ID: 1142979926

View in Genome Browser
Species Human (GRCh38)
Location 17:3665790-3665812
Sequence ACCCTGTGCGCTGGTCCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142979926_1142979931 19 Left 1142979926 17:3665790-3665812 CCACGGGGACCAGCGCACAGGGT 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1142979931 17:3665832-3665854 GAGACTGGAGTGTCCAGTGCAGG 0: 1
1: 0
2: 1
3: 27
4: 190
1142979926_1142979930 4 Left 1142979926 17:3665790-3665812 CCACGGGGACCAGCGCACAGGGT 0: 1
1: 0
2: 1
3: 10
4: 187
Right 1142979930 17:3665817-3665839 TGGATACGTGTTCGTGAGACTGG 0: 1
1: 0
2: 0
3: 0
4: 35

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142979926 Original CRISPR ACCCTGTGCGCTGGTCCCCG TGG (reversed) Intronic
900603106 1:3511585-3511607 CCCCTGTGCACATGTCCCCGCGG - Exonic
902227707 1:15007248-15007270 ACCTAGTGCTCTGGTTCCCGAGG - Intronic
903653410 1:24934500-24934522 CCCCTGAGCCTTGGTCCCCGAGG + Intronic
903661464 1:24981375-24981397 AGCCTGTGGGCTGATCCCTGAGG - Intergenic
904042938 1:27594531-27594553 ACCCTGTGCTCTGGGCACCCTGG - Intronic
904207234 1:28863245-28863267 ACCCCGTCCGATGGTCCCGGCGG + Exonic
906145547 1:43558200-43558222 TCCCTGTGAGCTGGTCTCCTTGG + Intronic
909793501 1:79703166-79703188 ATACTGAGCGCTGGTCCCCTTGG + Intergenic
912642373 1:111359830-111359852 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
916005102 1:160652976-160652998 ATGCTGAGCGCTGGTCCCCTGGG + Intergenic
916106255 1:161434794-161434816 ATGCTGAGCGCTGGTCCCCTGGG + Intergenic
919897755 1:202019775-202019797 AACCTGTGCGGTGGTCCCACAGG - Intergenic
924384824 1:243490858-243490880 GCCCTGTGGGCAGGTCCCCAGGG + Intronic
1063022327 10:2141939-2141961 CCCATGTGAGCTGGTCCCAGAGG + Intergenic
1063306181 10:4903065-4903087 ATGCTGAGCGCTGGTCCCCTCGG - Intergenic
1063995185 10:11611838-11611860 GCCCTGGGCGCGCGTCCCCGAGG - Intergenic
1064736852 10:18390497-18390519 ACCATGTTGGCTGGGCCCCGTGG - Intronic
1065453338 10:25881213-25881235 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1065500491 10:26376994-26377016 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1067745814 10:48934912-48934934 CGCCTGTGCCCTGGCCCCCGAGG + Intronic
1076061471 10:127417218-127417240 ACCCTGGGACATGGTCCCCGTGG + Intronic
1076779385 10:132715773-132715795 AGCCTGTGAGCTGTTCTCCGAGG - Intronic
1077109158 11:854492-854514 ACCACCTGCGCTGATCCCCGGGG + Intronic
1077159790 11:1107491-1107513 ACCCTGTGCAGTGGCCCCGGGGG + Intergenic
1078572770 11:12473800-12473822 TCCCTTTGAGCTGGACCCCGAGG + Exonic
1078848025 11:15139337-15139359 ACCCTGGGCCCTGGGCCCAGTGG + Intronic
1080385390 11:31807849-31807871 ACCCAGTGCAGGGGTCCCCGAGG + Intronic
1080896639 11:36453744-36453766 TCCCTGTGCCCTGGGACCCGTGG - Intronic
1083094126 11:60232676-60232698 ACACTGTGCCCTGGCCCCCATGG + Intronic
1083392980 11:62368597-62368619 ACGCTGAGCGCCGGTCCCCTGGG - Intronic
1084229319 11:67739447-67739469 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1085621485 11:78041135-78041157 ACCCAGTGTGCTGGCCCCTGGGG - Intronic
