ID: 1142967361

View in Genome Browser
Species Human (GRCh38)
Location 17:3589998-3590020
Sequence CATCAGCGCCAGGGACTCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142967361_1142967370 28 Left 1142967361 17:3589998-3590020 CCACCGAGTCCCTGGCGCTGATG 0: 1
1: 0
2: 0
3: 13
4: 95
Right 1142967370 17:3590049-3590071 GGAACTTCACGATGCCCAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 76
1142967361_1142967366 -7 Left 1142967361 17:3589998-3590020 CCACCGAGTCCCTGGCGCTGATG 0: 1
1: 0
2: 0
3: 13
4: 95
Right 1142967366 17:3590014-3590036 GCTGATGTCGGCCGTCTGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 65
1142967361_1142967368 7 Left 1142967361 17:3589998-3590020 CCACCGAGTCCCTGGCGCTGATG 0: 1
1: 0
2: 0
3: 13
4: 95
Right 1142967368 17:3590028-3590050 TCTGCCAGGAGTTCTGCAGCAGG 0: 1
1: 1
2: 1
3: 17
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142967361 Original CRISPR CATCAGCGCCAGGGACTCGG TGG (reversed) Exonic
900595348 1:3477826-3477848 GATCAGTGCGAGGGACTGGGGGG - Intronic
900765504 1:4502293-4502315 CATCAGCTCCATGGAGTCTGAGG - Intergenic
901733876 1:11299758-11299780 CATCAGAGACAGGGTCTCAGGGG + Intergenic
903950541 1:26993801-26993823 CATCAGCGCCTGCGGCCCGGGGG + Exonic
904725774 1:32546830-32546852 CAACAGCGCCAGGGAGACAGAGG - Intronic
905933766 1:41807631-41807653 CATCAGCCCCAGAGACACGCAGG - Intronic
907450152 1:54541184-54541206 CACCAGAACCAGGGATTCGGAGG - Intergenic
917953144 1:180062656-180062678 CATCACCGCTTGGGACTCTGCGG - Intronic
920422427 1:205844194-205844216 CATCAGGGACAGGGGCTCAGAGG - Exonic
922239969 1:223749041-223749063 CACCAGCGCCGCGGACTCGGAGG + Exonic
924198934 1:241640114-241640136 CAGCAGCGCCAGGCGCTCGTAGG + Exonic
1068865878 10:61895562-61895584 CATCAGCTCTAGGGAGTCTGCGG + Intergenic
1068910535 10:62374478-62374500 CATCTGCGCCCGCGGCTCGGCGG + Intronic
1070708190 10:78656914-78656936 CATCAGCTCCAGAGACGGGGCGG - Intergenic
1073176731 10:101561471-101561493 CCTCAGGGCCTGGGACTCGATGG - Intergenic
1073266547 10:102231297-102231319 CATCGGCGCCAGGGTCTGGCGGG + Intronic
1080789755 11:35511824-35511846 CATCAGCCCCATGGAGCCGGTGG - Intronic
1081621057 11:44619384-44619406 CACCTGCGCCAGGGACGCTGTGG - Exonic
1082770880 11:57206650-57206672 CATCGGGGTCAGGGTCTCGGAGG - Intergenic
1083635116 11:64116687-64116709 CACCATTGCCAGGGACTCGCTGG + Exonic
1083895948 11:65619786-65619808 CGTCAGCGCCCGGGAGTGGGAGG - Exonic
1085062108 11:73456848-73456870 AATCTGCACCAGGGACTTGGAGG - Intronic
1088816829 11:113427046-113427068 CATCAGCAGCAGGGAGTGGGGGG - Intronic
1089448523 11:118572900-118572922 CCTAAGCGCCAGGGAACCGGCGG - Intronic
1097053282 12:56236338-56236360 CAGCAGAGCCAGGGACTAAGGGG - Intronic
1106595199 13:31129635-31129657 CATCAGCGCCTGGGGGTTGGAGG + Intergenic
1108133022 13:47323657-47323679 CATCAGCACAAGGCACTCAGTGG + Intergenic
