ID: 1142976516

View in Genome Browser
Species Human (GRCh38)
Location 17:3647922-3647944
Sequence GAAGCAGGAGTGGCCACGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142976516 Original CRISPR GAAGCAGGAGTGGCCACGTC GGG Intronic
900506405 1:3031724-3031746 GAGCCAGGAATGGCCACCTCTGG - Intergenic
903353782 1:22734027-22734049 GCCGCAGGAGTGGCCCTGTCAGG + Intronic
904279211 1:29406966-29406988 GAGTCAGGAGAGGCCACCTCAGG - Intergenic
904527434 1:31144438-31144460 GCAGCAGGAGTGGCCTGATCTGG - Intergenic
906144876 1:43554041-43554063 AAAGGAGGACTGGCCACCTCGGG + Intronic
906213485 1:44025276-44025298 GAAGCATGAGTGGCAAGGTGGGG + Intronic
907301239 1:53487556-53487578 GACCCTGGCGTGGCCACGTCAGG - Intergenic
913535406 1:119767382-119767404 GAAGGGGCAGTGGCCACGGCAGG + Intronic
915444218 1:155965669-155965691 CAAGGAGGAGCGGCCACGGCGGG + Exonic
915705242 1:157837539-157837561 GCACCAGGAGAGGCCACGTTTGG + Intronic
916026223 1:160835975-160835997 GAAGAAGGAATGTCCACATCAGG + Intronic
917845755 1:179018960-179018982 GAAGCAGGGGTAGCAACGGCAGG + Intergenic
922630024 1:227097491-227097513 CAACCAGGAATGGCCACATCAGG + Intronic
1062903981 10:1167122-1167144 GAATCAGAAGTGGCCACACCAGG + Intergenic
1064982874 10:21181765-21181787 GAAGCAGGAGGGCCCACGTGTGG - Intergenic
1066716288 10:38289816-38289838 GAAGGAGGAGTGGGGACGTAAGG - Intergenic
1067068248 10:43115481-43115503 GAAGCGGCAGTGGCCACATCTGG - Intronic
1067139611 10:43646126-43646148 TAAGCAGGAGTGGACATGTTTGG - Exonic
1068654693 10:59562785-59562807 GAAGCAGCAGTGGCCCAGACTGG + Intergenic
1072416372 10:95249935-95249957 CAAGCAGGAGTGGGCAGGACAGG - Intronic
1072662963 10:97373719-97373741 CAGGCAGGAGTGTCCACATCTGG + Exonic
1072935608 10:99710123-99710145 GAAGGAGGAGTGGCCACCAGAGG - Intronic
1075342495 10:121658695-121658717 CAAGCAGTAATGGCCACATCTGG + Intergenic
1077082903 11:733149-733171 GATGCAGGCGTGGCCAGGGCTGG - Intergenic
1078509255 11:11973509-11973531 CAAACAGGAGTGGCCAGGACTGG - Intronic
1081596571 11:44463590-44463612 GAAGCAGGAGAGGCAAGGCCAGG + Intergenic
1085496400 11:76973543-76973565 GAAGCATGAGTGCCCAGCTCAGG + Intronic
1088242636 11:107787576-107787598 AAAGCAGGAGTGGTCTCGGCAGG - Intergenic
1088250582 11:107858303-107858325 GAAGGAGGAGTGCCCACCTCGGG - Intronic
1090832852 11:130431123-130431145 GAAGCAGCAGTGGCCAGGCTCGG - Intergenic
1093778579 12:23106891-23106913 AAAGCAGGAAAGGCCACCTCTGG + Intergenic
1094851094 12:34382719-34382741 GAAGCAGAGGTGCCCCCGTCAGG - Intergenic
1095385476 12:41644989-41645011 GAAGCAGGAGTGTGCAGGACAGG - Intergenic
1098122543 12:67256962-67256984 GAAGCAGCAGATGCCACGGCAGG - Intergenic
1098361110 12:69655367-69655389 GAAGCACCAGTGCCCACATCAGG - Exonic
