ID: 1142978844

View in Genome Browser
Species Human (GRCh38)
Location 17:3660066-3660088
Sequence GGATTGGCTTGGATCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 166}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142978844_1142978852 3 Left 1142978844 17:3660066-3660088 CCACCTGGGATCCAAGCCAATCC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1142978852 17:3660092-3660114 CCCCAAGGAGAGACCCACCTAGG 0: 1
1: 0
2: 2
3: 21
4: 220
1142978844_1142978859 18 Left 1142978844 17:3660066-3660088 CCACCTGGGATCCAAGCCAATCC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1142978859 17:3660107-3660129 CACCTAGGGGCCTTCGTAGCTGG 0: 1
1: 0
2: 0
3: 2
4: 30
1142978844_1142978856 5 Left 1142978844 17:3660066-3660088 CCACCTGGGATCCAAGCCAATCC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1142978856 17:3660094-3660116 CCAAGGAGAGACCCACCTAGGGG 0: 1
1: 0
2: 1
3: 7
4: 123
1142978844_1142978863 29 Left 1142978844 17:3660066-3660088 CCACCTGGGATCCAAGCCAATCC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1142978863 17:3660118-3660140 CTTCGTAGCTGGAGGCTTTGTGG 0: 1
1: 0
2: 1
3: 15
4: 122
1142978844_1142978854 4 Left 1142978844 17:3660066-3660088 CCACCTGGGATCCAAGCCAATCC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1142978854 17:3660093-3660115 CCCAAGGAGAGACCCACCTAGGG 0: 1
1: 0
2: 0
3: 17
4: 137
1142978844_1142978861 21 Left 1142978844 17:3660066-3660088 CCACCTGGGATCCAAGCCAATCC 0: 1
1: 0
2: 1
3: 14
4: 166
Right 1142978861 17:3660110-3660132 CTAGGGGCCTTCGTAGCTGGAGG 0: 1
1: 0
2: 0
3: 6
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142978844 Original CRISPR GGATTGGCTTGGATCCCAGG TGG (reversed) Intronic
900330169 1:2130286-2130308 GGACTGGCATGGACCCCATGGGG + Intronic
900677630 1:3898381-3898403 GGAATGGCTGGGATTACAGGAGG - Intronic
901740990 1:11341789-11341811 TGGTTGGATTGGAGCCCAGGTGG + Intergenic
901763852 1:11487802-11487824 GGCATGGATTGGAACCCAGGAGG + Intronic
902512358 1:16973268-16973290 GGGTGGGCTTGGATCTAAGGAGG - Intergenic
903149237 1:21393970-21393992 AGAATCGCTTGAATCCCAGGAGG - Intergenic
904713968 1:32452766-32452788 AGAATGGCGTGAATCCCAGGGGG + Intergenic
905890567 1:41516193-41516215 GCGTTGGCCTGGATCCCAGCAGG - Intronic
908483173 1:64564209-64564231 AGATTAACTTGGATCACAGGAGG + Intronic
910342813 1:86207533-86207555 CGCTTGGCTTGCATCCCAGGAGG + Intergenic
913096030 1:115515986-115516008 GGATTTGCTTTCACCCCAGGAGG - Intergenic
920747010 1:208638387-208638409 GGACTGGGTTGGAATCCAGGTGG - Intergenic
924243875 1:242063045-242063067 GGTTTGGCCTGGACCCCAGGAGG + Intergenic
924597365 1:245459078-245459100 AAATTGGCTTGAATCACAGGAGG - Intronic
1063019382 10:2112183-2112205 GGCTTGGCTTACATTCCAGGAGG - Intergenic
1064665170 10:17643677-17643699 GAATTGGCCTGAATCCCAAGAGG - Intergenic
1072544069 10:96420884-96420906 GGCTTGGGTTGGATTCCTGGAGG - Intronic