1112382195 13:98902360-98902382 CATCAGCGCCGGGGACGTGGTGG + Exonic
1119064111 14:71508590-71508612 CATCAGCTCCTGGAACTCTGTGG - Intronic
1121227407 14:92331215-92331237 CATGACAGCCAGGGACTCAGAGG - Intronic
1130047274 15:80455314-80455336 CATCAGCTCTAGGAATTCGGAGG - Intronic
1132523038 16:400225-400247 CATCCACGCCAGCGACTCCGTGG + Exonic
1133129229 16:3665915-3665937 CAGCAGCCCCAGGGACAAGGTGG + Intronic
1136570540 16:31094056-31094078 CATCAGAGACTGGGAGTCGGGGG + Intronic
1138112019 16:54331253-54331275 TATCAGCGCCAGGGTCCCTGGGG + Intergenic
1139190394 16:64856732-64856754 GATCAGTGCCAGGGCCTTGGGGG + Intergenic
1139870810 16:70107474-70107496 CATCACCGCCAGGGCCTCTGGGG - Intergenic
1140376069 16:74446403-74446425 CATCACCGCCAGGGCCTCTGGGG + Intergenic
1142624441 17:1182987-1183009 CCTCAGTGCCAGGGATGCGGAGG - Intronic
1142967361 17:3589998-3590020 CATCAGCGCCAGGGACTCGGTGG - Exonic
1143783661 17:9241950-9241972 AACCAGGGCCAGGGGCTCGGTGG - Exonic
1143894787 17:10127659-10127681 CATCAGAGCCCTGGAATCGGGGG - Intronic
1144234015 17:13239241-13239263 TTTCAGTGCCAGGGACTCTGAGG - Intergenic
1146794212 17:35769856-35769878 GATGAGGGCCATGGACTCGGGGG + Intronic
1148550552 17:48548011-48548033 TATCGGCTCCAGCGACTCGGCGG + Intergenic
1148906981 17:50918229-50918251 CATAGGTGCCAGGGACTCAGAGG + Intergenic
1153926383 18:9838777-9838799 CATCAGAGCCTGGGACTCAGAGG + Intronic
1154494328 18:14944629-14944651 CATCAGCGGCAGGGGGCCGGGGG + Intergenic
1154502020 18:15001832-15001854 CAGCAGTGCCAGGGACACGGAGG - Intergenic
1156056434 18:33010321-33010343 CATGACCGCCAGGGAATCTGAGG - Intronic
1157383153 18:47238086-47238108 CAGCAGCCCCAGGGACTAAGTGG + Intronic
1160866936 19:1260316-1260338 CATCCGCACCAGGGACGGGGCGG - Intronic
1160930475 19:1567678-1567700 CAGCAGCGGCAGCGACCCGGGGG + Exonic
1161269422 19:3381665-3381687 CAGGAGCGCCAGGGACGCAGAGG - Intronic
1162032090 19:7921903-7921925 CCTCAGAGCCAGGGACACTGAGG - Intronic
1162757328 19:12867952-12867974 CTCCAGCGCCGGGGACTCCGAGG + Exonic
1165045105 19:33098351-33098373 CCTCAGAGCCAGGGACTCAAGGG - Intronic
1167493038 19:49802703-49802725 CAGCAGAGGCAGGGACTTGGAGG + Intronic
1167741452 19:51326937-51326959 CCTCCTCCCCAGGGACTCGGGGG - Intronic
930152926 2:48076839-48076861 CCTCAGCGCCAGGGAAATGGTGG + Intergenic
932766212 2:74472157-74472179 CATCCGGGCCAGGGACGCGGCGG - Exonic
932837313 2:75049659-75049681 CATCAGCGCCGGCGACTATGAGG - Exonic
937264035 2:120604938-120604960 CAGCAGGGCCAGGGTCTGGGAGG + Intergenic
937438054 2:121895618-121895640 CATCAGCTCCAGGGGCTCTCAGG + Intergenic
938501199 2:131832002-131832024 CAGCAGTGCCAGGGACAAGGAGG - Intergenic
941188301 2:162344376-162344398 CGTCCGCGCCTGGTACTCGGCGG + Intronic
946326001 2:218985073-218985095 CATCGCCGCCGGGGACTGGGCGG + Exonic
946418457 2:219552122-219552144 CAGTAGAGCCAGGGACTGGGCGG + Exonic
