ID: 1142973369

View in Genome Browser
Species Human (GRCh38)
Location 17:3628194-3628216
Sequence CATTTTAAGCAGAAGATGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 337}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142973369_1142973372 22 Left 1142973369 17:3628194-3628216 CCGTCCATCTTCTGCTTAAAATG 0: 1
1: 0
2: 3
3: 33
4: 337
Right 1142973372 17:3628239-3628261 TTTTGTTGAAGCTGAGTGATGGG 0: 1
1: 1
2: 15
3: 127
4: 590
1142973369_1142973371 21 Left 1142973369 17:3628194-3628216 CCGTCCATCTTCTGCTTAAAATG 0: 1
1: 0
2: 3
3: 33
4: 337
Right 1142973371 17:3628238-3628260 ATTTTGTTGAAGCTGAGTGATGG 0: 1
1: 0
2: 6
3: 62
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142973369 Original CRISPR CATTTTAAGCAGAAGATGGA CGG (reversed) Intronic
900775856 1:4585113-4585135 CATTTTAGGGAGAAGAAGGGGGG + Intergenic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
902669557 1:17963446-17963468 CATTTTAATCAGAAGCTAAAAGG + Intergenic
902966195 1:20005219-20005241 CATTTAAAGCAGTATATAGAGGG + Intergenic
903375689 1:22864401-22864423 CATTTTAGGCAGCAGAAGCAGGG + Intronic
904444958 1:30563377-30563399 CATTTGAAACAGAAAAGGGAGGG + Intergenic
905324921 1:37145144-37145166 CATTTTACCCAGAGGAAGGAAGG + Intergenic
905472521 1:38204289-38204311 CAGTTAAGGCAGGAGATGGAGGG + Intergenic
905503985 1:38462050-38462072 CTTACTAGGCAGAAGATGGAAGG - Intergenic
905596950 1:39215751-39215773 TATTTTTAGCAGAAGTTGGTTGG + Intronic
905906619 1:41622689-41622711 GATTTTAAGCAGCAGATAGCAGG + Intronic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906201932 1:43966075-43966097 CTTTTTGAGCAGGAGCTGGAGGG + Intronic
908281803 1:62546661-62546683 CATTTTAAGAAAAATATGTATGG - Intronic
908806384 1:67937255-67937277 CCCTTTCAGCAGAAGAGGGAAGG + Intergenic
910249410 1:85180111-85180133 CGTTTTAAGCAGGAGATGGGTGG + Intronic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
911527890 1:99007296-99007318 CATTTAAAGGAGAAGACAGAAGG - Intergenic
911686452 1:100782208-100782230 CAATTTAAGCAGAATTTAGAAGG - Intergenic
916273913 1:162972846-162972868 CCTTTTCAGCAGAAGTTAGAGGG + Intergenic
916803499 1:168236286-168236308 CATTTGAATGAAAAGATGGATGG + Intronic
918373563 1:183885473-183885495 CATATTAATCTGAAGTTGGAGGG + Intronic
918432139 1:184472233-184472255 CTTTTTAATCAGAAGAAGAAAGG + Intronic
918665055 1:187140693-187140715 CATTTAAAGCAGAGTATAGAGGG + Intergenic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
920507488 1:206526690-206526712 CATTAAAGGCAGAAGTTGGAGGG + Intronic
920519325 1:206612108-206612130 CATTTTGAGGTGAGGATGGAGGG - Intronic
920713169 1:208314995-208315017 CATCTCAAGGAGAAGATGAATGG + Intergenic
921069878 1:211649913-211649935 CAATTTGAGCAGAAGTTGGGAGG - Intergenic
921326633 1:213990548-213990570 CACTTTAGGCAGCAGGTGGAGGG + Intronic
921429706 1:215051253-215051275 AATTTTATGTGGAAGATGGAAGG + Intronic
921565999 1:216720966-216720988 CATTTTAATCAGAGGTTGAAAGG + Intronic
921670207 1:217916582-217916604 CATTCTAAGTAGAAGAGGGATGG + Intergenic
921744696 1:218726225-218726247 CATTCAAAGCATAAGATAGAGGG - Intergenic
921873356 1:220166488-220166510 CATTTTAAAAAGGAGGTGGAAGG + Intronic
924091269 1:240503602-240503624 CATTTCAAGCATAAGGTGTAAGG - Intronic
924097642 1:240570484-240570506 CAAATTAAGCAGAATATGGAAGG + Intronic