1092391521 12:8084204-8084226 GACCTGTGCGCTGGGCCCTGTGG + Intronic
1092528088 12:9322651-9322673 AACCTCTGCGCTGGTTCCCCGGG - Intergenic
1092539182 12:9409107-9409129 AACCTCTGCGCTGGTTCCCGGGG + Intergenic
1092586236 12:9904201-9904223 ACCCTGTGGGTCAGTCCCCGAGG - Intronic
1094500275 12:31015389-31015411 AACCTCTGCGCTGGTTCCCCAGG - Intergenic
1094834093 12:34314156-34314178 ATCCCCTGCGCGGGTCCCCGAGG - Intergenic
1095942667 12:47737041-47737063 GGCCTGTGCGGTGGTCCCTGAGG - Exonic
1101247993 12:102903071-102903093 ACCCTGTGGGCTGGGCACGGTGG + Intronic
1103011883 12:117464258-117464280 ACCCTGTGGACTGGTCCCCTCGG + Exonic
1104866977 12:131961510-131961532 ACCCGGCGTGCTGCTCCCCGGGG + Exonic
1106197301 13:27504773-27504795 ACTGTGTGCCCTGGTCCCCCGGG - Intergenic
1113666945 13:112147887-112147909 CCCCTGTGTGATGGTCCCTGTGG + Intergenic
1113667234 13:112149310-112149332 ACCCTGTGTGATGGTACCTGTGG + Intergenic
1114075018 14:19157263-19157285 AGCCCCTGCGCTGGGCCCCGTGG + Intergenic
1114075487 14:19159177-19159199 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
1114086781 14:19240802-19240824 AGCCCCTGCGCTGGGCCCCGGGG - Intergenic
1114087250 14:19242713-19242735 AGCCCCTGCGCTGGGCCCCGTGG - Intergenic
1114802464 14:25792875-25792897 ATACTGAGCGCTGGTCCCCTGGG - Intergenic
1121074968 14:91060381-91060403 GCCGTCCGCGCTGGTCCCCGCGG + Exonic
1121728164 14:96167896-96167918 ACCCTTTGGGCTGAACCCCGGGG + Intergenic
1122097156 14:99380650-99380672 TTCCTGTGCTCTGGTCCCCTGGG + Intergenic
1122190474 14:100038750-100038772 ACCCTGTGTGCTGTGCCCTGGGG + Intronic
1202898257 14_GL000194v1_random:22200-22222 AACCCTTGCGCTGGGCCCCGGGG - Intergenic
1126663136 15:51051919-51051941 AGCTTGTGGGCTGGTCCCCGAGG - Intergenic
1129590720 15:76912486-76912508 ACCCTTTGCGCTGGGCGCAGTGG - Intergenic
1131111337 15:89766948-89766970 ACCCTGTGCCCTGCACCCTGCGG - Intronic
1131485886 15:92820360-92820382 AACCTGTGCGCTGGTCGGCCTGG - Intergenic
1132605793 16:793206-793228 GCCCTCTGCGCTGGTCCTTGAGG - Exonic
1136355274 16:29741095-29741117 ATGCTGAGCGCTGGTCCCCTAGG + Intergenic
1138448327 16:57078316-57078338 GCCCTGTGAGCGGGTCCCTGAGG + Intronic
1139378914 16:66517979-66518001 ACACTGTGCCCTGGTACCCTTGG - Intronic
1141184794 16:81779477-81779499 GCCCTGGGAGCCGGTCCCCGCGG - Intronic
1142004459 16:87682840-87682862 ACCTGGTGTGCTGGCCCCCGGGG - Intronic
1142979926 17:3665790-3665812 ACCCTGTGCGCTGGTCCCCGTGG - Intronic
1145750018 17:27349110-27349132 ACCCTGTGCCCGCGTCCCCGAGG + Intergenic
1147608060 17:41785479-41785501 ATCCTGTTCGCTGGGCCCCAGGG - Intronic
1150431770 17:65123888-65123910 ACCCTGTCCTCTGGTCCCTAAGG + Intergenic
1151462537 17:74263071-74263093 ACTCTGTTGGCTGCTCCCCGTGG - Intergenic
1151534349 17:74730273-74730295 GCCCTGTGCTCTGGTCTCAGAGG - Intronic
1152783923 17:82238346-82238368 GCCCTGTGCCCTGGCCACCGCGG - Intronic
1158695281 18:59697699-59697721 ACCCTGCGCGCTTCTCCCAGAGG - Intergenic