1072669720 10:97420381-97420403 GGAGGGGCTTAGATCCCAGTGGG - Intronic
1074968270 10:118512857-118512879 AGAATGGCGTGAATCCCAGGAGG + Intergenic
1076203780 10:128578882-128578904 GGAGTGGCTGGAATCCCAGCAGG - Intergenic
1078465304 11:11545840-11545862 GGGAAGGCCTGGATCCCAGGGGG + Intronic
1084190067 11:67494737-67494759 GGATCGGCTAGGACCCGAGGAGG + Intronic
1085475901 11:76788786-76788808 GGCCTGGCTCTGATCCCAGGTGG + Intronic
1086819026 11:91412079-91412101 GGAATGGCGTGAACCCCAGGGGG - Intergenic
1088400860 11:109422043-109422065 GGGGTGGCTTGGAGCCCTGGCGG + Intergenic
1092756723 12:11770432-11770454 GGATGGGCCTGGATCACATGGGG - Intronic
1095543672 12:43340786-43340808 GGAGTGGCTTGGTCCCCAGGAGG - Intergenic
1096984289 12:55745861-55745883 GGCTGGGCTTGGCTCCCAGAAGG - Intronic
1101199072 12:102415957-102415979 GCAGTGGCTTGGCTCCCATGTGG + Intronic
1101558091 12:105830026-105830048 GGGATGGCTAGGAACCCAGGGGG + Intergenic
1103939627 12:124494766-124494788 GGATTGGGGTGGCTTCCAGGGGG - Intronic
1104380647 12:128304880-128304902 AGATTGGTTTGGATGCCATGGGG + Intronic
1105838665 13:24233805-24233827 GCTTTGGCTTGCATCCCAGGGGG - Intronic
1107069555 13:36255571-36255593 AGAATCGCTTGGAACCCAGGAGG + Intronic
1108090340 13:46843029-46843051 GGGATGGCTTACATCCCAGGTGG - Intronic
1110743070 13:79019656-79019678 TGAGTTGCTTGAATCCCAGGTGG + Intergenic
1114526919 14:23372267-23372289 GGGTAGGCTTGTATCCCCGGTGG + Intergenic
1114551306 14:23534252-23534274 GGTTGGGCTGGGGTCCCAGGTGG + Exonic
1122531642 14:102431981-102432003 GGGGTGGCCTGGAGCCCAGGGGG - Exonic
1126700410 15:51361839-51361861 AGATTTGCTTGAACCCCAGGAGG + Intronic
1128581194 15:68811345-68811367 GGAGTGGCTAGGTGCCCAGGAGG + Intronic
1129529671 15:76254113-76254135 GGATTGGCTTTTATCCCTGTGGG - Intronic
1130380893 15:83371643-83371665 AGAATTGCTTGGACCCCAGGAGG + Intergenic
1131451208 15:92541668-92541690 GGGTTGGAGTGGGTCCCAGGAGG - Intergenic
1131849143 15:96519148-96519170 GCATTGGCTTTGATTGCAGGTGG - Intergenic
1133199064 16:4191307-4191329 GGATTGGCTCAAAACCCAGGTGG + Exonic
1133269340 16:4602814-4602836 GCCTTGGCCTGGGTCCCAGGTGG + Intergenic
1133690195 16:8206590-8206612 GGATGGGCTTAGTTCCCAGATGG + Intergenic
1134376599 16:13681444-13681466 GCATTGGAATGGATTCCAGGAGG - Intergenic
1135103662 16:19628273-19628295 AGAATTGCTTGGAGCCCAGGAGG + Intronic
1136588353 16:31202167-31202189 GGAGGGGCCTGGATCCCAGCTGG + Exonic
1137252689 16:46751542-46751564 GGCTTGGCCTGGATTCCCGGAGG + Intronic
1141216944 16:82033642-82033664 GAGTTGGCTTTGAGCCCAGGTGG + Intergenic
1141223139 16:82090405-82090427 AGAATCGCTTGGACCCCAGGGGG - Intronic
1142672944 17:1495796-1495818 GGATGGGAGTGAATCCCAGGCGG - Exonic
1142805012 17:2366956-2366978 GGATGGGCTGGCAGCCCAGGAGG - Intronic
1142978844 17:3660066-3660088 GGATTGGCTTGGATCCCAGGTGG - Intronic
1143815346 17:9507861-9507883 GCATTGGCTTTGGTTCCAGGTGG - Intronic