1065262495 10:23938073-23938095 TATACTAAGCAGAAGATGGGAGG - Intronic
1065652616 10:27909099-27909121 TATTTTAAGTAGCATATGGAAGG - Intronic
1065831141 10:29614817-29614839 CATTTTAACCATAAGCTGCAAGG - Intronic
1067712528 10:48661398-48661420 AACTTTAAGCAAAAGATGTAGGG + Intergenic
1068396633 10:56470342-56470364 CATTTTCAGCAGAAGAATCATGG + Intergenic
1068849010 10:61714663-61714685 CATTTAAAGCAGTATATAGAGGG - Intronic
1068993603 10:63177797-63177819 CATTTTAAGGAAAAGATTGAAGG - Exonic
1069188731 10:65461459-65461481 CATTTAAAGCAGTATATAGAGGG - Intergenic
1070216143 10:74383443-74383465 AATTTTCAGAAGAAGATGAATGG - Intronic
1070434016 10:76370839-76370861 CATTATAAGTTGAGGATGGAAGG + Intronic
1071269838 10:83996839-83996861 CATTTTAAGCATAAAATGCTGGG + Intergenic
1071325136 10:84507467-84507489 CATTTTAACCATAAAAAGGAAGG - Intronic
1072218015 10:93304243-93304265 CATTTGAACCAGAACATCGAGGG + Intergenic
1072344767 10:94493482-94493504 GATTTTAATAAGAAGATGGATGG + Intronic
1073152268 10:101320207-101320229 CATTCTAATCAGAAGATAAAAGG + Intergenic
1073568365 10:104555053-104555075 CATTTTGAGCAAAAAATGGCTGG - Intergenic
1074293191 10:112157057-112157079 CATTTTAAGTAGAAAAGGAAAGG - Intronic
1075606787 10:123817397-123817419 CATTATTTGCAGAAGATGGCAGG - Intronic
1078249721 11:9607141-9607163 CAGTTAAAGCAGAAAGTGGAGGG + Intergenic
1078813035 11:14790063-14790085 CATTTGAAACAGTAGATGGCAGG + Intronic
1079984028 11:27181109-27181131 GATTTCAAACAGAGGATGGAGGG + Intergenic
1080172860 11:29327229-29327251 CATTTGAAGTAAAAGATGAAGGG + Intergenic
1080242016 11:30137330-30137352 CATTTTAAGCAAATTATTGAAGG + Intergenic
1080300790 11:30782956-30782978 CATTTTAAGCAGAGAACAGAGGG + Intergenic
1080489208 11:32745056-32745078 CATTTAAAGCAGTGGATAGAGGG - Intronic
1080652862 11:34236516-34236538 CATTTTAAGCAGCAGATTTTAGG + Intronic
1082048772 11:47752976-47752998 CATTTGAAGTAGAAGAAGAAAGG + Exonic
1082599850 11:55135681-55135703 CATTCAAAGAAGAATATGGAGGG + Intergenic
1082760898 11:57126050-57126072 CATCTAAAGCGGAGGATGGATGG - Intergenic
1083165527 11:60883740-60883762 CATTTAAAGCAGTACATAGAAGG + Intergenic
1085370390 11:75998451-75998473 CATCTTAGGCAGAGGCTGGAAGG - Intronic
1085896750 11:80648923-80648945 CATTTAAGGCATCAGATGGAAGG + Intergenic
1086274058 11:85103918-85103940 CATTTTAACAAGAAGATAAACGG + Intronic
1086769186 11:90739871-90739893 GATATTAAGCTGAAGATTGAAGG - Intergenic
1087141728 11:94770598-94770620 CATTTTAAAAAGAAGGGGGAGGG - Intronic
1087341294 11:96910907-96910929 CATTTAAAGCAGTAGGTAGAGGG + Intergenic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1087893476 11:103561756-103561778 GAGTTAAAGCAGAAGATGGGTGG + Intergenic
1088783325 11:113157176-113157198 CTTTTTAAGCAGAACATGCCAGG - Intronic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1092910838 12:13143716-13143738 CATTCTAAGCAGGAGAAAGAAGG + Intergenic
1093489150 12:19684887-19684909 CCATTCAAGCAGAATATGGATGG + Intronic
1094253239 12:28391054-28391076 CTTTTTAAGGAGAAGATGTGTGG + Intronic
1094426272 12:30320409-30320431 CATTTAAAGTAGGAGATGAAGGG + Intergenic
1095812722 12:46387520-46387542 GATTTTAAAAAGGAGATGGAAGG + Intergenic
1097245015 12:57603089-57603111 CCTTTGGAGCAGAAGATGAAGGG - Exonic
1097281951 12:57850451-57850473 TATTTTAGGCAGAAGTTAGAAGG - Intergenic
1098416502 12:70241168-70241190 CATTTTTAGAAAAATATGGATGG - Intergenic
