CGGTGGTTCTGGGGTGAAGAAGG - Intergenic
1007654453 6:43443918-43443940 GGGAGGTCCTGGAGGGTAGAAGG - Exonic
1008434621 6:51461122-51461144 GGGTGGTGAAGGAGTGAAGAGGG - Intergenic
1010744163 6:79542117-79542139 GCTGGGTCCTGGAGAGAAGAGGG - Intergenic
1011829433 6:91353425-91353447 GGGTATTATTGGAGGGAAGAGGG - Intergenic
1012241348 6:96876430-96876452 GGGTACCCCTGGAGGGAAGAAGG - Intergenic
1014969216 6:127793164-127793186 GTGTGATCCTGGAGAGAACAGGG + Intronic
1015461463 6:133496476-133496498 GGGTGGTCATGTAGGGGAAATGG - Intronic
1015569190 6:134604365-134604387 GGGTGCTCCTGGAGGGTGCATGG - Intergenic
1015569288 6:134604695-134604717 GGGTGCTGCTGGAGCGATGATGG - Intergenic
1015671328 6:135693250-135693272 GGGAGGTCCTGGAGAAGAGAAGG + Intergenic
1016269390 6:142271155-142271177 GTGTGGTGCTGGAGGGGGGAAGG - Intergenic
1016892572 6:149021191-149021213 GGCTGGTCCTTGAGGGAAACAGG + Intronic
1017901041 6:158718720-158718742 GGTTAGTCCTGGTGGGAAGGTGG - Intronic
1018034705 6:159872043-159872065 GGGTGGTGATGGCAGGAAGATGG + Intergenic
1018732156 6:166659379-166659401 GGGTGGCCGGGGAGGGGAGAGGG + Intronic
1018767353 6:166944854-166944876 GTGTGGGCCTGGTGGGCAGAGGG - Intronic
1019221115 6:170473567-170473589 GGTTGCTCCTGGAGGAAAGGGGG - Intergenic
1019415392 7:924539-924561 GCGTGGACCTGGAGGGCAGGGGG - Intronic
1019548658 7:1591408-1591430 AGGTGGTCCTGCAGGGAGAAGGG - Intergenic
1019565373 7:1676310-1676332 GGGTGGTCCCTCAGTGAAGAGGG - Intergenic
1019572777 7:1720714-1720736 GGGGGGTGCTGGGGGGAGGAAGG - Intronic
1019739125 7:2664102-2664124 GGGTGGCCCTGGGGACAAGAGGG + Exonic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020083578 7:5298973-5298995 GGGTGCTCCTGGAGGGAGGATGG - Exonic
1020137994 7:5597104-5597126 GGGAGGCCAAGGAGGGAAGATGG + Intronic
1021783544 7:24130247-24130269 GGGTGATCAGGGAGGCAAGAAGG - Intergenic
1022028816 7:26473115-26473137 GGGTGGGCCAGGAGGAAGGAGGG - Intergenic
1022239932 7:28500738-28500760 GGGGGAAGCTGGAGGGAAGATGG + Intronic
1022388116 7:29920698-29920720 GGGTGGTTCAGCAGGGAAGCCGG - Intronic
1023864924 7:44234025-44234047 GTGGGGTCCTGGTGGGGAGAGGG + Intronic
1024004639 7:45216521-45216543 GGCGGCTCCTGGAAGGAAGAAGG + Intergenic
1024253197 7:47521572-47521594 GGATAGTTCTGGAGGGAAAAGGG + Intronic
1024486781 7:49928487-49928509 GGGTGGTCCTGAAGGAGAGTGGG - Intronic
1025210705 7:57018220-57018242 GGGTGCTCCTGGAGGGAGGATGG + Intergenic
1025661251 7:63558627-63558649 GGGTGCTCCTGGAGGGAGGATGG - Intergenic
1026033512 7:66815473-66815495 GGGAGGTCAAGGAGGGAGGATGG - Intergenic
1026407030 7:70077048-70077070 GGGGGGTCCTGGAGGACACAGGG + Intronic
1027185553 7:75968708-75968730 GAGTGGTCCAGGGGGGAAAAGGG - Intronic
1027350874 7:77309535-77309557 TGGTGTTTCTGGAGGGAAGGGGG + Intronic
