ID: 1142969560

View in Genome Browser
Species Human (GRCh38)
Location 17:3601902-3601924
Sequence GCTCACTTCTAAACTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142969558_1142969560 -9 Left 1142969558 17:3601888-3601910 CCAACTCCAGAAGTGCTCACTTC No data
Right 1142969560 17:3601902-3601924 GCTCACTTCTAAACTCCTACAGG No data
1142969555_1142969560 27 Left 1142969555 17:3601852-3601874 CCAATATGCTGGGATTACAGACA 0: 4
1: 387
2: 11254
3: 123398
4: 321342
Right 1142969560 17:3601902-3601924 GCTCACTTCTAAACTCCTACAGG No data
1142969557_1142969560 -8 Left 1142969557 17:3601887-3601909 CCCAACTCCAGAAGTGCTCACTT No data
Right 1142969560 17:3601902-3601924 GCTCACTTCTAAACTCCTACAGG No data
1142969556_1142969560 -3 Left 1142969556 17:3601882-3601904 CCACGCCCAACTCCAGAAGTGCT No data
Right 1142969560 17:3601902-3601924 GCTCACTTCTAAACTCCTACAGG No data
1142969554_1142969560 28 Left 1142969554 17:3601851-3601873 CCCAATATGCTGGGATTACAGAC No data
Right 1142969560 17:3601902-3601924 GCTCACTTCTAAACTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142969560 Original CRISPR GCTCACTTCTAAACTCCTAC AGG Intergenic
No off target data available for this crispr