1099337201 12:81377752-81377774 GATTTTACCCTGAAGATGGAGGG - Intronic
1099731212 12:86505907-86505929 GATTTTAAACAGAAGAAGGCAGG + Intronic
1099772975 12:87086843-87086865 CATTTTAAGAAGAAACAGGAAGG + Intergenic
1100606156 12:96153699-96153721 CATTTAAAGAAAAAGATGTAAGG + Intergenic
1100735616 12:97526290-97526312 CATTTTAAGGAAAAGAAGAATGG - Intergenic
1102413246 12:112738540-112738562 CATTTTGAGCAGAATTTAGATGG + Intronic
1102839982 12:116108477-116108499 CATTGTCAACAGAAGTTGGAAGG - Intronic
1103560065 12:121788962-121788984 CATTTTAGGTAGAATGTGGAGGG - Intronic
1104144649 12:126020893-126020915 CATTATCAGCCTAAGATGGATGG + Intergenic
1104180557 12:126376201-126376223 CCTTTTAAGCAGAAGCCAGAGGG + Intergenic
1105753506 13:23444019-23444041 CCCTTTCAGCAGAAGAGGGATGG - Intergenic
1106248558 13:27967784-27967806 CATTTCAAGCAAAAGCTGGAAGG - Intronic
1108557028 13:51603527-51603549 CATTTTCAGCAAAATATTGAAGG + Intronic
1110659093 13:78037446-78037468 TTTTTTAAGCAAAAGATGGCTGG + Intergenic
1111140244 13:84108157-84108179 CATTCTAAGCAGTCGTTGGAAGG + Intergenic
1111780252 13:92714220-92714242 AATTTTGAGCAGCAGATGGGAGG - Intronic
1111954655 13:94743100-94743122 CATTATAGGCAGAATATGGAAGG + Intergenic
1112765971 13:102744116-102744138 CGTTTTAAGTACAAGATGAAAGG - Exonic
1114030031 14:18570231-18570253 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1115849022 14:37573079-37573101 CATTTTAAGCTAAAGATTGTTGG + Intergenic
1116305648 14:43251964-43251986 CATTTTAAGCCGAATATTTAGGG + Intergenic
1116609515 14:47049719-47049741 CATTCTATGCAGAATATGAAAGG - Intronic
1117394057 14:55291426-55291448 CAATTGTAGCAGAAGATTGATGG + Intronic
1117462851 14:55963547-55963569 CACTTTAAGCAGATGCTGCATGG - Intergenic
1118740107 14:68733322-68733344 CAGTTACAGCAGAAGCTGGAAGG + Intergenic
1123189756 14:106557497-106557519 CATTTTCATCAGCAGAGGGAGGG + Intergenic
1123197666 14:106631753-106631775 GATTTTCAGCAGCAGAGGGAGGG + Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124426094 15:29564422-29564444 CAAGTTAAGCAGAAGACAGATGG - Intronic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1128590618 15:68893363-68893385 GTTTCTAAGCAGAAGTTGGATGG + Intronic
1130926354 15:88388492-88388514 ACTTTTAAGCAGTAGAGGGATGG + Intergenic
1132170921 15:99653689-99653711 CATTTTAAAAACAATATGGAAGG - Intronic
1133085945 16:3363626-3363648 CATTTTAAAAAGAATATGCATGG + Intergenic
1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG + Intergenic
1134569535 16:15279519-15279541 CAAATCCAGCAGAAGATGGAGGG - Intergenic
1134732844 16:16476530-16476552 CAAATCCAGCAGAAGATGGAGGG + Intergenic
1134934598 16:18235441-18235463 CAAATCCAGCAGAAGATGGAGGG - Intergenic
1138937810 16:61751366-61751388 TTTTTTAAGGAGAATATGGAAGG - Intronic
1138971460 16:62149342-62149364 CATTTTAAGAAGAGAATGAAAGG + Intergenic
1139214646 16:65115276-65115298 TATTTTAAGTGGAAGAGGGATGG + Intronic
1141056592 16:80821409-80821431 GATTTTAAGATGAAGAAGGAAGG + Intergenic
1142647669 17:1325546-1325568 CATTTTCAACAGAAGATTGCTGG + Intergenic
1142973369 17:3628194-3628216 CATTTTAAGCAGAAGATGGACGG - Intronic
1143843590 17:9754761-9754783 CATTATAAACAGGAGATGTATGG + Intergenic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1146544497 17:33726436-33726458 CATTTCAAGCTGAACATGCAAGG - Intronic