1159412954 18:68105351-68105373 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1160668046 19:342478-342500 GCCCTGTGAGGTGGTCCCCACGG - Intronic
1161084713 19:2329391-2329413 GCCCTGGGCGCTGGTCACCCTGG - Intronic
1161153607 19:2721466-2721488 CCCGTGGGCGCGGGTCCCCGGGG - Intronic
1161319373 19:3633904-3633926 AGCCTGTGCGCTGGTGCCCGTGG - Intronic
1162278508 19:9676904-9676926 ACGCTGAGCGCCGGTCCCCTGGG - Intergenic
1162932240 19:13962952-13962974 ACCCAGGGCGCGGGTCCCGGGGG - Intronic
1164146828 19:22517714-22517736 ACCCCGTGCGCGGGGCCCGGAGG + Intronic
1164229799 19:23277138-23277160 ATGCTGAGCGCTGGTCCCCCGGG - Intergenic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1165260735 19:34615191-34615213 ACCCTGTGTCCTGCTCCCTGTGG - Intronic
1165621560 19:37252504-37252526 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1165652275 19:37501848-37501870 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1167916187 19:52741897-52741919 ATGCTGAGCGCTGGTCCCCTGGG + Intergenic
1168477338 19:56686121-56686143 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1168545591 19:57247287-57247309 ATCCTGGCCGCTGGTCCCTGAGG + Intronic
925917820 2:8619310-8619332 ACCCTGCTCCCTGGGCCCCGGGG - Intergenic
927935772 2:27075524-27075546 TCCCTGTGTGCTGATCCCCAGGG + Intergenic
928199840 2:29240804-29240826 ACCCTGGCAGCTGGTCCCTGGGG - Intronic
928669542 2:33587238-33587260 ACCCAGTGGGCTGGTCCCATTGG + Exonic
929597696 2:43186696-43186718 AGCCTGTTGGCTGATCCCCGGGG - Intergenic
929780623 2:44954751-44954773 ACCCAGTGCGCTGCTCTCCTCGG - Intergenic
936107425 2:109636949-109636971 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
936157333 2:110056906-110056928 ATGCTGTGCGCCGGTCCCCTGGG + Intergenic
936187361 2:110314538-110314560 ATGCTGTGCGCCGGTCCCCTGGG - Intergenic
937043304 2:118837192-118837214 CCCCTCTGCGCTGGTCCTGGAGG + Intergenic
938489339 2:131753806-131753828 AGCCCCTGCGCTGGGCCCCGTGG + Intronic
938489881 2:131755867-131755889 AGCCCTTGCGCTGGGCCCCGGGG + Intronic
938490027 2:131756476-131756498 AACCCTTGCGCTGGGCCCCGGGG + Intronic
943692281 2:190881181-190881203 ACCCTGTGCCGGCGTCCCCGAGG + Exonic
1168986059 20:2050051-2050073 ACCCTGTGGGCTGGGCACAGCGG - Intergenic
1171900277 20:30850020-30850042 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1172336732 20:34122759-34122781 ACCTGGTGCGCTGGCCCGCGCGG - Intergenic
1173265827 20:41479481-41479503 CCACTGTGCCCTGGTCCCCGTGG - Intronic
1175897981 20:62347860-62347882 GCCCTGTGAGGTGGGCCCCGTGG - Intronic
1176156838 20:63626495-63626517 TCCCTGTGGGGTGGTCCCTGTGG + Intronic
1176617943 21:9038191-9038213 AACCCTTGCGCTGGGCCCCGGGG - Intergenic
1176706033 21:10120488-10120510 AGCCCTTGCGCTGGTCCCCAGGG + Intergenic
1176706481 21:10122631-10122653 AGCCCTTGCGCTGGGCCCCGGGG + Intergenic
1178707879 21:34889703-34889725 TCCCCCTGCGCCGGTCCCCGCGG + Intronic
1180290668 22:10850178-10850200 AGCCCCTGCGCTGGGCCCCGTGG + Intergenic