1029335780 7:99898119-99898141 TGGTGGTGCTGAAGGGAAGTGGG - Intronic
1029440137 7:100582854-100582876 GGGGGCTCCCGGAGGGAAGATGG + Intronic
1029869825 7:103678901-103678923 GGGTGGTGGTGGATGAAAGAAGG + Intronic
1030378092 7:108777014-108777036 GAGTGGTCCTGGAGACAAGCAGG - Intergenic
1032190694 7:129763954-129763976 GGGTGGGCAAGGAGGGAGGATGG - Intergenic
1032307409 7:130748999-130749021 GTGTGGTACTGGTGGGAAAATGG + Intergenic
1032335172 7:131018378-131018400 GGGTGGTCCAGGTGGGTAGGTGG - Intergenic
1032793964 7:135262918-135262940 GGTTGCTCAAGGAGGGAAGAGGG + Intergenic
1032898029 7:136273949-136273971 GGGTGGTGCTGCAGGAGAGAAGG + Intergenic
1033360977 7:140638923-140638945 TGGTGTTCCTGGAAGGAAGGGGG + Intronic
1033618580 7:143041167-143041189 GGGTGCTCCTTGTGGGAACAAGG - Intergenic
1034416220 7:150965587-150965609 GGGAGGAGTTGGAGGGAAGAGGG - Intronic
1035423836 7:158753686-158753708 GGCTGGGCCAGGAGAGAAGATGG + Intronic
1035528452 8:332894-332916 GGGTGTCCCTGGAGGGAGGGCGG + Intergenic
1035528468 8:332939-332961 GGGTGTCCCTGGAGGGAGGGCGG + Intergenic
1035626047 8:1071378-1071400 GGGTGGTGCTGGAGGAGGGAGGG - Intergenic
1036172259 8:6499179-6499201 GTTTGGTCCTGGAGGAGAGACGG + Intronic
1037656400 8:20887815-20887837 GGGTGGTGCAGCAAGGAAGAAGG + Intergenic
1038007401 8:23444403-23444425 GTGGGTTCCTGGAGGGGAGAGGG - Intronic
1038617129 8:29105208-29105230 GGGAGGTCCAGGTGGGAGGATGG - Intronic
1038740254 8:30211053-30211075 GGGTGGGCGTGGAAGGCAGAGGG - Intergenic
1040492975 8:47941984-47942006 GCGTGGGCCTGCAGGGAAGCCGG - Intronic
1040551206 8:48438991-48439013 CGCTGGTGCTGGAGGGGAGATGG + Intergenic
1041091896 8:54309870-54309892 GGGTGCTCCTGGAGAGACGATGG - Intergenic
1041537161 8:58939468-58939490 GAGTGGTCTGGGAGGGAAGGAGG + Exonic
1041775140 8:61514961-61514983 GGGTGGACAGGGAGGGAAGGAGG + Intronic
1042669608 8:71247004-71247026 GGGAGGTGCTGGAGGGATGTGGG - Intronic
1042669619 8:71247062-71247084 GGGAGGTGCTGGAGGGATGTGGG - Intronic
1042669625 8:71247082-71247104 GGGAGGTGCTGGAGGGATGTGGG - Intronic
1044547148 8:93472500-93472522 GGCTGGTCCTGAAGTGAAGATGG - Intergenic
1044934129 8:97277400-97277422 GCGTGGCCCTGCCGGGAAGAAGG - Exonic
1045272633 8:100674939-100674961 GGGTGGTCCTGGCAGCAAGCAGG - Intergenic
1047523901 8:125616262-125616284 GGGTGGTCTTGGAGGGCCTACGG + Intergenic
1048083292 8:131151498-131151520 AGGTGGTCCATGAGGGAAGCTGG + Intergenic
1048310422 8:133318342-133318364 TGGTGGTCCTGGAGGGAGTCGGG - Intergenic
1048429709 8:134358769-134358791 GGGTGGTTCTGGAGTGCACATGG - Intergenic
1049529764 8:143148371-143148393 GGGAGGTCCTGGTGGGATGCAGG - Intergenic
1049570466 8:143368005-143368027 AGGTGGTCCTGGAGGCAAGCTGG + Intergenic