1146558588 17:33848682-33848704 CATTCTAGGCAGTAGCTGGATGG + Intronic
1146713617 17:35064630-35064652 CATTTTAAGCAGGAAACAGAAGG - Intronic
1147265961 17:39234857-39234879 CGTTTTACCCAGAAGGTGGAGGG + Intergenic
1147909743 17:43848466-43848488 CATTTTAGGAGGAAGAAGGAAGG - Intronic
1148454579 17:47804218-47804240 CACTTTATTCAGAAGATGCAAGG + Intergenic
1148530190 17:48382753-48382775 CATCTTAACCAAAAGTTGGAAGG + Intronic
1150140302 17:62722730-62722752 CATTTTCTACAGAAGATGGCTGG - Intronic
1150178202 17:63084981-63085003 CATTATAACCAGTTGATGGATGG + Intronic
1151099356 17:71538984-71539006 ATTTTTAAGGAGGAGATGGAGGG - Intergenic
1152449945 17:80372335-80372357 TATTTTAAGGACAAGAAGGAGGG - Intronic
1155332786 18:24734719-24734741 TATTTAAAGCAGAGGAGGGAGGG + Intergenic
1155800381 18:30094194-30094216 CATTCTAAACACTAGATGGATGG + Intergenic
1156038129 18:32789015-32789037 CATTCTAAGCAGAAGATTGAAGG - Intergenic
1157694822 18:49713634-49713656 CATTTAAAGCAGTATATAGAGGG - Intergenic
1159401423 18:67940821-67940843 CATTTAGAAAAGAAGATGGATGG + Intergenic
1159424679 18:68270065-68270087 CATCTTAAGCATTAAATGGAAGG + Intergenic
1159627364 18:70710177-70710199 CATTTTAGGCACCAGATGTAAGG - Intergenic
1163280185 19:16311549-16311571 CCTTTTAAGCAGAAACTTGAAGG - Intergenic
1164567880 19:29341056-29341078 GATTTTAAGGAGAAAATGAAGGG - Intergenic
1165984810 19:39758709-39758731 GATATTATGCAGAAGATGGAAGG + Intergenic
1168430899 19:56279066-56279088 CCCTTTCAGCAGAAGACGGATGG + Intronic
925306938 2:2854490-2854512 CCTTGTAAGCAGGACATGGAAGG - Intergenic
926428410 2:12761214-12761236 CATTTTTAAAAGATGATGGATGG - Intergenic
927744538 2:25605013-25605035 CATTTTAAACAGAACTTGGCTGG - Intronic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
930860065 2:56062808-56062830 CATTTAAAGCAGTATGTGGAGGG - Intergenic
931295568 2:60921362-60921384 CACTTTTAGGAGAAAATGGAAGG - Intronic
933328586 2:80869244-80869266 CATTTTAAGAGGAAGTTAGAAGG + Intergenic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
936856249 2:116961057-116961079 CTTTTTTAGCAGAATATTGAAGG + Intergenic
939088801 2:137754403-137754425 CATTTAAAGAAGAATATGGCAGG + Intergenic
939396925 2:141642641-141642663 GATATGAAGAAGAAGATGGATGG + Intronic
939724397 2:145698235-145698257 CATGTTAAGGAGAAATTGGAGGG + Intergenic
940409362 2:153342700-153342722 CAACTAAATCAGAAGATGGAGGG - Intergenic
941286816 2:163624283-163624305 AATTTTAAGTAGAAGATCCATGG + Intronic
941763534 2:169270909-169270931 ATTTTTAAGCAAAAGATTGATGG - Exonic
941853808 2:170210282-170210304 CAGTTTAAACAAATGATGGAAGG - Intronic
941994779 2:171592051-171592073 TATTTTTAGGAGAAAATGGATGG + Intergenic
942143412 2:173001258-173001280 CATTTAAAACAGAATCTGGAAGG - Exonic
942641845 2:178068904-178068926 CATTTTAAGTAGAGAATGGAAGG + Intronic
942683431 2:178505321-178505343 CATCTTAAACTTAAGATGGAAGG - Exonic
943002747 2:182349546-182349568 CTTTCTAATCAGAAGATTGATGG - Intronic
943829593 2:192443255-192443277 CATTTGGAGCAGAACCTGGACGG + Intergenic
944001353 2:194842488-194842510 CTTTATAAGCACAAGATGGGGGG - Intergenic
944741322 2:202615561-202615583 CCTTTTAAGTTAAAGATGGAGGG + Intergenic
946637927 2:221750940-221750962 CATTTTAATCAGAAGAACAATGG + Intergenic
946835394 2:223767495-223767517 ATATTCAAGCAGAAGATGGATGG - Intronic
947390240 2:229631426-229631448 TATTTTAAGAAGAAGCTGGAGGG - Intronic