1180291080 22:10851932-10851954 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
1180333642 22:11556011-11556033 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1180339842 22:11609363-11609385 ATGCTGAGCGCTGGTCCCCTGGG + Intergenic
1180493469 22:15879599-15879621 AGCCCCTGCGCTGGGCCCCGTGG + Intergenic
1180493885 22:15881354-15881376 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
1181535232 22:23538599-23538621 ACGCTGAGCGCTGGTCCCCTGGG + Intergenic
1182296240 22:29312331-29312353 ACCCCGTGCCCAGGTCCTCGAGG - Exonic
1184035845 22:41917732-41917754 CCCCTTTGCCCTGGACCCCGGGG + Intergenic
1184608467 22:45587580-45587602 TCCCTGAGCGCTGGGCCCCCAGG - Intronic
1184820384 22:46905539-46905561 ACCCCGTGCCCTCCTCCCCGGGG - Intronic
949878807 3:8645529-8645551 AACTTGTGAGCTGGTCCCCGAGG + Intronic
952888169 3:38024509-38024531 ACCCTCTGCTCTGGTCCGGGGGG + Exonic
954539238 3:51382727-51382749 ACCCTGAGTGGTGGTCCCCATGG - Exonic
954604845 3:51901315-51901337 ACCCTGTGGGTCGGCCCCCGAGG + Intronic
961008297 3:123419630-123419652 ACCCTGTGCTTGGGTCACCGGGG + Intronic
961827776 3:129607562-129607584 ACCCTGAGCACTGGTCCCTCTGG - Intergenic
962808821 3:138945456-138945478 ACCCTGGGCGCTGGCTCCAGAGG + Exonic
966771837 3:183511032-183511054 ATGCTGAGCGCTGGTCCCCTGGG - Intronic
969341889 4:6547436-6547458 ACCCTGTGCTCCAGTACCCGTGG + Intronic
969442479 4:7225698-7225720 ACCCTGTGAGCTGGCCCACCAGG + Intronic
969786971 4:9466088-9466110 ATCCTGAGCGCTGGTCCCCTGGG + Intergenic
970008109 4:11429173-11429195 ACCCGGTGCGGTGGCCCCTGGGG + Exonic
970440508 4:16077499-16077521 ACGCTGAACGCTGGTCCCCTGGG + Intronic
973374203 4:49276495-49276517 AGCCCCTGCGCTGGGCCCCGGGG + Intergenic
973383209 4:49333744-49333766 AGCCCCTGCGCTGGGCCCCGGGG - Intergenic
977937703 4:102826457-102826479 ACCCCATGCCCTTGTCCCCGCGG + Intronic
985646152 5:1085616-1085638 TGCCTGTGCGCTGACCCCCGCGG - Intronic
985646162 5:1085650-1085672 CGCCTGTGCGCTGACCCCCGCGG - Intronic
985646172 5:1085684-1085706 CGCCTGTGCGCTGACCCCCGCGG - Intronic
985646182 5:1085718-1085740 GGCCTGTGCGCTGACCCCCGCGG - Intronic
986571031 5:9166391-9166413 ACCCTGTGAGCTGGGCACTGGGG - Intronic
996738482 5:126777919-126777941 ACCCGGTGAGCTGGTCGCCGCGG - Intronic
999294060 5:150446962-150446984 ACCCTGTGCTTTTGTCCCCAGGG - Exonic
1001573821 5:172748722-172748744 AGCCTGTGCGCTGGGAGCCGAGG - Intergenic
1002103732 5:176869769-176869791 ACCCTGTGCCCAGGTACCAGCGG + Intronic
1002696841 5:181097926-181097948 GCCCTGTGCGCTGCTGCCTGTGG - Intergenic
1002697781 5:181101447-181101469 GCCCTGTGCGCTGCTGCCTGTGG + Intergenic
1003628781 6:7767974-7767996 ACCCTGTGCCCTGGGCTCAGTGG + Intronic
1007287509 6:40758245-40758267 ACCCTGCTCTCTGGTCCCAGAGG - Intergenic
1007571404 6:42893781-42893803 ACGCTGAGCGCTGGTCTCCTGGG - Intergenic
1008563843 6:52748389-52748411 ATCCTGAGTGCTGGTCCCCTGGG - Intergenic
1012931257 6:105319569-105319591 ACCCTGTGCGATGGTTGCCTGGG - Intronic
1015285289 6:131479514-131479536 ATGCTGAGCGCTGGTCCCCTGGG + Intergenic
