ID: 1142979604

View in Genome Browser
Species Human (GRCh38)
Location 17:3663978-3664000
Sequence GCCCCCAGCCTAACATCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142979602_1142979604 -6 Left 1142979602 17:3663961-3663983 CCAGGTCATTCAAGTAGGCCCCC 0: 1
1: 0
2: 0
3: 2
4: 71
Right 1142979604 17:3663978-3664000 GCCCCCAGCCTAACATCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 167
1142979592_1142979604 28 Left 1142979592 17:3663927-3663949 CCTCTGGGATCTGGAAGCAGAGG 0: 1
1: 2
2: 4
3: 37
4: 404
Right 1142979604 17:3663978-3664000 GCCCCCAGCCTAACATCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 167
1142979591_1142979604 29 Left 1142979591 17:3663926-3663948 CCCTCTGGGATCTGGAAGCAGAG 0: 1
1: 0
2: 7
3: 31
4: 330
Right 1142979604 17:3663978-3664000 GCCCCCAGCCTAACATCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 167
1142979601_1142979604 -5 Left 1142979601 17:3663960-3663982 CCCAGGTCATTCAAGTAGGCCCC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1142979604 17:3663978-3664000 GCCCCCAGCCTAACATCCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142979604 Original CRISPR GCCCCCAGCCTAACATCCCA GGG Intronic
901399839 1:9008174-9008196 GCCCCCAGATGAACTTCCCAGGG + Intronic
902038536 1:13475319-13475341 GTTCCCAGTATAACATCCCAAGG + Exonic
902987445 1:20163624-20163646 GCACCCAACCCCACATCCCAGGG - Intronic
903737188 1:25537487-25537509 TCCCCCAGCCTAGCATCCACAGG - Intergenic
905405844 1:37731867-37731889 GCCCTCATCCTATCATCCCCCGG - Intronic
906151748 1:43591630-43591652 GCCCCCAGCCTCACAGCCGAGGG - Intronic
913195356 1:116451939-116451961 GCCTCCTGCCTAAGATCCCTTGG - Intergenic
913454705 1:119019207-119019229 GCCCCCAGCCAAACTTCTCTTGG - Intergenic
915101726 1:153505910-153505932 GCCCCCAGGCTGACATCCTCTGG - Intergenic
915553944 1:156650986-156651008 GCCCCAAGCCCAAGATCACAAGG + Intronic
916002496 1:160630550-160630572 GACCCCACCCTTTCATCCCAAGG + Intronic
917071951 1:171161122-171161144 GGGCCAAGCCTAACATACCATGG + Exonic
920174481 1:204091610-204091632 GCCCCCAGCCTTCCAACCCAAGG - Intronic
923144807 1:231190550-231190572 GCCCCCGGCGTAACATACCAGGG + Intronic
1063273205 10:4535287-4535309 GACCCCAGCCTCAATTCCCAGGG + Intergenic
1064481288 10:15743406-15743428 GCCCCTAGACTAACATACCCTGG + Intergenic
1065870442 10:29951816-29951838 GCCTGCAGCCTAAAAGCCCAGGG + Intergenic
1067039294 10:42940490-42940512 CCCCCCAGCCCAAGACCCCAAGG - Intergenic
1069865787 10:71501957-71501979 GGCCCCAGCCTCAAATTCCAAGG - Intronic
1072664931 10:97385826-97385848 GCCCCCAGCACAGCCTCCCAAGG + Intronic
1072728005 10:97826499-97826521 GCACCCAGCCTCCCACCCCAGGG - Intergenic
1072769960 10:98129617-98129639 AGCCCCAGCTTAACATCCCTGGG - Intergenic
1074587235 10:114780106-114780128 GCTCACACCCTAACATGCCAAGG + Intergenic