948689603 2:239693740-239693762 AATATTAGGGAGAAGATGGAGGG - Intergenic
948948505 2:241234122-241234144 CATTATTAGCAGATAATGGAAGG - Intronic
1169772781 20:9219646-9219668 TATTTTTAGGAGAGGATGGAGGG - Intronic
1170047291 20:12098762-12098784 CATTGTCAGCAGCAGCTGGAAGG + Intergenic
1173771524 20:45663578-45663600 CATTTTAAGCAGTGCATAGAGGG - Intronic
1173811327 20:45957622-45957644 CATGTTCAGCAGAAGATCCAAGG + Exonic
1177982497 21:27931800-27931822 GGATATAAGCAGAAGATGGATGG - Intergenic
1178771854 21:35512210-35512232 AATTTTAAGGAAAAGATGAAAGG + Intronic
1180454146 22:15497281-15497303 CATTTAAAGCAGTATGTGGAGGG + Intergenic
1182928484 22:34150471-34150493 CATTTCAACCAGGAGAAGGAAGG + Intergenic
1184122200 22:42459275-42459297 TATTTCAAGCAGAAGATCAATGG + Intergenic
1184464830 22:44662746-44662768 CATTTTAAGCACTCTATGGAAGG + Intergenic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
950207202 3:11090112-11090134 TAGTTTAAGCATAAGATGTAGGG - Intergenic
950896862 3:16460568-16460590 CATTTCAAGCAGAGGCTGGGTGG + Intronic
951393239 3:22132468-22132490 CAATTTAAGCTGAATAAGGAGGG + Intronic
951471329 3:23059759-23059781 CATTTAAAGCAGCATATAGAGGG - Intergenic
951760890 3:26146510-26146532 CATCATACACAGAAGATGGATGG + Intergenic
952470782 3:33649121-33649143 CATTCTAGGCAGAAGAAGCAAGG - Intronic
953302140 3:41788286-41788308 CATTTAAAGCAGAAGAAGCATGG + Intronic
953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG + Intergenic
954295440 3:49672148-49672170 CATTTTAAACAGAAGCCAGAAGG + Intergenic
954521233 3:51228464-51228486 CCTTTTAAACAGAATATGGTGGG - Intronic
954621949 3:52001530-52001552 CATTTCCAGCAGAAACTGGAAGG + Intergenic
955467796 3:59254543-59254565 CATTCTAATCAAATGATGGATGG - Intergenic
955872127 3:63450498-63450520 CATTTTAAACAGAGGAAGGCTGG + Intronic
956260495 3:67335550-67335572 CATTTTGAGTGGAAAATGGAGGG + Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956752977 3:72359611-72359633 TATTTTAAGCTGAAAATAGATGG + Intergenic
957409168 3:79815339-79815361 TATTGTAAGCAGCAGATGGTTGG + Intergenic
958259649 3:91365738-91365760 CATTTAAAGCAAAAGAAGGAAGG + Intergenic
958416120 3:93875782-93875804 CAGTTTAAGCAGTATATTGAAGG + Intronic
958843251 3:99234235-99234257 CATTTCATGCTGAAAATGGATGG + Intergenic
958860451 3:99438893-99438915 AATTTAAAGCAGAAGAAGGAAGG + Intergenic
958981780 3:100728925-100728947 CTTTTTAAGTAGGAGAAGGATGG + Intronic
960066863 3:113383568-113383590 AATTTTAAGCTGGATATGGAAGG + Intronic
961170975 3:124797519-124797541 CTTTTTAAACAGAATATGTAAGG + Intronic
962091861 3:132252630-132252652 CATTTTAACCAGGAAAGGGATGG - Intronic
962513757 3:136129008-136129030 CATTTAAAGCAGTGTATGGAGGG + Intronic
963073569 3:141325792-141325814 TAATTTAAGCAGACGATGGCTGG + Intronic
963920864 3:150903380-150903402 CATTTTCATCAGCAGATGTATGG + Exonic
965956809 3:174379982-174380004 GATTTTAAGCAGAAAAAGGAAGG + Intergenic
966401804 3:179555220-179555242 TTTTTTAAGCAGGAGGTGGAGGG - Intergenic
966449797 3:180045236-180045258 CACTTGAAGGAGAAGAAGGAAGG - Intergenic
968078691 3:195831791-195831813 CACTGGAAGCTGAAGATGGAGGG + Intergenic
968268680 3:197382671-197382693 CACATCAAGGAGAAGATGGAAGG - Intergenic
969099691 4:4759635-4759657 CATTTTAAGCAAACGTTCGAGGG - Intergenic
969104444 4:4794628-4794650 CATTTTCAGAAGAAGCAGGATGG - Intergenic