1018069842 6:160154618-160154640 ACCCTCTGGGCTGGTCCTCATGG + Intronic
1019685403 7:2379288-2379310 CCCCTGGGCCCTGGTGCCCGCGG + Intronic
1024313325 7:47990507-47990529 ATGCTGAGCGCTGGTCCCCTGGG + Intronic
1033482024 7:141751971-141751993 ATGCTGAGCGCTGGTCCCCTGGG + Intronic
1033597451 7:142867586-142867608 ACCCTGTCGGCTGGTCCCCCAGG + Exonic
1034269704 7:149797638-149797660 GCCCTGTGCCCGGGTCCCCAGGG + Intergenic
1037801284 8:22037219-22037241 ACCCTGGGGGCTGGCCCCCTAGG - Intergenic
1038442851 8:27583944-27583966 ACCCTGTGCCCTGGGGCCTGTGG + Intergenic
1042027649 8:64440958-64440980 AACCTGTGAGCTGGTCCTAGTGG - Intergenic
1042722515 8:71841693-71841715 ACCCTGCGCGCTCCTCCGCGCGG + Exonic
1049100879 8:140578110-140578132 ACCCTCGGCACTGGGCCCCGAGG - Intronic
1049207699 8:141371105-141371127 ACCCTCTGGGCTGGCCCCCTCGG + Intergenic
1049365539 8:142235145-142235167 GCCCTGGGTGCTGGTGCCCGTGG + Intronic
1050896863 9:10893727-10893749 ACCCTGTGCCCTGATCCAGGAGG - Intergenic
1050972448 9:11894630-11894652 ATGCTGAGCGCTGGTCCCCTGGG - Intergenic
1053643306 9:40107605-40107627 AGCCCTTGCGCTGGTCCCCAGGG + Intergenic
1053761598 9:41352636-41352658 AACCCTTGCGCTGGGCCCCGGGG - Intergenic
1053762381 9:41355742-41355764 AGCCCTTGCGCTGGGCCCCGGGG - Intergenic
1053762846 9:41357885-41357907 AGCCCTTGCGCTGGTCCCCAGGG - Intergenic
1054324627 9:63706979-63707001 AGCCCTTGCGCTGGGCCCCGGGG + Intergenic
1054325411 9:63710097-63710119 AACCCTTGCGCTGGGCCCCGGGG + Intergenic
1054350728 9:64015577-64015599 AGCCCCTGCGCTGGGCCCCGGGG - Intergenic
1054540193 9:66263752-66263774 AACCCTTGCGCTGGGCCCCGGGG - Intergenic
1054540977 9:66266859-66266881 AGCCCTTGCGCTGGGCCCCGGGG - Intergenic
1054541449 9:66268998-66269020 AGCCCTTGCGCTGGTCCCCAGGG - Intergenic
1057228055 9:93302811-93302833 CCCCTGTGAGCTGGGCCCCTTGG + Intronic
1057486304 9:95487197-95487219 ACCCTCTGTGCAGGTCCACGCGG + Intronic
1061715043 9:132513739-132513761 CCCCTGTGCGAGGGTCCTCGGGG + Intronic
1062098460 9:134715041-134715063 ATGCTGAGCGCTGGTCCCCTGGG - Intronic
1202791066 9_KI270719v1_random:90576-90598 AGCCCTTGCGCTGGTCCCCAGGG + Intergenic
1202791519 9_KI270719v1_random:92720-92742 AGCCCTTGCGCTGGGCCCCGGGG + Intergenic
1185575868 X:1171807-1171829 ATGCTGAGCGCTGGTCCCCTGGG + Intergenic
1191018426 X:55835321-55835343 ACGCTGAACGCTGGTCCCCTGGG - Intergenic
1198268263 X:135031181-135031203 ATGCTGAGCGCTGGTCCCCTGGG + Intergenic
1200068258 X:153515266-153515288 AGCATGTTCCCTGGTCCCCGAGG + Intergenic
1200149533 X:153944475-153944497 TCCCTGAGGGCTGGTTCCCGAGG - Intronic
1200251663 X:154557336-154557358 ATCCTGTGGCCTTGTCCCCGCGG + Intronic
1200253870 X:154569020-154569042 ATCCTGTGGCCTTGTCCCCGCGG + Intergenic
1200263899 X:154635388-154635410 ATCCTGTGGCCTTGTCCCCGCGG - Intergenic
1200266104 X:154647080-154647102 ATCCTGTGGCCTTGTCCCCGCGG - Intergenic
1201151323 Y:11097029-11097051 AACCCTTGCGCTGGGCCCCGGGG - Intergenic
1201951353 Y:19567596-19567618 ACCTGGTGCGTGGGTCCCCGCGG - Intergenic