1144131691 17:12252788-12252810 GGCTTTGTCTGGATCCCAGGAGG - Intergenic
1144924677 17:18795113-18795135 AGAATGGCTTGAACCCCAGGAGG - Intronic
1147741769 17:42674213-42674235 GGTTTGGCTGGGGTCCCGGGGGG - Intronic
1148865097 17:50624213-50624235 GGAATGGCTTTGAGTCCAGGGGG + Intronic
1151739133 17:75967378-75967400 AGAATGGCTTTGAACCCAGGAGG + Intronic
1152603931 17:81279321-81279343 TGATTGGCCTGGATGCCAGCTGG - Intronic
1152680059 17:81662908-81662930 AGAATGGCTTTGAACCCAGGAGG + Intronic
1152802417 17:82337096-82337118 CGGTTGGCTCGGCTCCCAGGAGG - Intergenic
1154470367 18:14694146-14694168 GAATTGGTGTGGATCCCAGCGGG - Intergenic
1155233109 18:23793471-23793493 GGAGAGGCTTGCATCCCTGGGGG + Intronic
1155668859 18:28345107-28345129 GGTTTGGCTTTGGACCCAGGAGG - Intergenic
1157190730 18:45579247-45579269 GTATGGGCTTGGATGCAAGGGGG + Intronic
1159915590 18:74184884-74184906 GGTTTGACTGGTATCCCAGGTGG + Intergenic
1160255292 18:77243414-77243436 GGACTGGCTGGGAAGCCAGGGGG + Intergenic
1161794314 19:6377711-6377733 AGAATCGCTTGGAACCCAGGAGG + Intronic
1162584176 19:11549059-11549081 GGAGTAGCTGGGATCACAGGTGG - Intronic
1162841927 19:13363158-13363180 GGGTTGGCTTGGGTCCGAGTGGG - Intronic
1162847440 19:13404300-13404322 GGATTGGCTCTGCTCTCAGGTGG - Intronic
1163721557 19:18900350-18900372 GGGTTGGCCTGGAGCCCTGGGGG + Intronic
1165022756 19:32937298-32937320 GGATGTGCTGGGATCCCAGTGGG - Intronic
1167463980 19:49640611-49640633 AGCTTGGCTAGGATCCCAGGAGG - Intergenic
1168576033 19:57511137-57511159 AGAATGGCATGAATCCCAGGGGG - Intronic
926847823 2:17161385-17161407 AGTTTGGCCTGGATGCCAGGAGG - Intergenic
927879562 2:26681111-26681133 TGATGGGCTGGGACCCCAGGAGG - Intergenic
929520599 2:42647065-42647087 AGAATGGCGTGGAACCCAGGAGG + Intronic
932073688 2:68644335-68644357 GGGCAGGCTTGGAACCCAGGCGG - Intronic
932978246 2:76630305-76630327 GGATTGGCTGGGAGCCCATAGGG - Intergenic
933029465 2:77309597-77309619 GCAGTGGCTAGTATCCCAGGGGG - Intronic
933881302 2:86672739-86672761 GGAATGGTGTGGATTCCAGGTGG + Intronic
935345605 2:102104820-102104842 GGAATGGCTGGCCTCCCAGGAGG - Intronic
935996382 2:108778814-108778836 GGATTGCTTTAGAGCCCAGGAGG - Intronic
938736407 2:134190565-134190587 GGATTTGATTGGAGCCCAAGTGG + Intronic
940749886 2:157613126-157613148 AGATTGGCTGGGATCCCAGAGGG - Intronic
942673429 2:178401668-178401690 GCATATGGTTGGATCCCAGGTGG + Intergenic
943456972 2:188120423-188120445 GGAATGGCGTGAACCCCAGGGGG - Intergenic
946665348 2:222043983-222044005 GGATTGGGGTGGATCCAGGGAGG + Intergenic
947525302 2:230873725-230873747 GGACTGGCCTGCATCCAAGGAGG - Intronic
948335443 2:237203516-237203538 GGATTGGGCTGGATCCCTTGAGG + Intergenic
1173860207 20:46278152-46278174 GGAGTGCCTAGGAGCCCAGGGGG - Intronic
1174457887 20:50662451-50662473 GGGCTAGCTTGGAGCCCAGGTGG + Intronic
1175231875 20:57478958-57478980 AGAATCGCTTGGAACCCAGGAGG + Intergenic
