ID: 1142966238

View in Genome Browser
Species Human (GRCh38)
Location 17:3583567-3583589
Sequence TTATTAGGGGAGCGCCCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142966233_1142966238 12 Left 1142966233 17:3583532-3583554 CCTCCATCAGGGGAAGGACACAC 0: 1
1: 0
2: 0
3: 19
4: 232
Right 1142966238 17:3583567-3583589 TTATTAGGGGAGCGCCCGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1142966234_1142966238 9 Left 1142966234 17:3583535-3583557 CCATCAGGGGAAGGACACACAAA 0: 1
1: 0
2: 4
3: 30
4: 208
Right 1142966238 17:3583567-3583589 TTATTAGGGGAGCGCCCGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1142966226_1142966238 30 Left 1142966226 17:3583514-3583536 CCTGCCCAGGAGGCACAGCCTCC 0: 1
1: 0
2: 1
3: 54
4: 538
Right 1142966238 17:3583567-3583589 TTATTAGGGGAGCGCCCGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1142966228_1142966238 25 Left 1142966228 17:3583519-3583541 CCAGGAGGCACAGCCTCCATCAG 0: 1
1: 0
2: 7
3: 42
4: 308
Right 1142966238 17:3583567-3583589 TTATTAGGGGAGCGCCCGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 53
1142966227_1142966238 26 Left 1142966227 17:3583518-3583540 CCCAGGAGGCACAGCCTCCATCA 0: 1
1: 0
2: 6
3: 34
4: 365
Right 1142966238 17:3583567-3583589 TTATTAGGGGAGCGCCCGCAAGG 0: 1
1: 0
2: 0
3: 1
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142966238 Original CRISPR TTATTAGGGGAGCGCCCGCA AGG Intronic
906133322 1:43475683-43475705 TTCCTAGGAGAGCCCCCGCATGG + Intergenic
909233539 1:73121755-73121777 TTATGAGGGTAGAGCCCTCATGG - Intergenic
1068632813 10:59315163-59315185 TTAATAGGGGATCGCTAGCAGGG + Intronic
1068758794 10:60684210-60684232 TGATTAGGGGCGCGCAGGCAGGG + Intronic
1073466271 10:103696216-103696238 CTATTAGGGCAGCGCCTGCTCGG - Intronic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1106066967 13:26362595-26362617 TTATTAGGTGAGGGCCCAGATGG - Intronic
1113196363 13:107811816-107811838 TTATAAGGGCAGAGCCCTCATGG + Intronic
1115464100 14:33695171-33695193 TTATTATGGAAGCTCCCTCAAGG - Intronic
1130321744 15:82848046-82848068 CTTTTAGAGGAGCTCCCGCAAGG - Intronic
1131518853 15:93098467-93098489 TTATGAGGGCAGAGCCCACAAGG + Intergenic
1132875619 16:2135689-2135711 TCGTTAGGGCAGCGCGCGCATGG + Exonic
1134519367 16:14911664-14911686 TCGTTAGGGCAGCGCGCGCATGG - Intronic
1134554566 16:15154564-15154586 TCGTTAGGGCAGCGCGCGCATGG + Intergenic
1134707037 16:16310319-16310341 TCGTTAGGGCAGCGCGCGCATGG - Intergenic
1134909938 16:18016319-18016341 TTATGAGGGCAGAGCCCTCATGG + Intergenic
1134960503 16:18401805-18401827 TCGTTAGGGCAGCGCGCGCATGG + Intergenic
1138747658 16:59382203-59382225 TTATTAAGGGAGTGCTCTCAAGG - Intergenic
1142966238 17:3583567-3583589 TTATTAGGGGAGCGCCCGCAAGG + Intronic
1149440938 17:56673346-56673368 TCATGAGGGGAGAGCCCTCATGG + Intergenic
1155026676 18:21946995-21947017 TCATTAGGGCAGAGCCCTCATGG - Intergenic
926536590 2:14120608-14120630 CTATTAGGGGAGCCCACGGAGGG - Intergenic
927943549 2:27120856-27120878 TCATGAGGGGAGAGCCCTCATGG - Intergenic
940667060 2:156621660-156621682 TCATTAGGGTAGAGCCCTCATGG - Intergenic
1174054161 20:47786342-47786364 TTACGAGGGGAGCGCCCGGCCGG - Exonic
1175404336 20:58716975-58716997 CTACCAGGGGTGCGCCCGCATGG + Intronic
1178584048 21:33858226-33858248 TTATTAGAGGAGCTGCCGCCTGG + Intronic
949232850 3:1772010-1772032 TTATGAGGGCAGAGCCCTCATGG + Intergenic
966221664 3:177557579-177557601 TTATGAGGGCAGGGCCCTCATGG - Intergenic
966393335 3:179475843-179475865 TTATGAGGGCAGAGCCCTCATGG + Intergenic
970823922 4:20251917-20251939 TTATTTGGGAAGCGCCCGGACGG + Intergenic
972031689 4:34467666-34467688 TTATGAGGGCAGAGCCCTCATGG + Intergenic
972297114 4:37750549-37750571 TCATGAGGGGAGAGCCCTCATGG + Intergenic
977439771 4:97049846-97049868 TCATTAGGGCAGAGCCCTCATGG - Intergenic
983795352 4:171855011-171855033 TTATTAAGGGAGTGCTCTCAAGG - Intronic
987696509 5:21341026-21341048 TTATCAGGGAAGCGCCCAAACGG - Intergenic
988755689 5:34245544-34245566 TTATCAGGGAAGCGCCCAAACGG + Intergenic
988964259 5:36400744-36400766 TTATTTGGGGAGCTCCTGGAGGG + Intergenic
991655737 5:68902170-68902192 TTATTAAGGAAGGGCCCCCAGGG - Intergenic
991743944 5:69711362-69711384 TTATCAGGGAAGCGCCCAAATGG + Intergenic
991753765 5:69843880-69843902 TTATCAGGGAAGCGCCCAAATGG - Intergenic
991795516 5:70291094-70291116 TTATCAGGGAAGCGCCCAAATGG + Intergenic
991803382 5:70400607-70400629 TTATCAGGGAAGCGCCCAAATGG - Intergenic
991823314 5:70586630-70586652 TTATCAGGGAAGCGCCCAAATGG + Intergenic
991833081 5:70718993-70719015 TTATCAGGGAAGCGCCCAAATGG - Intergenic
991887883 5:71290613-71290635 TTATCAGGGAAGCGCCCAAATGG + Intergenic
999662041 5:153874583-153874605 TTATCAGGGCAGAGCCCTCATGG + Intergenic
1004547113 6:16608522-16608544 CTAGTAGGAGAGCGCCTGCAAGG + Intronic
1005554332 6:26957320-26957342 TTATCAGGGAAGCGCCCAAACGG + Intergenic
1005854235 6:29848339-29848361 TGATTAAGGGAGAGCCCGCTAGG - Intergenic
1007928364 6:45668375-45668397 TTATAAGGGCAGAGCCCTCATGG + Intergenic
1013631597 6:111991404-111991426 TTATTAGGGGATCACATGCAGGG + Intergenic
1022591272 7:31665747-31665769 TTCTTAGGGGAAGGCCCTCAGGG + Intergenic
1056481525 9:87011639-87011661 GTGCCAGGGGAGCGCCCGCAGGG - Intergenic
1058238792 9:102529078-102529100 TTATGAGGGCAGAGCCCTCACGG + Intergenic