1076911481 10:133392253-133392275 GCCCACACCCCAACATCCCCCGG - Intronic
1077071449 11:675948-675970 GCACGCAGCCTGACATCCCCCGG + Intronic
1077230216 11:1455327-1455349 GCCCCCAGCCTGCCTCCCCAGGG + Intronic
1077267424 11:1658537-1658559 GCGCCCAGCCTAACATGGGACGG - Intergenic
1077439069 11:2559869-2559891 GGCCCCACCCTGACTTCCCATGG - Intronic
1078109614 11:8382059-8382081 GCCCCCACCCCCACATCCTACGG + Intergenic
1079091961 11:17487078-17487100 GTCCCCAGGCTAAGGTCCCAAGG + Intergenic
1079370008 11:19844101-19844123 GTCCCCAGGCTGACATCTCATGG + Intronic
1081469812 11:43359208-43359230 GCCCCCAGCCTACCCTCACAGGG + Intronic
1084561756 11:69909580-69909602 GACCCCAGCCTCCCATCCAAAGG + Intergenic
1084701485 11:70788967-70788989 GCCACCAGCCCCACACCCCAAGG - Intronic
1086261416 11:84945657-84945679 TCCCCCAGCCTGCCAGCCCAGGG + Intronic
1086595116 11:88561373-88561395 GCCCCCTGACTAGAATCCCAGGG + Intronic
1088608683 11:111556416-111556438 GCCCCAACCCTATCATCACATGG + Intronic
1088851373 11:113706131-113706153 TCCACCAGCCTAGAATCCCAAGG + Intronic
1097176545 12:57146745-57146767 GCCCCCAGCTCAGCACCCCAAGG - Intronic
1097245673 12:57606364-57606386 GCCCCCAACCCAGCAGCCCATGG - Intronic
1099776196 12:87134958-87134980 GCCTCCATCCTAAAATCACAGGG - Intergenic
1100982524 12:100172836-100172858 GCCCCAAGCCTGACCTCCCTGGG - Intergenic
1102476956 12:113195040-113195062 GCCCTCAGCCTCACATTCCAGGG - Intergenic
1103889489 12:124228011-124228033 GCTCCCAGGCTCACCTCCCACGG + Intronic
1104971805 12:132534153-132534175 GCCCCCATGCTGACCTCCCAGGG - Intronic
1105734099 13:23249286-23249308 GACTCCAGACTAATATCCCAGGG - Intronic
1107433653 13:40362598-40362620 GCCTCCAACCTAACCTCCAAGGG + Intergenic
1107723988 13:43279061-43279083 GCCCCTAGCCCAACAGGCCAAGG - Intronic
1108187441 13:47902105-47902127 CTCCCCAGCCTAAAATCTCAGGG + Intergenic
1109284804 13:60397455-60397477 GCCCCCAACCCAACCTCCCTGGG - Intronic
1110329461 13:74254673-74254695 GCTCCGAGCCTCACATCACACGG - Intergenic
1114460051 14:22880663-22880685 CCCCCCAGCCACACAGCCCAAGG + Exonic
1114664159 14:24368580-24368602 GCCCCCAGCCTCACTTCCGCAGG - Intronic
1116020301 14:39452798-39452820 GCCCTCAGCCCAAAATCACAGGG - Intergenic
1118035408 14:61860932-61860954 TCCCCCAGCTTAAAATGCCATGG - Intergenic
1119385794 14:74257572-74257594 CCCGCCAGCCTCGCATCCCACGG - Intronic
1121322838 14:93002597-93002619 GCCACCAGCCTGACAGTCCAGGG + Intronic
1121446866 14:93984221-93984243 GCCCCCAGCCTGACCTCCTGTGG - Intergenic
1123469707 15:20541122-20541144 GCCCCAAGCCTGACCTCCCGGGG - Intronic
1123648356 15:22459577-22459599 GCCCCAAGCCTGACCTCCCGGGG + Intronic
1123682900 15:22775540-22775562 GCCCCAAGCCTGACTTCCCTGGG - Intronic
1123729985 15:23136108-23136130 GCCCCAAGCCTGACCTCCCGGGG - Intronic