1176606255 21:8834613-8834635 AGAATGGCTTGAATCCCAGAAGG + Intergenic
1176804124 21:13463720-13463742 GAACTGGTGTGGATCCCAGGGGG + Intergenic
1180654211 22:17405511-17405533 GGAGTAGCTGGGATCACAGGCGG - Intronic
1181746992 22:24962388-24962410 GGATTGGCATGGAGCTGAGGGGG + Intronic
1182455628 22:30448402-30448424 GGACTGCCCTGGACCCCAGGAGG - Intronic
1183670888 22:39272007-39272029 GGATTGGCCAGGATCCCACATGG + Intergenic
1184593143 22:45499217-45499239 AGCTTGGATTGGAACCCAGGTGG + Intergenic
1184786752 22:46675777-46675799 GGGCTGGGTTGGAGCCCAGGAGG + Intronic
949581591 3:5393865-5393887 GGAATCGCTTTGAACCCAGGAGG - Intergenic
950041587 3:9923085-9923107 AGAATGGCTTGAACCCCAGGAGG + Intronic
950626690 3:14252718-14252740 GGACAGGCTTGGAACCCAGGTGG - Intergenic
951016352 3:17736587-17736609 TGATTGCCTTGGATCCCTGGTGG - Intronic
952964657 3:38613667-38613689 GGGTTGCCTTGGCTCCCAGGTGG + Intronic
954634665 3:52065016-52065038 GGAAGGGCCTGGAGCCCAGGTGG + Intergenic
955887941 3:63620429-63620451 GGAATCGCTTTGAGCCCAGGAGG - Intergenic
956156114 3:66299279-66299301 AGAATCGCTTGGAACCCAGGAGG - Intronic
956334061 3:68143825-68143847 GGATTGGCAGGGATCTTAGGAGG - Intronic
956515362 3:70040655-70040677 GGAATGTCTAGGATGCCAGGTGG + Intergenic
959525832 3:107375387-107375409 GAATTGGCATGGATCCAAGAGGG + Intergenic
961177912 3:124851126-124851148 TAATTGGCTTGGATTCCGGGAGG + Intronic
962351510 3:134659850-134659872 CCAGTGGCCTGGATCCCAGGGGG + Intronic
963371860 3:144411671-144411693 GCATTGGCTTTGCTTCCAGGTGG + Intergenic
964389652 3:156184145-156184167 GGACTGTCTTGGATCCTATGAGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967645833 3:191922518-191922540 GGATGGGGTGGGCTCCCAGGTGG + Intergenic
968541720 4:1171532-1171554 GGTCGGGCTTGGATTCCAGGGGG + Intronic
968863662 4:3193424-3193446 GGTTTGGATTTGATGCCAGGAGG + Intronic
968879467 4:3291924-3291946 TGATTAGTTTGGATCCCAGGAGG - Intergenic
969212660 4:5699731-5699753 GGAATTACTTGGAGCCCAGGAGG + Intronic
969261839 4:6038612-6038634 TGATGGGCCTGGATCCCAGCAGG - Intronic
971148151 4:24002214-24002236 AGAATGGCTTGAACCCCAGGAGG - Intergenic
971315797 4:25566965-25566987 GGAATGGCGTGAACCCCAGGGGG - Intergenic
982235979 4:153251273-153251295 GGTTTGGTTTGGACCCCAAGAGG - Intronic
987957698 5:24762649-24762671 GGGATGGCTTGGGTCCCAGTGGG - Intergenic
990153043 5:52842160-52842182 TGATTGGCTCAGATCCTAGGTGG + Intronic
993844379 5:92922383-92922405 GGCTTGGCTTTGATACCAGTTGG - Intergenic
994428178 5:99621900-99621922 GGATTGGCTTGGAGCCAGGAGGG + Intergenic
996571097 5:124933108-124933130 GAAGTGGCTGGGTTCCCAGGGGG - Intergenic
997917576 5:137943654-137943676 GGAATTGCTTGAACCCCAGGAGG + Intronic
997931982 5:138080232-138080254 AGAATGGCTTTGAACCCAGGAGG + Intergenic
1000773570 5:165388485-165388507 GGATTGGCTTGGAACCAAAAAGG + Intergenic
1005746331 6:28841549-28841571 AGAATTGCTTGAATCCCAGGAGG + Intergenic