1099291244 12:80778776-80778798 GTAGCATGACTGGCCAGGTCTGG - Intergenic
1102439142 12:112948203-112948225 AAAGCAGGGGTGGCCAGGTGTGG + Intronic
1103402732 12:120654367-120654389 GAAGCAGGAGAGGACACGGTGGG + Intronic
1104797240 12:131528273-131528295 GACACACGAGGGGCCACGTCTGG - Intergenic
1106705788 13:32278059-32278081 GAAGTAGGTGTGTCCAAGTCAGG + Intronic
1108041805 13:46346285-46346307 GCCGCAGGAGTGGGCACCTCAGG - Intronic
1115615321 14:35089379-35089401 GAAGCATGAGCGACCACGCCTGG + Intronic
1117659230 14:57986838-57986860 GAATTATGAGTGGCCAGGTCAGG + Intergenic
1119322643 14:73740824-73740846 ACAGGAGGAGTGGCCACGTCGGG - Intronic
1119670174 14:76512499-76512521 GAACCATGACTGGCCACCTCTGG - Intergenic
1124960750 15:34392112-34392134 GAAGCAGGAGGGGGCACACCAGG + Intronic
1124977379 15:34538333-34538355 GAAGCAGGAGGGGGCACACCAGG + Intronic
1125786992 15:42327858-42327880 GAAACTGGAGAGGCCACATCTGG + Intronic
1129869926 15:78933606-78933628 GAGGCAGACGTGGCCACTTCGGG + Intronic
1130520148 15:84655730-84655752 GAAGCAGCAGTGCCTACGTCTGG - Intronic
1132138391 15:99367362-99367384 CAAGATCGAGTGGCCACGTCTGG + Intronic
1132574127 16:656916-656938 GAAGCTGGGGTGGCCAGGTGGGG + Intronic
1132682051 16:1146435-1146457 GAGGCCGGGGTGGACACGTCTGG - Intergenic
1133349851 16:5094116-5094138 GCAGCAGGAGTGGGGACGGCGGG + Intronic
1135013060 16:18901489-18901511 GAAGCATGAGTGACCACATCTGG + Intronic
1135319988 16:21489089-21489111 GAAGCATGAGTGACCACATCTGG + Intergenic
1135372821 16:21920577-21920599 GAAGCATGAGTGACCACATCTGG + Intergenic
1135438963 16:22450124-22450146 GAAGCATGAGTGACCACATCTGG - Intergenic
1136330212 16:29570781-29570803 GAGGCATGAGTGACCACATCTGG + Intergenic
1136444842 16:30310506-30310528 GAGGCATGAGTGACCACATCTGG + Intergenic
1137832329 16:51555720-51555742 GAATCAGGACTGGGCAAGTCAGG + Intergenic
1139430746 16:66909989-66910011 GAACCAGGAGCTGCCACATCTGG + Exonic
1141659321 16:85433422-85433444 GAAGCAGGAGTGCACACCACTGG + Intergenic
1142555744 17:775856-775878 GAAGCTGGAGTGGCCACTGACGG - Exonic
1142976516 17:3647922-3647944 GAAGCAGGAGTGGCCACGTCGGG + Intronic
1143661541 17:8327370-8327392 GAAGGAGGAGTGGCTAGCTCTGG - Intergenic
1144441357 17:15285704-15285726 GATGCAGGAATTGCCAGGTCTGG - Intergenic
1145961379 17:28888249-28888271 GTGGCAGGAGAGGCCAGGTCTGG + Intronic
1146564563 17:33901261-33901283 GTAGCAGCAGTGGCCACAGCAGG + Intronic
1147314801 17:39614650-39614672 GAAGCTGGACTGGACACCTCAGG - Intergenic
1147517195 17:41131302-41131324 GAAGCAGCTGTGACCATGTCCGG + Intergenic
1148133010 17:45273714-45273736 GAAGCAGCAGCTGCCACGTAGGG - Intronic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1150050768 17:61960002-61960024 CAAGCAGGAGCCACCACGTCTGG + Intronic
