ID: 1142969616

View in Genome Browser
Species Human (GRCh38)
Location 17:3602452-3602474
Sequence GACCCAGAAAACCACACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142969616_1142969617 -8 Left 1142969616 17:3602452-3602474 CCATCAGTGTGGTTTTCTGGGTC No data
Right 1142969617 17:3602467-3602489 TCTGGGTCATCATTTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142969616 Original CRISPR GACCCAGAAAACCACACTGA TGG (reversed) Intergenic
No off target data available for this crispr