1049660701 8:143818596-143818618 GGGTGGGCCAGGAGGGGAGTGGG - Intronic
1049716752 8:144096513-144096535 GGGTGGTGCTGGAGAGATGGGGG + Intronic
1049752015 8:144289409-144289431 GTGTGGTCCTGGAGGCCACATGG - Intronic
1049890326 9:63236-63258 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1052383799 9:27801599-27801621 GGCTGGGACTGGAGGGAATAAGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1053141533 9:35685604-35685626 GGATGGTCCGGGAGGGAGAAGGG - Intronic
1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG + Intergenic
1054454100 9:65420619-65420641 GGGAGGGACGGGAGGGAAGAAGG + Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1055436289 9:76295375-76295397 GGGTGTTACTGGTGTGAAGAGGG + Exonic
1055961936 9:81828954-81828976 AGGGGCTCCTGGAGGAAAGAAGG - Intergenic
1056451161 9:86718042-86718064 TGGTTGTCCTTGAGAGAAGATGG + Intergenic
1057483449 9:95463356-95463378 GGGTGAGCGTGGAGGGGAGACGG + Intronic
1057706439 9:97398375-97398397 GGGGAGCCCTGGAGGGAGGATGG - Intergenic
1057770693 9:97965198-97965220 GGGTGTATCTGCAGGGAAGAGGG - Intergenic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1059560888 9:115333631-115333653 GGGTGGTCCTGGGGGGAAGGGGG - Intronic
1059974585 9:119701973-119701995 GGGTGGTGGTGGAGGGAATTGGG + Intergenic
1060786766 9:126457224-126457246 TGTTGGTGATGGAGGGAAGAAGG - Intronic
1061012942 9:127966063-127966085 GGGTGGGCCGGGAGGGAGGCTGG + Intronic
1061249820 9:129420230-129420252 GCGGGGCCCTGGAGGGGAGATGG + Intergenic
1061297090 9:129682591-129682613 GGGTGAAGCTGGAGGGAGGAGGG + Intronic
1061741326 9:132708496-132708518 CTGTGGTCCTGGTGGGAACATGG - Intergenic
1062544560 9:137055660-137055682 CGCTGGGCCTGGAGGGAAGCGGG - Intergenic
1062589298 9:137266316-137266338 GGGCTGTCCTGTAGGGAGGACGG - Exonic
1062610380 9:137370767-137370789 GCGTGGGCCTGGAGCCAAGAGGG + Intronic
1187471530 X:19574015-19574037 GGGTGGGCTTGGAGTGGAGATGG + Intronic
1188147381 X:26630420-26630442 TGCTGGTCCTGGAGGGAGTAGGG - Intergenic
1188561738 X:31476214-31476236 GGCTGGTCCTTGAGGGCTGAAGG + Intronic
1188743795 X:33817254-33817276 TGGTGGTCCTGGGGGACAGAGGG + Intergenic
1189794773 X:44635236-44635258 AGGTGGTCCTGGAGGGAAAAAGG - Intergenic
1190128310 X:47724744-47724766 GGGTGGTCGGGAAGGGAAGGAGG - Intergenic
1190337040 X:49269059-49269081 GGGAGGACTTGGAGGCAAGATGG - Intergenic
1190767852 X:53490245-53490267 GGGTGGTCGTGGCAGGAAGAGGG + Intergenic
1192105278 X:68309851-68309873 TGGTGGTCCTAAAGGAAAGAAGG + Intronic
1192435013 X:71137711-71137733 GTATAGCCCTGGAGGGAAGAAGG - Exonic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1199458978 X:148061764-148061786 GGGGGGTCATGGAGGGAAGGAGG - Intergenic
1199698666 X:150361488-150361510 GCGTGGGCGTGGAGGGAAGGAGG + Intronic