1157128002 18:44975908-44975930 GAAGCAGTAGTGGCCAAGCCTGG + Intronic
1158177554 18:54674290-54674312 GAGGAAGGAGTGGCCACTTTTGG - Intergenic
1158319543 18:56248219-56248241 GAATCAGTAGAGGCCACGTGGGG - Intergenic
1159169927 18:64752966-64752988 GAACCAGGAGTGCCAATGTCTGG - Intergenic
1159481090 18:68992396-68992418 GAGGCAGGAATGGCCATGTGGGG - Intronic
1160415815 18:78709886-78709908 GAAGGTGGAGTGGCCAGGCCAGG - Intergenic
1161093771 19:2377001-2377023 GAAACTGGAGTGGCCACGGGTGG + Intergenic
1162003952 19:7765327-7765349 GAGCCTGGAGTGGCCAGGTCTGG + Intronic
1163000562 19:14363983-14364005 GAGGCAGGAGGGGCCACGAGCGG - Intergenic
1163296156 19:16414157-16414179 GAAGGTGGAGGGGCCACGTGAGG + Intronic
1163783239 19:19261387-19261409 AAAGCAGAAGTGGCCAAGTGCGG - Intronic
1164032718 19:21422630-21422652 GAAGCAGGAATAGCCATGTTGGG + Intronic
1166100366 19:40567998-40568020 GGAGCAGGTGCGGCCACGACCGG + Exonic
1167126050 19:47549425-47549447 GAAGGAGGAAGGGCCACCTCGGG - Exonic
1167411627 19:49347509-49347531 GAAGCAGGAGTGGGGACGATGGG - Intronic
1167665456 19:50820888-50820910 GAAGCAGGAGTGACCGAGTGTGG + Intronic
1167957501 19:53078217-53078239 GAAACAAGAGTTGCCACCTCAGG + Intronic
925897012 2:8480145-8480167 GGAGCTGCAGTGGTCACGTCTGG - Intergenic
925955366 2:8958863-8958885 GAGACAGGTGTGGCCACGTGGGG + Intronic
926144820 2:10390616-10390638 CAAGCAGGAGAGGCCACTTCCGG + Intronic
930963693 2:57292623-57292645 CAAGCAGGATTGGCTACCTCTGG + Intergenic
933158944 2:79003048-79003070 GACCCAGGAGTGGACATGTCAGG + Intergenic
933541397 2:83647624-83647646 AAAGCAGGTGAGGCCACGACAGG - Intergenic
935204612 2:100887120-100887142 GAAGCAGGACTGGCCTCCTGAGG + Intronic
936102092 2:109590967-109590989 GAAGGAAGATGGGCCACGTCTGG + Intronic
941659938 2:168185888-168185910 GAAGCAGGAATGGTCACCTTTGG - Intronic
943566049 2:189517946-189517968 GAAGCCAGATTGGCCAGGTCGGG + Intergenic
949000563 2:241610577-241610599 GAAGCAGGAGTGGGGAGGGCGGG - Intronic
1173268723 20:41511818-41511840 GAAGCAGGAGTGGACAGGAAAGG - Intronic
1174581936 20:51578398-51578420 GAAGCAGGAGAGGACAGGTAAGG + Intergenic
1174958792 20:55131875-55131897 GAAGAAGGGGTGTCCATGTCAGG + Intergenic
1175786498 20:61715420-61715442 GAAGCAGGAGGGCCCACACCAGG - Intronic
1175874708 20:62223889-62223911 GGAGCAGGAGGGGCCCCGCCTGG + Intergenic
1175875622 20:62227969-62227991 GAAGCAAGGATGGCCACGGCGGG + Intergenic
1176083720 20:63286481-63286503 GTAGGAGGAGTGGCCAAGGCAGG - Intronic
1178982480 21:37276586-37276608 AAAGCAGAAGTTGCCAGGTCAGG - Intergenic
1179597716 21:42453995-42454017 GGAGCAGGAGTGGGAACATCTGG - Intergenic
