ID: 1142968158

View in Genome Browser
Species Human (GRCh38)
Location 17:3593703-3593725
Sequence GTGTGGGACAGGCGGTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142968158_1142968162 -9 Left 1142968158 17:3593703-3593725 CCCACTGACCGCCTGTCCCACAC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1142968162 17:3593717-3593739 GTCCCACACAGCCTACCATGTGG 0: 1
1: 0
2: 1
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142968158 Original CRISPR GTGTGGGACAGGCGGTCAGT GGG (reversed) Intronic
900619067 1:3578700-3578722 TTGTTGGAAAGGCGGACAGTTGG - Intronic
900792978 1:4691793-4691815 GTGGGGGACAAGCGCTCAGAGGG + Intronic
901738045 1:11324748-11324770 GTGTGGGGGCGGCGGTCATTAGG - Intergenic
902997446 1:20237832-20237854 TTGTGGAGCAGGGGGTCAGTGGG - Intergenic
903300315 1:22374202-22374224 GTGTGAGACAGGCAATGAGTAGG - Intergenic
904842070 1:33379314-33379336 GTGGGGGGCAGGGGGGCAGTGGG - Intronic
910159633 1:84259331-84259353 GGGTGGGAGTGGAGGTCAGTTGG + Intergenic
910771801 1:90838740-90838762 ATGTGGGAAAGGTGGTCTGTAGG - Intergenic
912903510 1:113678809-113678831 GCATGGCACAGGCGGTCAGGAGG - Intronic
917538842 1:175894286-175894308 CTGTGGGAAAGGCGGCAAGTAGG + Intergenic
920038620 1:203081939-203081961 GTTTGGGACAAGCAGGCAGTGGG + Intergenic
923144391 1:231187701-231187723 GGGTGGGAAAGGCGGGCAGAAGG + Intronic
1064283410 10:13971008-13971030 GTGTGGGACAGGAGGCAAGGCGG - Intronic
1067773061 10:49140893-49140915 GTGTGAAACAGGCAGTCAGCTGG + Intergenic
1073445213 10:103576338-103576360 GTGGGGAATTGGCGGTCAGTAGG + Intronic
1074240662 10:111635510-111635532 TTGTGTGAAAGGAGGTCAGTAGG - Intergenic
1075322442 10:121502914-121502936 GTGTGGGGCATGGAGTCAGTGGG - Intronic
1075466487 10:122655333-122655355 GTGGGGGACAGACAGTCAGAGGG + Intergenic
1076107501 10:127835070-127835092 GGGTGGGAGAGGCTGTGAGTAGG - Intergenic
1076744293 10:132504974-132504996 GTCTGGGACAGGGGTGCAGTGGG + Intergenic
1077094513 11:793620-793642 CTGTGGGGCAGGGGGTCAGCTGG + Intronic
1078771984 11:14359341-14359363 GTGTGGGAGTGGGTGTCAGTTGG + Intronic
1083803669 11:65060941-65060963 GTGTGGGGCAGGTGGAGAGTGGG - Intergenic
1084941634 11:72616312-72616334 GTGGGGGAAAGGGGGGCAGTGGG - Intronic
1086599726 11:88617892-88617914 GAGTGGGACAGGGAGACAGTAGG + Intronic
1093616255 12:21229138-21229160 GTGTGGGGCAGGTGGTATGTGGG - Intronic
1095271836 12:40227589-40227611 GGGTGGGACTGGAGGTCATTAGG - Intronic
1097265289 12:57740760-57740782 GTATGGGACAGGAGGTGAGAGGG + Intronic
1101463535 12:104923134-104923156 GTGTGGGTCACGAGGTCAGGAGG + Intronic
1102107200 12:110335645-110335667 GTGTGGGTCAGTCGGTCACGTGG + Intronic
1113650891 13:112033533-112033555 TTGTGGCAAAGGCTGTCAGTGGG - Intergenic
1116846365 14:49868180-49868202 GTGTGGGAGAGGCGGGGCGTGGG + Intergenic
1117093759 14:52275865-52275887 GTGTGGCACAGGGGGGCATTTGG + Exonic
1121120274 14:91371948-91371970 GGGTGGGAAAGGCAGGCAGTGGG + Intronic
1121458596 14:94055571-94055593 GTGTGTGCCAGGGGCTCAGTGGG - Intronic
1122119626 14:99545196-99545218 GTGTGGGAGAGGCAGGCAGCCGG - Intronic
1125899124 15:43329247-43329269 TTGTGGGACTGGAGTTCAGTGGG - Exonic
1128172458 15:65524956-65524978 TTGTGGAACAAGGGGTCAGTTGG + Intergenic