969595150 4:8144529-8144551 CATTTAATGCAGATTATGGAGGG + Intronic
970166231 4:13241270-13241292 CATTCTAAGGAGAAGAAGCAAGG - Intergenic
972899324 4:43663301-43663323 CAATTTAAACAGAAGCGGGAAGG - Intergenic
973028582 4:45306096-45306118 TATTGTAAGGAGAAGATTGAAGG + Intergenic
974761281 4:66277266-66277288 CATTTTAAAAAGAAGATGCATGG + Intergenic
975495910 4:75035653-75035675 CATTTAGAACACAAGATGGAGGG - Intronic
976145367 4:82037683-82037705 CATTTTAAGGAGAGAAGGGATGG + Intronic
976782610 4:88777769-88777791 CATTTTCAGGAGAAGATGGTAGG - Intronic
976954150 4:90874077-90874099 CTTTTTAAATTGAAGATGGAAGG - Intronic
976997552 4:91454427-91454449 CCTTATAAGTAGAAGGTGGAGGG - Intronic
979140716 4:117170563-117170585 CACTTTAAGAAGAATAAGGATGG - Intergenic
980597211 4:134970003-134970025 CATTTAAAGCAGAATGTAGAGGG + Intergenic
981574564 4:146191186-146191208 TCTTTTAAGGAGAAAATGGATGG + Intronic
982069629 4:151683840-151683862 CATTTGAGACAGAAGATGGGTGG - Intronic
984489878 4:180419646-180419668 GATTTTAAGCAGAAGACTAAAGG - Intergenic
984517522 4:180758850-180758872 CATATTAAGTAGAAGATATATGG - Intergenic
984614135 4:181876710-181876732 CATTTCAAGCAGAAGTTTTAAGG - Intergenic
985365775 4:189231075-189231097 CAATTGTAGCAGAAGGTGGAGGG + Intergenic
987541954 5:19267415-19267437 ATTTTTAAGCAGAAGACTGATGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
987625759 5:20398282-20398304 CATTTTAAGAAAAAAATGAAAGG - Intronic
989564730 5:42890709-42890731 CATTTTAAGGAAAAAGTGGAGGG - Intergenic
990176597 5:53114809-53114831 AATTTTAGGCAGAAAAGGGAGGG - Intergenic
990492156 5:56313005-56313027 CATTTTGTGTAAAAGATGGAAGG + Intergenic
990916667 5:60913744-60913766 CATTTAAAGCAGTATATAGAGGG - Intronic
991308918 5:65213145-65213167 CATTTTACACATAAAATGGATGG + Intronic
992423001 5:76625764-76625786 CATTTAAAACTTAAGATGGATGG - Intronic
993370125 5:87082982-87083004 AATTTTATGAAGAAGATAGAAGG - Intergenic
994275009 5:97824915-97824937 CATTTTAAACAGATGTTGAAGGG - Intergenic
996530093 5:124519468-124519490 CTTTTTTATCAGCAGATGGAAGG + Intergenic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
997992835 5:138560373-138560395 CATTTGAAACAGAGGATGCAAGG + Intronic
998535247 5:142924255-142924277 CATCTTAAGGAGAAGAAGAAAGG - Intronic
998704941 5:144748194-144748216 CATTTTTAGCAGAAGAGGAGAGG - Intergenic
999723895 5:154419146-154419168 CATTTCAAGCAGGAGATGTTGGG + Exonic
1000462597 5:161541520-161541542 CAATTTATGCAGAAGATGCAAGG - Intronic
1000672946 5:164085145-164085167 CAATTCAAGCTCAAGATGGAGGG + Intergenic
1001566475 5:172702685-172702707 GATTTTAAGCAGAGGAATGATGG - Intergenic
1001864319 5:175090155-175090177 CATCTTGGGCAGGAGATGGAAGG - Intergenic
1002700235 5:181118943-181118965 CACTTTAGGCAAAAGGTGGAAGG + Intergenic
1002771674 6:295420-295442 CAGATTATACAGAAGATGGAGGG + Intronic
1003124817 6:3347872-3347894 CATCTTTAGCAGTAGAAGGAAGG - Intronic
1003453131 6:6255837-6255859 GATTTTAAAAAGAAGATTGAGGG + Intronic
1003838539 6:10096452-10096474 CATTTTAAGCTGAAAAATGAAGG + Intronic
1004977351 6:20983127-20983149 CAATTTAAGTAGAACAGGGATGG + Intronic
1005033153 6:21530163-21530185 CATTTTCTGCAGGAGCTGGAAGG - Intergenic
1005070371 6:21856810-21856832 CTTTGTGAGCTGAAGATGGAGGG + Intergenic
1005276811 6:24228341-24228363 GATTTTAAGCAGCAGGTGGTAGG + Intronic
1005368417 6:25103456-25103478 CTTTTCAACCAGAAGATGAAGGG - Intergenic