1179666330 21:42915191-42915213 GAAGCAGGGGTGGCCAGGCGCGG + Intergenic
1179708029 21:43193813-43193835 GAACCAGGAGGGGCCTCGCCAGG - Intergenic
1179899402 21:44381202-44381224 GAAGCAGGGGAGGCCAGGTGTGG + Intronic
1182587975 22:31356858-31356880 GAAGCAGGAGAGGGCAGGTGTGG - Intergenic
1183002804 22:34875746-34875768 GAAGCAGGAGAGTCCACTTCGGG - Intergenic
949509277 3:4754219-4754241 GAAGCAGGAGTTGCAGGGTCAGG - Intronic
949953332 3:9247631-9247653 GAAGCAGGTGTGGCAACCTCAGG + Intronic
950203164 3:11059008-11059030 TAAGCAGGAGTGGCCAGGCAGGG - Intergenic
951281250 3:20752656-20752678 GCAGCAGGAGAGGCCACAGCAGG - Intergenic
960628309 3:119702914-119702936 AAAGCAGGAGTGGCCAGGCCAGG - Intergenic
963039542 3:141058656-141058678 GACACAGCAGTGGCCAAGTCGGG - Intronic
965710998 3:171556373-171556395 GAAGCAGACGAGGCCACTTCAGG + Intergenic
966505089 3:180691873-180691895 GAAGAAGGAGGGGCCAGTTCAGG - Intronic
966860610 3:184229493-184229515 GCAGCAGGCGTGGCCAGGGCAGG + Intronic
968001935 3:195212211-195212233 GAAGCGGGGGTGGCCACGGTAGG + Intronic
968160690 3:196424179-196424201 GCATCAGGAGTGGCCACGTGTGG - Intronic
969617327 4:8261508-8261530 GAAGCAGGGAGGGCCACGTCTGG - Intergenic
970531406 4:16989201-16989223 AAAGGATGAGTGGCCATGTCAGG + Intergenic
974723783 4:65773827-65773849 CAAGCAGGCGTAGCCAGGTCGGG + Intergenic
984493542 4:180467875-180467897 GAAGCAGGAGAGGTCCCTTCTGG + Intergenic
988711467 5:33780886-33780908 GCAGCAGGAGTGGTCTCATCAGG + Intronic
990987465 5:61654392-61654414 TGAGCAGGAGAGGCCAGGTCAGG + Intronic
993858338 5:93102892-93102914 GAAGCAGTTGTGTCCACATCTGG + Intergenic
994037361 5:95217496-95217518 AAAGCAGGTGTGGCCAAGACCGG - Intronic
997434137 5:133862035-133862057 GAAGCAGGAGGGGCCAGGCGCGG + Intergenic
1001446225 5:171785970-171785992 GAAGCAGGTGAGGCCAGGCCAGG + Exonic
1002279888 5:178123945-178123967 AAAGGGGGAGTGGCCAGGTCAGG + Exonic
1004173331 6:13316269-13316291 AGAGCAGGACTGGCCACCTCTGG + Intronic
1007060492 6:38936069-38936091 GAAGCATGAGCCACCACGTCTGG - Intronic
1007428533 6:41762752-41762774 CAAGCAGGAGTCACCACATCTGG + Intergenic
1007706960 6:43797072-43797094 GAAGTAGCAGAGACCACGTCCGG - Intergenic
1009328162 6:62380053-62380075 GCAGGAGGAGTGGCCAGGTGCGG - Intergenic
1013392781 6:109703611-109703633 GATGGAGGAGTGGACACCTCTGG - Intronic
1013585527 6:111575296-111575318 GAAGAAGGAGTGGCCGGGTGCGG + Intronic
1013687264 6:112600157-112600179 GCACCAGGAATGGCCATGTCAGG - Intergenic
1018686573 6:166308255-166308277 GAAGCCGGAGAGGCCGCGGCTGG - Exonic
1019276857 7:180284-180306 GACCCAGGAGCGCCCACGTCAGG + Intergenic
1019442261 7:1053291-1053313 GACGCAGGTGTGGCGACGGCGGG + Intronic
