ID: 1142970263

View in Genome Browser
Species Human (GRCh38)
Location 17:3606590-3606612
Sequence AACCACTTACTGGCACCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142970256_1142970263 13 Left 1142970256 17:3606554-3606576 CCCGCTCACCACTTCTTCAGAAG No data
Right 1142970263 17:3606590-3606612 AACCACTTACTGGCACCTCCTGG No data
1142970254_1142970263 26 Left 1142970254 17:3606541-3606563 CCAGCAAAGGAGCCCCGCTCACC No data
Right 1142970263 17:3606590-3606612 AACCACTTACTGGCACCTCCTGG No data
1142970255_1142970263 14 Left 1142970255 17:3606553-3606575 CCCCGCTCACCACTTCTTCAGAA No data
Right 1142970263 17:3606590-3606612 AACCACTTACTGGCACCTCCTGG No data
1142970257_1142970263 12 Left 1142970257 17:3606555-3606577 CCGCTCACCACTTCTTCAGAAGC No data
Right 1142970263 17:3606590-3606612 AACCACTTACTGGCACCTCCTGG No data
1142970258_1142970263 5 Left 1142970258 17:3606562-3606584 CCACTTCTTCAGAAGCATGCCGG No data
Right 1142970263 17:3606590-3606612 AACCACTTACTGGCACCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142970263 Original CRISPR AACCACTTACTGGCACCTCC TGG Intergenic
No off target data available for this crispr