1005798017 6:29388370-29388392 TATTTTTAGTAGAAGAGGGATGG - Intronic
1005827701 6:29644875-29644897 CATTTTACAAAGAAGATTGAAGG + Intergenic
1005912671 6:30325166-30325188 GATTTTATGCTGAATATGGAAGG - Intergenic
1005929051 6:30467149-30467171 AATCTTCAGCAGAAAATGGAAGG + Intergenic
1006287586 6:33108770-33108792 GATTTTAAGCAGGAGAGTGATGG + Intergenic
1008090987 6:47293715-47293737 AGTTTTAAGCAGAGGATGAAAGG - Intronic
1008434158 6:51455651-51455673 CATTTTATTCAGAAGAAGTATGG + Intergenic
1008995586 6:57654624-57654646 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009184113 6:60553402-60553424 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009443828 6:63715749-63715771 CATTTTATGGAGAATAGGGAAGG + Intronic
1009679434 6:66872906-66872928 CATTTAAAGCAGTAGGTAGAAGG - Intergenic
1009918098 6:70021879-70021901 GATTTTAAGCTAAAAATGGAAGG - Intronic
1010505155 6:76648175-76648197 CATTTTCAGTAGAAAAAGGATGG + Intergenic
1010740478 6:79497014-79497036 CATTTCATGAAGAATATGGATGG - Intronic
1011528442 6:88292897-88292919 CCTTTTAAGGATAAGAAGGAAGG - Intergenic
1012138847 6:95595161-95595183 TATTTTATGCAGAAAATGAAAGG - Intronic
1012910190 6:105109371-105109393 CATATTGAGCAGAAAGTGGAGGG + Intronic
1012992630 6:105941472-105941494 CATTTGGAGTACAAGATGGATGG - Intergenic
1013716961 6:112973615-112973637 CATTTCAATCAGATGCTGGAAGG - Intergenic
1013727699 6:113120006-113120028 TAATTTAAGCAATAGATGGAAGG - Intergenic
1015064832 6:129011809-129011831 CATTTTAAGTGGAAAAGGGATGG + Intronic
1015707382 6:136102881-136102903 CATTCTAAGCTAAAGATGCAAGG + Intronic
1016072557 6:139757371-139757393 CAATTGAATCAGAATATGGAGGG - Intergenic
1016331114 6:142952717-142952739 CTTTTTAGGCAGAAGCTGGGTGG + Intergenic
1018116544 6:160591381-160591403 CATATTTGGCAGAAGGTGGAAGG - Intronic
1018480755 6:164187468-164187490 AATTTTAAGCAGGATAAGGAAGG - Intergenic
1018781964 6:167076250-167076272 CATTTGAAGCAAAAAAAGGAAGG - Intergenic
1019802909 7:3101446-3101468 TGTTTTAAGCAGAGGATAGAAGG + Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1020718985 7:11717456-11717478 CATGGAAAGCAGAAAATGGAGGG - Intronic
1021284021 7:18756988-18757010 CATTTTAAGAAGCAGTTGGTTGG + Intronic
1021839443 7:24710511-24710533 AATTTTATGGGGAAGATGGATGG - Intronic
1022034328 7:26519342-26519364 GCTTTTAAGAAGAAGTTGGAGGG - Intergenic
1022037248 7:26546130-26546152 CCTTTCAGCCAGAAGATGGAAGG - Intergenic
1023950758 7:44842635-44842657 AATTTGAAGTAGAAAATGGAAGG - Intronic
1024810886 7:53210895-53210917 CATATTCAGTAGAAGATGGAAGG - Intergenic
1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG + Intronic
1027760959 7:82278202-82278224 CAATTTATTCAAAAGATGGAAGG + Intronic
1028249411 7:88523300-88523322 CATTTACAGCAGAAGACTGAAGG - Intergenic
1029257082 7:99276751-99276773 CATGTTAGACAGAAGATGAAAGG + Intergenic
1030596571 7:111547085-111547107 CATTTTAAGCAGCAGAATGCTGG + Intronic
1030765867 7:113409078-113409100 CGTTTTTAGCAAAAGAAGGATGG - Intergenic
1030817787 7:114057908-114057930 CATTTAAAGCAGTGTATGGAGGG + Intronic
1031712384 7:125065244-125065266 CATTTTAGCAAGAAGCTGGATGG - Intergenic
1032347784 7:131133145-131133167 GATTTTGAGCAGAAGCTAGATGG + Intronic
1032656243 7:133933577-133933599 CATAATAAGCAGAAGATGAAGGG + Intronic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1034702001 7:153104616-153104638 CAACTTAATCAGAAAATGGAGGG - Intergenic
