ID: 1142980068

View in Genome Browser
Species Human (GRCh38)
Location 17:3666543-3666565
Sequence GCAGGTGTCCAGAAGGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 437}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142980066_1142980068 -9 Left 1142980066 17:3666529-3666551 CCAGGAGCTGCGGGGCAGGTGTC 0: 1
1: 0
2: 3
3: 21
4: 268
Right 1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG 0: 1
1: 0
2: 3
3: 47
4: 437
1142980057_1142980068 25 Left 1142980057 17:3666495-3666517 CCCAGGAGGAGGAGGAGCAGGTT 0: 1
1: 1
2: 14
3: 153
4: 800
Right 1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG 0: 1
1: 0
2: 3
3: 47
4: 437
1142980058_1142980068 24 Left 1142980058 17:3666496-3666518 CCAGGAGGAGGAGGAGCAGGTTA 0: 1
1: 0
2: 8
3: 72
4: 569
Right 1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG 0: 1
1: 0
2: 3
3: 47
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142980068 Original CRISPR GCAGGTGTCCAGAAGGCAGA TGG Intronic
900208659 1:1442392-1442414 GCAGGTGTTCAGAAGGCTGGGGG + Exonic
900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG + Intronic
901059408 1:6465235-6465257 GCAGGGGTCAGGCAGGCAGAGGG + Intronic
901172168 1:7266989-7267011 GCAGGGGTCTGGAAGGCAGTGGG + Intronic
902036698 1:13463161-13463183 CCGGGTGTCCTGAAGGCAGAGGG + Intergenic
902570159 1:17342093-17342115 GGACGTGTCCAGCAGGGAGATGG - Exonic
902612058 1:17603227-17603249 GCAGCTGTCCATTAGCCAGATGG + Intronic
902643088 1:17779205-17779227 AGAGGGGTCCAGGAGGCAGAGGG - Intronic
902741899 1:18444672-18444694 ACAGGAGTCCAGAGGTCAGATGG + Intergenic
902886011 1:19405298-19405320 GCAGGTGCTCGGAAGCCAGAGGG + Intronic
903258929 1:22120839-22120861 GTAGGCATCCAGAAGGCAGGTGG + Intronic
904961141 1:34333946-34333968 GCTGAGGTCCAGAAGGCAGTGGG - Intergenic
905143118 1:35864985-35865007 GAAGTTGTCATGAAGGCAGAAGG + Intergenic
905402468 1:37713709-37713731 GCAGATCTGCAGAAGCCAGATGG - Intergenic
905778005 1:40682610-40682632 GCAGATGTACAAAAGGTAGATGG + Intergenic
906127828 1:43438327-43438349 CCAGGTGTCCAGTAGGCAACTGG + Intronic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906305559 1:44716442-44716464 GGAGGTGTTCAGAAGGCAAATGG - Intronic
906458405 1:46018350-46018372 GGAGGAGTCCAGCAGGCAGCTGG - Intronic
907817555 1:57935193-57935215 GCATCTGTTCAGAAAGCAGAGGG + Intronic
907914879 1:58859688-58859710 GAAGATGTCCAGGAGGCAGATGG - Intergenic
908429855 1:64045895-64045917 GCAAATGTCAAGATGGCAGATGG - Intronic
908774869 1:67630033-67630055 GAAGGTGTGCAGAAGCCACAGGG - Intergenic
909412768 1:75374091-75374113 GCAAGTGACCTGAATGCAGAAGG + Intronic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
910984320 1:92990882-92990904 GCAGGTTTCTAGAACTCAGAAGG + Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
914716525 1:150258916-150258938 GTGGGTGTCCAGAGAGCAGAAGG + Intronic
914993654 1:152520011-152520033 GCATTTGTCCAGAAGGAAGAGGG + Intronic
915075422 1:153304576-153304598 GAAAGTGACCAGAAGGCAGCAGG - Intronic
915225658 1:154409351-154409373 GGAGGAGAGCAGAAGGCAGAGGG - Intronic
