ID: 1142969617

View in Genome Browser
Species Human (GRCh38)
Location 17:3602467-3602489
Sequence TCTGGGTCATCATTTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142969613_1142969617 1 Left 1142969613 17:3602443-3602465 CCATCACTGCCATCAGTGTGGTT No data
Right 1142969617 17:3602467-3602489 TCTGGGTCATCATTTGAAACAGG No data
1142969616_1142969617 -8 Left 1142969616 17:3602452-3602474 CCATCAGTGTGGTTTTCTGGGTC No data
Right 1142969617 17:3602467-3602489 TCTGGGTCATCATTTGAAACAGG No data
1142969611_1142969617 13 Left 1142969611 17:3602431-3602453 CCTCAGGGCTGGCCATCACTGCC No data
Right 1142969617 17:3602467-3602489 TCTGGGTCATCATTTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142969617 Original CRISPR TCTGGGTCATCATTTGAAAC AGG Intergenic
No off target data available for this crispr