1130330060 15:82915330-82915352 GTGTGGAAGAGGCAGACAGTGGG - Intronic
1130654287 15:85781238-85781260 GTGCAGGACAGGCTGTCAGATGG - Intronic
1136030149 16:27496814-27496836 GTGCAGGACAGGCAGTCAGAAGG + Intronic
1136417390 16:30112434-30112456 GTGTGGGAAAAGGGGTCAGAGGG + Intronic
1137056998 16:35750731-35750753 GTGGGGGCCAGGGGGTCAGGAGG - Intergenic
1139118032 16:63980445-63980467 GTCTGGGCCAGGTGGTCAATTGG + Intergenic
1140380523 16:74482811-74482833 GTGTGGTACAGGCTGGTAGTGGG + Intronic
1142029041 16:87829382-87829404 GTGGGGGACAGGCCCTGAGTGGG - Intergenic
1142968158 17:3593703-3593725 GTGTGGGACAGGCGGTCAGTGGG - Intronic
1147203976 17:38823654-38823676 TTGTGGGTCAGTCCGTCAGTTGG + Intronic
1147285830 17:39401903-39401925 GTGTGGAAAAGGGGGTCTGTGGG + Intronic
1148343507 17:46888234-46888256 GTGTGGGTCAGGTGGGGAGTTGG + Intergenic
1152691977 17:81722452-81722474 GGGTGGGAGAGGAGGCCAGTGGG + Intergenic
1153350638 18:4077567-4077589 GGGTGGGTCAGGCGGGCAGGAGG - Intronic
1153985146 18:10344571-10344593 GTGTGGGACAGGAGGGCATCAGG - Intergenic
1154026633 18:10713948-10713970 TTCTGGGACAGGCAGTAAGTTGG + Intronic
1156261832 18:35451658-35451680 GTGTGGGATTTGGGGTCAGTGGG + Intronic
1157566428 18:48681744-48681766 GTGTGGGGCAGGCAGGCAGGTGG - Intronic
1161592527 19:5135279-5135301 GTGTGGGGCAGGCGGGCGGGCGG - Intronic
1162001004 19:7745077-7745099 GGGTGGCACAGGCGTTCTGTTGG + Exonic
1162327483 19:10007590-10007612 GGCTGGGGCAGGGGGTCAGTGGG - Intronic
1163580421 19:18135575-18135597 CTGTGGCAAAGGCTGTCAGTGGG + Intronic
1165466765 19:35979240-35979262 GTGTGTGACAGGGTGCCAGTGGG - Intergenic
1167820079 19:51919903-51919925 GTGTGGAAGAAGGGGTCAGTTGG - Intronic
1168301119 19:55405788-55405810 GAGTGGGAGAGGCGTTCACTGGG - Intronic
1168640287 19:58026742-58026764 GTCTGGGCCAGGCGGTGGGTGGG - Intergenic
1168651163 19:58093195-58093217 CAGTGGGGGAGGCGGTCAGTAGG - Intronic
928217369 2:29372890-29372912 GTGTGGGACAGGTGGTGAACTGG + Intronic
934513555 2:94968782-94968804 GTGTGGGACACGGGGCAAGTTGG - Intergenic
935709816 2:105888414-105888436 GTGTAGGAAATGCGGACAGTGGG + Intronic
948341543 2:237256650-237256672 GTCTGGGAAAGGAGGGCAGTTGG - Intergenic
948530307 2:238599861-238599883 GTGGGGGACAGGAGAGCAGTGGG - Intergenic
948687395 2:239677684-239677706 GTGTGGGACAGAGAGGCAGTGGG - Intergenic
1172190378 20:33058752-33058774 GGGTGGGATAGGCGCTCAGAGGG + Intronic
1178701034 21:34834370-34834392 GTGCAGGAGAGGCGGGCAGTGGG + Intronic
1179482351 21:41686133-41686155 GTGTGGGGCAGGTGGGCAGTGGG + Intergenic
1179522192 21:41953108-41953130 GCGAGGGACAGGCTGGCAGTTGG - Intronic
1179792694 21:43764624-43764646 GTGTGTGACAGGTGTTCACTGGG - Intergenic
1179926553 21:44538265-44538287 CTGTGGGAAAGGCCGTCAGCGGG - Intronic
1180994763 22:19959917-19959939 AGGTGGGACAGGCGGGCACTGGG + Intronic
1183303876 22:37071697-37071719 GTGTTGGTCAGTTGGTCAGTTGG + Intronic
1183738838 22:39658942-39658964 TTGTGGGGCAGGCGGACGGTGGG + Exonic
1184320359 22:43737114-43737136 GTTTGGAAGAGGCGGTGAGTTGG - Intronic
1184889491 22:47371111-47371133 GTGAGGGACAGTGGGTGAGTGGG - Intergenic
952832551 3:37577084-37577106 ATGTGGCACAGGTGGTCAGTGGG + Intronic
