ID: 1142973786

View in Genome Browser
Species Human (GRCh38)
Location 17:3631021-3631043
Sequence GGGAAGACAGCACTCCCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142973786_1142973800 28 Left 1142973786 17:3631021-3631043 CCTCCCGGGAGTGCTGTCTTCCC 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1142973800 17:3631072-3631094 GTCAGCCTGCGGCCTTGGTCAGG 0: 1
1: 0
2: 1
3: 5
4: 111
1142973786_1142973802 30 Left 1142973786 17:3631021-3631043 CCTCCCGGGAGTGCTGTCTTCCC 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1142973802 17:3631074-3631096 CAGCCTGCGGCCTTGGTCAGGGG 0: 1
1: 0
2: 1
3: 19
4: 180
1142973786_1142973797 23 Left 1142973786 17:3631021-3631043 CCTCCCGGGAGTGCTGTCTTCCC 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1142973797 17:3631067-3631089 CCCCTGTCAGCCTGCGGCCTTGG 0: 1
1: 0
2: 0
3: 17
4: 196
1142973786_1142973801 29 Left 1142973786 17:3631021-3631043 CCTCCCGGGAGTGCTGTCTTCCC 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1142973801 17:3631073-3631095 TCAGCCTGCGGCCTTGGTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 137
1142973786_1142973795 17 Left 1142973786 17:3631021-3631043 CCTCCCGGGAGTGCTGTCTTCCC 0: 1
1: 0
2: 1
3: 4
4: 145
Right 1142973795 17:3631061-3631083 CGCTTGCCCCTGTCAGCCTGCGG 0: 1
1: 0
2: 0
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142973786 Original CRISPR GGGAAGACAGCACTCCCGGG AGG (reversed) Intronic