1123748155 15:23333590-23333612 GCCCCAAGCCTGACCTCCCGGGG - Intergenic
1124280519 15:28357442-28357464 GCCCCAAGCCTGACCTCCCGGGG - Intergenic
1124302179 15:28554170-28554192 GCCCCAAGCCTGACCTCCCGGGG + Intergenic
1124334645 15:28848063-28848085 GCCCCAAGCCTGACTTCCCTGGG - Intergenic
1126696454 15:51329956-51329978 CCCTCCAGCCCCACATCCCAGGG - Intronic
1128054758 15:64691401-64691423 AACCCCAGCCTTCCATCCCAGGG + Intronic
1129108839 15:73325780-73325802 GTCCCCAGTGTAACATTCCAAGG - Intronic
1129269139 15:74410296-74410318 GCTCCCAGCCCAAGAGCCCATGG - Exonic
1129474572 15:75776100-75776122 GACCCAAGCCCAACATCCCTGGG + Intergenic
1129730230 15:77926446-77926468 GCCCCAAGCCCAACCTCCCTGGG - Intergenic
1130276280 15:82477862-82477884 GGCCCATGCCGAACATCCCAGGG - Intergenic
1130468641 15:84205255-84205277 GGCCCATGCCGAACATCCCAGGG - Intergenic
1130485108 15:84394507-84394529 GGCCCATGCCGAACATCCCAGGG + Intergenic
1130495634 15:84468324-84468346 GGCCCATGCCGAACATCCCAGGG + Intergenic
1130590934 15:85209854-85209876 GGCCCATGCCGAACATCCCAGGG - Intergenic
1133928203 16:10210993-10211015 TCCCACAGCCCAACCTCCCATGG - Intergenic
1134228171 16:12408275-12408297 GCCCTTAGCCTACCATCTCAGGG - Intronic
1134276609 16:12782034-12782056 ACCCCCAGCCTCACACCTCACGG - Intronic
1135421374 16:22307813-22307835 ACCCCCATCCTCACCTCCCATGG + Intronic
1137731694 16:50694501-50694523 GCTTCCAGCCTCAGATCCCAGGG - Intronic
1142979604 17:3663978-3664000 GCCCCCAGCCTAACATCCCAGGG + Intronic
1147549825 17:41432796-41432818 GCTCCTGGCCTAACACCCCAAGG - Intergenic
1147896800 17:43756590-43756612 TCCCCCAGCCCAGCCTCCCATGG - Intronic
1148124068 17:45228039-45228061 TCCCCCAGCCCCCCATCCCATGG + Intronic
1148346860 17:46908936-46908958 TCTCCCAGCCTGACAGCCCAGGG - Intergenic
1148755280 17:49969866-49969888 CCCCCCACCCCCACATCCCAGGG - Intronic
1150718913 17:67597722-67597744 TCCACCAGCCTAACAACCCCTGG - Intronic
1152271299 17:79326457-79326479 GACCCCAGGCCAGCATCCCATGG - Intronic
1155413536 18:25571679-25571701 ACCCACAGACTAACATCACATGG + Intergenic
1161297323 19:3526546-3526568 ACCTCCAGCCTCAGATCCCAGGG - Intronic
1161979733 19:7624194-7624216 GCCCCCAGCTGAGCCTCCCAGGG + Intronic
1162001497 19:7747190-7747212 GCCCCTAGCCCCACATCCCCAGG + Intronic
1162782308 19:13012641-13012663 GCGCCCATCCTGACATCCGACGG + Intronic
1165410117 19:35654693-35654715 GACCCCACCCCAGCATCCCAAGG - Intronic
1165621453 19:37251952-37251974 GCGCTCAGCCGAACATCCCAAGG - Intergenic
1166087693 19:40487883-40487905 ACCCCCAGCCTGAGACCCCAGGG - Intronic
1166213227 19:41320496-41320518 TCCCCCAGCCCAGCATCCCACGG + Intronic
1167571874 19:50293445-50293467 CTCCCCAGCCTCACACCCCAGGG - Intronic
925959611 2:9003325-9003347 GCCCCCAGCCCGCCATCCCCGGG - Intronic