1024540731 7:50473358-50473380 GAAGCAGGAGTGGCCATGTGGGG - Intronic
1025190744 7:56893687-56893709 GGAGCAGGAGGGGCCAGCTCTGG + Intergenic
1025681199 7:63683237-63683259 GGAGCAGGAGGGGCCAGCTCTGG - Intergenic
1026427927 7:70315195-70315217 GAACAAGGAGTGGCAAAGTCAGG - Intronic
1026911658 7:74094798-74094820 GCGGCAGGAGACGCCACGTCAGG - Intronic
1026966564 7:74443910-74443932 GAAGCAGGAGGGGCCAGGAGGGG - Intergenic
1027175209 7:75899052-75899074 GCAGCAGCTGAGGCCACGTCTGG - Intergenic
1029616171 7:101659274-101659296 GAAGCAGGAGAGGCTACCTAGGG + Intergenic
1029666615 7:101999096-101999118 GCAGCAGGAGGGGCCACCTCTGG + Intronic
1030565380 7:111147713-111147735 GAGGCAGGAGCGACCACTTCTGG + Intronic
1030644352 7:112043021-112043043 CAAGATGGAGTGGCCACATCAGG - Intronic
1032851412 7:135798821-135798843 GAAGCAGCTGTGGTCACATCTGG - Intergenic
1034974543 7:155440155-155440177 GTAGGAGCAGCGGCCACGTCAGG + Intergenic
1035861553 8:3034007-3034029 GCAGCTGGAGGAGCCACGTCTGG - Intronic
1036656749 8:10681880-10681902 GAACCAGGAGTGGCCATGGGTGG - Intronic
1036849276 8:12190438-12190460 GCAGCAGGAGTGGGGACGGCGGG + Intronic
1036870636 8:12432712-12432734 GCAGCAGGAGTGGGGACGGCGGG + Intronic
1038506602 8:28090262-28090284 CAAGGAGGAGTGGCCAACTCTGG + Intronic
1039586407 8:38711101-38711123 GGAGCAGCAATGGCCACTTCCGG + Intergenic
1040776771 8:51053877-51053899 GAAGCAGGAGTGGACAACTGTGG + Intergenic
1042277623 8:67022042-67022064 AAACTAGGAGTGGCCACTTCTGG + Intronic
1045908958 8:107382785-107382807 CAAGCAGGAATGGCCAAGTTGGG + Intronic
1048831941 8:138486172-138486194 GCAGAAGGAGTGGCTAAGTCGGG + Intronic
1049129049 8:140820455-140820477 GGAGCAGGAGAGACCAAGTCAGG + Intronic
1049406690 8:142454752-142454774 GGGGCAGGAGTGGAGACGTCCGG - Intronic
1049507115 8:143008702-143008724 CAAGCAGGCGTGGCCAGGCCGGG + Intergenic
1049680048 8:143914081-143914103 GGAACAGGAGTGGCCCCGGCCGG - Intergenic
1049973539 9:841685-841707 GCAGCTGGAGTGGCGAGGTCTGG - Exonic
1057599644 9:96446561-96446583 CAAGGAGGAGAGGCCAGGTCAGG - Intergenic
1062729264 9:138100060-138100082 GAGGAAGGAGAGGCCATGTCTGG + Intronic
1203776664 EBV:77064-77086 GGAGCGGGAGCGGGCACGTCGGG - Intergenic
1189160294 X:38803787-38803809 GAATCTGGAGTGGCCGCGGCCGG - Exonic
1189959756 X:46313038-46313060 CAAGCAGGCGTCACCACGTCTGG + Intergenic
1192258682 X:69489537-69489559 GAAGCAGGAGAGGCTTCCTCTGG - Intergenic
1197034107 X:121853968-121853990 CAAGCAGGCGTGGCCACGCTGGG - Intergenic
1197725129 X:129771134-129771156 AAAGCAGGAATGGTCAAGTCTGG - Intergenic
1197756834 X:130001623-130001645 GAAGCAGGAGAGGCCATTTCAGG + Intronic
1199454411 X:148011623-148011645 TAAGTAGGAGAGGGCACGTCAGG + Intronic