948289784 2:236816500-236816522 CAGCAGCGCCAGGGTCTCCTAGG - Intergenic
948449468 2:238060508-238060530 CAGCAGGGCCAGGGCCCCGGGGG - Intronic
1168962694 20:1879909-1879931 CCTGAGCCCCAGGGACTCAGAGG - Intergenic
1172182783 20:33013812-33013834 CGTCAGCTCCAGGGGCTCTGGGG - Exonic
1175086330 20:56462140-56462162 CATCACCCCCTGGGACTTGGAGG - Intergenic
1181176468 22:21039942-21039964 GATCAGGGACAGGGACTTGGGGG - Intergenic
1181466672 22:23114111-23114133 CCTCAGAGCCTGGTACTCGGTGG + Intronic
1182070135 22:27457779-27457801 CATCAGCTTCAGGGACTCAAAGG - Intergenic
1183507732 22:38218887-38218909 CCTCAGGGCCAGGGACCCTGGGG - Intergenic
1184522699 22:45004866-45004888 CATCAGCTCCACGGACTCTTGGG + Intronic
1184526292 22:45025430-45025452 CTGCAGCGCCTGGGACTCAGTGG - Intergenic
1184664109 22:45978456-45978478 CATCGGCGCACGGGGCTCGGCGG - Intergenic
1184667889 22:45998061-45998083 CCTCAGGGGCAGGGACTGGGGGG + Intergenic
950101093 3:10357476-10357498 CATCAGGGCCAGGAACTTGGAGG + Intronic
955896485 3:63706043-63706065 CATCGGAACCAGGGACTGGGAGG + Intergenic
956229495 3:66998203-66998225 AATCAGCGCCAGGAATTCGGAGG + Intergenic
959938188 3:112052321-112052343 CAGCTGAGCCAGGGACTCTGAGG + Intronic
961558844 3:127714984-127715006 CAGCAGCGCCAGGGGCTCCAGGG + Intronic
964002143 3:151787819-151787841 CATGAGAGCCAGTGACTCAGAGG - Intergenic
981966387 4:150608767-150608789 CATCATTGCCAGGGGCTGGGAGG - Intronic
987116815 5:14732255-14732277 CATCTGTGCCTGGGACTGGGAGG + Intronic
989196975 5:38725518-38725540 GATCAGCGCCAGGGACACTAAGG + Intergenic
989559944 5:42838533-42838555 CACCAGCATCAGGGACTCTGTGG + Intronic
1007398853 6:41592253-41592275 CACCAGCGCCCAGGACTTGGTGG + Intronic
1010013414 6:71076031-71076053 CTTCAGCCCCAGGGACTCAGTGG + Intergenic
1010428184 6:75749199-75749221 CCGCAGTGCCGGGGACTCGGCGG + Intronic
1019298414 7:290866-290888 CACCTGCGCCAGGGCCTCGGTGG + Intergenic
1019608056 7:1919991-1920013 CAACAGCTCCAGTGACACGGAGG + Intronic
1024238090 7:47413450-47413472 CATGATGGCCAGGGGCTCGGTGG + Intronic
1032947615 7:136870588-136870610 CATCATCGCCAGGGACTGGCGGG - Intronic
1035928249 8:3752763-3752785 CATGTGCCCCAGGGACTGGGTGG + Intronic
1036737553 8:11331551-11331573 CTTGAGAGCCAGGGTCTCGGTGG + Exonic
1039019047 8:33185197-33185219 CATCAGGGCCAGGGATGCAGAGG + Intergenic
1049673045 8:143878169-143878191 CACCGGCGCCCGGGACTCAGGGG + Intronic
1049679382 8:143910874-143910896 CAGCATCGCCAGGCAGTCGGTGG - Intergenic
1053145699 9:35710772-35710794 CAGCACAGCCAGGAACTCGGAGG - Intronic
1056823942 9:89863956-89863978 CATCATCTCCAGGGAGACGGGGG - Intergenic
1061493047 9:130956824-130956846 CATCCGCCCCAGGGTCTCGTTGG - Intergenic
1185633835 X:1537007-1537029 CCTCAGAGCCCGGGACTCGGGGG + Exonic
1185735045 X:2489921-2489943 CATCAGCGCCAAGGTCTTCGGGG - Exonic
1199875402 X:151924128-151924150 GATCATCTTCAGGGACTCGGAGG - Exonic