926231157 2:11005305-11005327 GCCCCCAACCCAACATGCCTGGG + Intergenic
926564823 2:14457334-14457356 GCCCCCAGCTTGACAGCCCCTGG + Intergenic
935202085 2:100865980-100866002 ACCCTCAGCCTGACAGCCCAGGG + Intronic
940522574 2:154769507-154769529 TGCACCAGCCTTACATCCCACGG + Intronic
948120649 2:235527756-235527778 GCCCACAGCCTAGCATTTCAAGG + Intronic
948840882 2:240648316-240648338 CCTCCCAGCAGAACATCCCAGGG + Intergenic
1171960088 20:31487091-31487113 GCTCCCACCTCAACATCCCAAGG + Intergenic
1179515514 21:41903758-41903780 GCCCCCAGGCTCACCTGCCACGG - Intronic
1179937534 21:44614615-44614637 CCCCCCAGCCCAACACCCCCAGG - Intronic
1179995866 21:44973729-44973751 GCCTCCAGCCTGCCCTCCCAGGG + Intronic
1180202094 21:46230011-46230033 ACCCCCAGCCTAACTTCGAAGGG + Intergenic
1181061506 22:20284196-20284218 GCCCCCAGCCCAACTTCCTCTGG + Intergenic
1182072353 22:27472600-27472622 GGCCCCATGTTAACATCCCAGGG - Intergenic
1183080226 22:35451442-35451464 GCCCCCAGCCTAACCTCAGCCGG + Intergenic
1184291140 22:43498741-43498763 CCACCCAGCCCAACATCCCCAGG + Intronic
950882308 3:16332611-16332633 TCCCCCAACCTCCCATCCCATGG + Intronic
951311257 3:21128699-21128721 GCAACCAGCCTTGCATCCCAGGG - Intergenic
952311899 3:32198237-32198259 GCTCCCAGCCTGCCATCCCAAGG - Intergenic
956390816 3:68771023-68771045 GCCCCCAGCCAAACTCCCCTTGG - Intronic
961558827 3:127714934-127714956 ACACCCATCCCAACATCCCAGGG + Intronic
966455912 3:180116020-180116042 GCCCCCATCTGAAAATCCCAAGG + Intergenic
967305140 3:188052271-188052293 ACCCCCAGCCTACCACCACAAGG + Intergenic
968746368 4:2362609-2362631 GCCCCCAGCCTGGCAGCCCCTGG - Intronic
968982591 4:3858454-3858476 ACCCCCAGTCTAGCATCGCAGGG - Intergenic
969331186 4:6474195-6474217 GCCCCCCACCTCACATCCTAAGG + Intronic
972152404 4:36110072-36110094 GCCCCTTGCCTCACATCACATGG + Intronic
972715414 4:41641148-41641170 GCCCTCATCCCAACAGCCCAAGG + Intronic
974409053 4:61515215-61515237 GCCTCCAGGCTAAAATCCCTTGG - Intronic
977619493 4:99120323-99120345 GCCCCCAGCCTAACTCCTCTTGG - Intergenic
978564176 4:110064348-110064370 GGCCCCCTCCTGACATCCCATGG - Intronic
986393500 5:7306074-7306096 GCCCCAAGCCTGACTTCCCTGGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991290322 5:65027451-65027473 CCCCACAGCCTCACATCCAAGGG + Intergenic
996852307 5:127966601-127966623 GCCCCGAGCCAAACATCTCTCGG + Intergenic
997990866 5:138543396-138543418 CCCCCCAGCCTTACCTCACAAGG - Intergenic
999290618 5:150423234-150423256 TCCCCCAGCCTTTCATCCCAGGG - Intergenic
999350375 5:150864588-150864610 GCCCACAGCCTACCATTCCAGGG - Intronic
1001420508 5:171582829-171582851 GCCGCCATCCTACCATCACAAGG - Intergenic
1002780233 6:359560-359582 GCCGCCAGCCCAGCATCCCCAGG - Intergenic
1002974106 6:2057148-2057170 GCCACCAGCCTTACTTCCTAAGG + Intronic
1006671536 6:35732286-35732308 GCCCCCAGCCTTTCATCTCTTGG + Intergenic