959122425 3:102248384-102248406 GTGTGGGAAACGAGGTCAGGAGG + Intronic
960427090 3:117522122-117522144 GTCTGGGACATGCAGGCAGTGGG - Intergenic
962740190 3:138357669-138357691 GTGGAGGCCAGGCGGCCAGTGGG - Intronic
963511148 3:146250951-146250973 CTGCGGGGCAGGCGGTGAGTGGG - Exonic
964310215 3:155384513-155384535 GTGGGGGGAAGGTGGTCAGTGGG + Intronic
966661112 3:182416014-182416036 GTATGGGACTGGTGGTCATTGGG - Intergenic
966882416 3:184357862-184357884 GGGTGGGGCAGGCGGTGAGTCGG + Intronic
969682241 4:8649781-8649803 CTGTGGGGCAGGCGGGCAGCGGG - Intergenic
980483189 4:133416455-133416477 GTAAGGGACAGAAGGTCAGTGGG + Intergenic
982073948 4:151720091-151720113 GTGTGGGACAGGCCCTCCGTTGG - Intronic
984329626 4:178298069-178298091 GTGTGGGGCGGGGGGGCAGTCGG + Intergenic
990173587 5:53082578-53082600 GTGTGGGACAGGGGGTATATGGG - Intronic
990446836 5:55901214-55901236 GTGTTGGACAGGCGGGAACTAGG - Intronic
997819952 5:137056267-137056289 GTGGGGGACAGGGGGTCTATGGG + Intronic
999484918 5:151985637-151985659 GTGTGGGGCAGGGGGTGAGGGGG - Intergenic
1003266076 6:4565852-4565874 GTGTGGGGCATGTGGTCATTAGG + Intergenic
1004059541 6:12179146-12179168 TTGTGGGACAGGCAATCAGGAGG + Intergenic
1007775006 6:44219859-44219881 GGGCGGGACAGGGGGCCAGTAGG + Intronic
1008427905 6:51380678-51380700 GTGTGGGACTGGTGGACAGAAGG + Intergenic
1011559990 6:88604378-88604400 GGGTGTGACAGGCATTCAGTAGG - Intergenic
1015147670 6:130005590-130005612 CTGTGGGGCAGGAGGGCAGTGGG + Intergenic
1015461835 6:133500424-133500446 TTGAGGTACAGGCAGTCAGTGGG - Intronic
1015868637 6:137753688-137753710 GTGTGGGAAAGGGGATCAATTGG - Intergenic
1019536952 7:1534192-1534214 GTCCGGGACAGCCGGACAGTGGG + Intronic
1022494659 7:30845295-30845317 GTGTGGGGCAGGGGCTCTGTAGG - Intronic
1023974428 7:45017426-45017448 TTGTGGAACAGGAGGTCAGTTGG + Intronic
1030496889 7:110311695-110311717 GTGAGGGAGAGGAGGACAGTAGG - Intergenic
1032086337 7:128885761-128885783 GTGTGGGACGAGGGGGCAGTGGG + Intronic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1035010892 7:155714195-155714217 GTGTGGAATAGGCAGGCAGTTGG + Intronic
1035271655 7:157723371-157723393 GTGGGGGACAGGTGGCCAGCCGG - Intronic
1037704871 8:21310388-21310410 GTCTGGGACTGGTAGTCAGTGGG + Intergenic
1041196712 8:55408491-55408513 GTGTGGGACAGCCCCCCAGTGGG + Intronic
1047508379 8:125497581-125497603 GTGTGGGAGAGGCAGCCAGAAGG + Intergenic
1047877037 8:129149965-129149987 GTGTGGGAGAGACAGTAAGTTGG + Intergenic
1056733915 9:89188804-89188826 GGGTGGGACCAGCGGTCTGTGGG - Intergenic
1057691863 9:97292787-97292809 GTGAGGTACAGTGGGTCAGTGGG + Intergenic
1058080683 9:100698494-100698516 GTGTGGCACAGGAGGTACGTGGG + Intergenic
1059458530 9:114414898-114414920 GTGGGGGACAGGAGGTCATCTGG + Intronic
1060934136 9:127506037-127506059 CTGTGGGCCAGGCGGGCAGGAGG + Exonic
1190511966 X:51182470-51182492 GTGTGGGCAAGGCGATCAGTTGG + Intergenic
1193389896 X:80913970-80913992 GTGAGGAACAGGTGGTGAGTGGG + Intergenic
1196255611 X:113514810-113514832 GTGAGGGACAAGGGGTCAGCAGG + Intergenic
1199980372 X:152917376-152917398 GTGTTGGCCAGTCGGCCAGTGGG + Intronic
1200104033 X:153702573-153702595 GTGTGGGAGTGGCGTTCAGGAGG - Intronic