1006731566 6:36239991-36240013 GGAATCGCTTGGATCACAGGTGG + Intergenic
1007345028 6:41222863-41222885 GGCTGGGCTTGGTTCCCAGATGG + Intergenic
1007971254 6:46054414-46054436 GGATTAGCTTGGATCACAGGAGG - Intronic
1009650216 6:66466706-66466728 GCATTGGCTTGGAAGTCAGGTGG - Intergenic
1010257250 6:73772414-73772436 AGAATGGCATGAATCCCAGGAGG + Intronic
1012615142 6:101268593-101268615 GGATTGGCTTGGAATCAAGAAGG + Intergenic
1015983726 6:138865003-138865025 TGATTGGCTGGGATCCCAATGGG + Exonic
1016979778 6:149843556-149843578 GGGTTGGCCTGGAACACAGGAGG - Intronic
1017189216 6:151633999-151634021 GGGTTGGCTTCAATCCCAGATGG + Intergenic
1019764815 7:2842869-2842891 GGATTTGCTTGGAGACCATGGGG + Intronic
1019970621 7:4537871-4537893 AGACCGGCTTGGGTCCCAGGCGG - Intergenic
1021510276 7:21427146-21427168 GGAGCGGCTTGGAGCCGAGGAGG + Intergenic
1022652769 7:32292741-32292763 GGATTGGCTTGGAACACAGCAGG - Intronic
1023366751 7:39472197-39472219 GGAATCGCTTGAACCCCAGGAGG + Intronic
1026287378 7:68975227-68975249 GGAGTAGCTGGGATCACAGGTGG + Intergenic
1026880064 7:73902207-73902229 GGCTTGGCTGGGCGCCCAGGTGG + Intergenic
1035459948 7:159032399-159032421 GGATGGGCCGGGCTCCCAGGCGG - Intronic
1036169814 8:6472553-6472575 AGAATGGCTTGAAACCCAGGAGG - Intronic
1037389781 8:18381104-18381126 GGATGGGCTTGGCTGCCATGAGG + Intergenic
1037858438 8:22388218-22388240 GGATTGGGGTGGATCTGAGGTGG + Intronic
1038381977 8:27104567-27104589 TGATTGGGATGGTTCCCAGGGGG + Intergenic
1039254576 8:35705051-35705073 AGAATGGCTTGAAACCCAGGGGG - Intronic
1041309048 8:56495611-56495633 GGACTAGATTGGATCCCAGAAGG - Intergenic
1042936554 8:74065016-74065038 GGTTTCGCTTGGACCACAGGGGG - Intergenic
1045573514 8:103394181-103394203 GGATTGGCTTGGAACCTGGGTGG + Intergenic
1047186511 8:122638066-122638088 GGATTGGCATTAAACCCAGGTGG - Intergenic
1047401069 8:124547893-124547915 AGAATTGCTTGAATCCCAGGAGG + Intronic
1048951223 8:139498488-139498510 GAATTGGCTTGGATCACCGTGGG + Intergenic
1056957908 9:91097162-91097184 GGATTGGCTTGGATTTGTGGGGG - Intergenic
1057018532 9:91677459-91677481 GCATTTCCTGGGATCCCAGGAGG + Intronic
1059392531 9:114008212-114008234 GGTTTGCCTTGGGGCCCAGGAGG - Intronic
1061569927 9:131470876-131470898 TGTTGGGCTTCGATCCCAGGTGG + Exonic
1061576737 9:131512115-131512137 GGATTGTAAAGGATCCCAGGAGG + Exonic
1062563671 9:137153898-137153920 AGAATCGCTTGAATCCCAGGGGG - Intronic
1185544098 X:927472-927494 GAGGTGGGTTGGATCCCAGGAGG - Intergenic
1187757550 X:22544436-22544458 GGGTGATCTTGGATCCCAGGGGG + Intergenic
1194077698 X:89417170-89417192 GGGTTGGCTTGGGTTCCGGGTGG + Intergenic
1198466222 X:136907074-136907096 GGACTGGCTTGGTGCCCAGCAGG + Intergenic
1198548462 X:137719364-137719386 GGTTTGGCTTTGATTCCAGGTGG + Intergenic
1200430349 Y:3072716-3072738 GGGTTGGCTTGGGTTCCGGGTGG + Intergenic
1200927753 Y:8669804-8669826 GAATTGATTTGGATTCCAGGAGG - Intergenic