1008363816 6:50651983-50652005 CCCCCTAGCCTACCACCCCAGGG - Intergenic
1009468402 6:64002160-64002182 GCCCCCAGCCAAACTCCCCTTGG - Intronic
1011168236 6:84475745-84475767 CCACCCAGCCTTGCATCCCAGGG + Intergenic
1016545194 6:145213989-145214011 GCCCAAAGCCTAACATCCCAGGG + Intergenic
1016575877 6:145569367-145569389 GCCCCCAGCATGCTATCCCATGG + Intronic
1019414851 7:922474-922496 TCCCCCAGCCCAAGATGCCATGG + Intronic
1019808323 7:3145465-3145487 GCTCACAGCCTCACATTCCAGGG + Intronic
1020168212 7:5824160-5824182 GCCCCCAGCCTCACGGCCCTGGG - Intergenic
1022484603 7:30768662-30768684 TCCTCCTGCCTAACCTCCCAAGG - Intronic
1022671801 7:32462762-32462784 GCCCCTGGCCTAACATGCAAGGG - Intergenic
1026986339 7:74557312-74557334 GCCCCCTGCCTGCCAGCCCAGGG + Intronic
1028087502 7:86654208-86654230 GCCACCAGCTTTACCTCCCAGGG + Intronic
1029322281 7:99774512-99774534 GAACCCAGCCTTGCATCCCAGGG - Intronic
1029562391 7:101311289-101311311 GACCCCAGTATAACAACCCAAGG - Intergenic
1038060249 8:23904378-23904400 TCCCCCAGCTTAACACCCCCAGG - Intergenic
1038258407 8:25971904-25971926 GCGCCCAGCCTTGCAGCCCAGGG - Intronic
1039194676 8:35017707-35017729 GGCCCCAGCCTCACAGGCCATGG + Intergenic
1040657702 8:49530818-49530840 GCAACCAGCCTTGCATCCCAGGG + Intergenic
1040697876 8:50023945-50023967 GCCCAGAGCCTGAAATCCCATGG - Intronic
1047506222 8:125482828-125482850 GCCCCCATCCTCCCAGCCCAAGG - Intergenic
1049162470 8:141106123-141106145 GCTCCCAGCCCAGCTTCCCAGGG + Intergenic
1049706877 8:144047212-144047234 GCCCCCAGGCTTCCCTCCCACGG + Intergenic
1053352566 9:37423111-37423133 GCCCCCTGCCAAACGTCCAAGGG - Intronic
1053424935 9:38004445-38004467 CCCCCCAGCCCACCCTCCCAGGG + Intronic
1055430466 9:76238298-76238320 GCCCACAGCCTAACAGACCATGG - Intronic
1059394993 9:114028646-114028668 GCCACCAGCCCCACATTCCAGGG - Intronic
1060454071 9:123773594-123773616 GCCCCCTACCTAGCACCCCAAGG - Intronic
1061406250 9:130394475-130394497 CCCCCCAGCCCAACATCACCTGG + Intronic
1062100947 9:134728285-134728307 GCCCCAAGCCTCAAAGCCCAGGG - Intronic
1062380025 9:136282635-136282657 ACCCCCTGCCTAACAACCCCTGG - Intronic
1062461717 9:136665205-136665227 GCCCCCAACCTAACACGCTAAGG + Intronic
1186622057 X:11251811-11251833 GCCACCAGCCACACATTCCAAGG + Intronic
1188526734 X:31095379-31095401 GCACCCAGCCTGACTTCCAATGG - Intergenic
1193644172 X:84046891-84046913 GGCACCAGCTTAACATCCAAGGG + Intergenic
1195917656 X:109951825-109951847 GCCCCCAACCTCATCTCCCATGG + Intergenic
1200050260 X:153425629-153425651 GCCCCCAGCCCAACACCTCATGG - Intergenic
1200239103 X:154484560-154484582 GCCCCCACCCTGGCACCCCAAGG + Exonic
1202374143 Y:24218106-24218128 GCCCCAAGCCCAACCTCCCTGGG - Intergenic
1202496638 Y:25452014-25452036 GCCCCAAGCCCAACCTCCCTGGG + Intergenic