1036541716 8:9720473-9720495 CCTTGTAAGGAGATGATGGAGGG - Exonic
1037293111 8:17372198-17372220 CATTTTTAGCAGAAGGTGGCAGG - Intronic
1038323485 8:26551126-26551148 CCCTTTGAGCAGAAGAGGGATGG + Intronic
1038966858 8:32583297-32583319 CATCTTGAGCAGAAAAAGGAGGG - Intronic
1039262034 8:35782277-35782299 CATTTAAAGAAGCATATGGAGGG + Intronic
1039776000 8:40737329-40737351 CGATTTAAGGAGAAGAGGGATGG + Intronic
1041202885 8:55468156-55468178 CATAACAATCAGAAGATGGATGG - Intronic
1043277547 8:78418770-78418792 AATTTTAAATAGAAGATAGAAGG - Intergenic
1043305179 8:78784871-78784893 CTTTTCAAGGAGAAGATGGAGGG - Intronic
1044233038 8:89800960-89800982 CATTTTAGGAAGCAGATAGAAGG - Intergenic
1044418135 8:91959729-91959751 CATTTTAACAAGAAGATGAATGG - Intronic
1044748699 8:95395790-95395812 CATCTTAAGCAGTAGTTGGATGG - Intergenic
1045315324 8:101038995-101039017 AATTTTAAACAGAATATGTAAGG - Intergenic
1046541135 8:115585437-115585459 AATTTTAAGTAGAAAAAGGAAGG + Intronic
1046727472 8:117691049-117691071 GGTTTGAAGCAGACGATGGATGG + Intergenic
1047127357 8:121977079-121977101 CATTTTAAGTAGTACATGGCAGG + Intergenic
1047378390 8:124328484-124328506 CATCTTCAGCAGAATATTGAGGG + Intronic
1047548253 8:125840376-125840398 CATATAATGCAGAATATGGATGG + Intergenic
1047624884 8:126646561-126646583 CATGTTAAGTAGAAGATGGACGG + Intergenic
1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG + Intronic
1050158753 9:2695279-2695301 CATTTCAAGCAGAAGAGGCAAGG - Intergenic
1050196524 9:3090163-3090185 GATTTTAAGAAGTAGATTGAAGG + Intergenic
1050280829 9:4048297-4048319 CATGTTTAGCAGAAGATGGAAGG + Intronic
1050282524 9:4066004-4066026 CATTTTAATGAGATGTTGGAAGG - Intronic
1051984881 9:23072251-23072273 CATTTTTAAAATAAGATGGAAGG + Intergenic
1052129380 9:24823238-24823260 CATTTTAACCAAAAGCTGGGGGG + Intergenic
1052300250 9:26945827-26945849 CATTTGAAGCATGAGATGGATGG - Intronic
1054927331 9:70601847-70601869 CATGATAAGCAGAAAAGGGAAGG - Intronic
1055847877 9:80589174-80589196 CATCTTAAGGAGAAGAGTGAGGG + Intergenic
1058062873 9:100516663-100516685 CTTTTTAAACAGAAGAGGAAGGG + Exonic
1058555598 9:106163459-106163481 CTTTTTAAGTAGAAGAGGGAGGG + Intergenic
1061639548 9:131941505-131941527 AACTTTAAGCTGAAGAAGGAAGG + Intronic
1186942784 X:14529224-14529246 AATTTGAAGCAGAAAAGGGAAGG - Intergenic
1186990220 X:15059238-15059260 CAGTTTAAGTACAAAATGGAAGG - Intergenic
1188146406 X:26619015-26619037 CATTCTAAGTAGGGGATGGAGGG + Intergenic
1188675060 X:32929368-32929390 GATTTGAAGAAGAATATGGAGGG + Intronic
1189016808 X:37293459-37293481 GATTTTATGGATAAGATGGATGG + Intergenic
1190121725 X:47665843-47665865 CATGTTCAGGAGAAAATGGAGGG - Intergenic
1190125626 X:47702875-47702897 CATGTTCAGGAGAAAATGGAGGG - Intergenic
1192273640 X:69608536-69608558 AATTTTAAGCAGCAGTTTGAAGG - Intergenic
1192409650 X:70922047-70922069 CATTTCAGGCAGTAGCTGGAGGG - Intergenic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1194053463 X:89101153-89101175 CTTTTTGAGCAGAATATGGGGGG - Intergenic
1194931857 X:99898363-99898385 CATTTAAAAAACAAGATGGATGG - Intergenic
1195042450 X:101026906-101026928 CATTTTAAGCAGAATAAAAAAGG + Intronic
1198458296 X:136838756-136838778 CCCTTTAAGCAGAAGAGGGATGG + Intergenic
1200756039 Y:6990969-6990991 CATTTTAGGAAGGAGATGAAAGG - Intronic