915988839 1:160492739-160492761 GCAGTTGTCAACAAGTCAGATGG - Intronic
916417637 1:164607554-164607576 GGAGCTGTCCAGGAGGCAGTTGG + Intronic
916662090 1:166931927-166931949 GGAGATGTCCAGAAGACAGTTGG + Intronic
917538481 1:175891641-175891663 ACAGCTTTCCAGAAGGCAGGAGG + Intergenic
918118125 1:181514534-181514556 GCAGGTGTCAGGAAGACAAAGGG - Intronic
918655976 1:187027185-187027207 GCAGGTGTCCACAATGGTGATGG - Intergenic
918988744 1:191668823-191668845 GCAGGAGTCAGGAAGGCTGACGG + Intergenic
919850570 1:201669360-201669382 GCAGGAGTCAACCAGGCAGAGGG + Intronic
920388753 1:205585933-205585955 GCAGGTGTGGGGAGGGCAGAGGG - Intronic
920683212 1:208089130-208089152 ACATCTTTCCAGAAGGCAGATGG - Intronic
921161064 1:212472440-212472462 GCTAATGTCCAGTAGGCAGAAGG - Intergenic
922298884 1:224278119-224278141 GGAGATGTCCAGCAGGCAGTAGG - Intronic
1062807853 10:437500-437522 GCAGGTGTTCTCCAGGCAGAGGG + Intronic
1063219732 10:3956029-3956051 GCAGGTGGCCAGTTGGCAGATGG + Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1063987872 10:11526287-11526309 GGAGGTGTCCACAAGACAGTTGG - Intronic
1063987935 10:11527097-11527119 GCAGGTGTACAGAGTGCTGAGGG + Intronic
1067451527 10:46384867-46384889 GCCGGAGTCCAGATGGCAGGGGG - Intronic
1067585712 10:47474889-47474911 GCCGGAGTCCAGATGGCAGGGGG + Intronic
1068446025 10:57125015-57125037 GCTGGTGTCAAGAAGTCAGTTGG - Intergenic
1069650629 10:70044779-70044801 GCAAGTTTCCAGAGGGAAGAAGG + Intergenic
1069706163 10:70460128-70460150 GCAGGGGCCCAGACGGCGGAAGG - Intergenic
1070505169 10:77106698-77106720 ACAGGTCTCCATAAAGCAGAAGG - Intronic
1070603200 10:77879885-77879907 GGAGGTGTCAGGCAGGCAGATGG + Intronic
1070760195 10:79019455-79019477 GCAGGTGTCCAAGAGGGAAAGGG - Intergenic
1070803307 10:79256007-79256029 GCGGGTGTCCTGGTGGCAGAGGG + Intronic
1070892197 10:79949228-79949250 GCAGGTTTCCAGAACGCAGGTGG - Intronic
1071987788 10:91070183-91070205 GTAGGTGTAGAGAAGGAAGATGG - Intergenic
1072052876 10:91723955-91723977 GGAGATGTCAAGAAGGCAGCTGG - Intergenic
1072332368 10:94366170-94366192 AGAGCTGTCCAGGAGGCAGATGG - Intergenic
1072966920 10:99981782-99981804 GCAGGAGGTCTGAAGGCAGAGGG + Intronic
1073213739 10:101825146-101825168 GCAGGTCACCATGAGGCAGATGG - Intergenic
1073472227 10:103729933-103729955 GCAGGTGTAAACAAGGGAGAGGG + Intronic
1073480760 10:103784816-103784838 GGAGGGGTCCAGATGGCAGCTGG + Intronic
1073836429 10:107449085-107449107 GCAGGGGTCTAAAAGTCAGATGG - Intergenic
1074121048 10:110494829-110494851 GAAGGTGCCCAGAAAGCAGAAGG - Intergenic
1076013088 10:127006255-127006277 GCAGGAGAGCAGAAGGCAGGAGG - Intronic
1076200806 10:128556327-128556349 GCAGGTGTGTATAAAGCAGAGGG - Intergenic
1076325733 10:129620489-129620511 GCAAATGTACAGAAGGCACAAGG - Intronic
1076511004 10:131013422-131013444 GCAGGTGTCACCCAGGCAGAGGG - Intergenic
1076594485 10:131617444-131617466 GAAGGTGGGCAGAGGGCAGAAGG + Intergenic
1076607792 10:131700706-131700728 GCAGGGATCCAGAAGGCACCAGG - Intergenic
1077235166 11:1478489-1478511 CCAGGAGGCCAGAAGGAAGAAGG - Intronic
1078139205 11:8679751-8679773 GCATGTGACCAGCAGGAAGAGGG - Intergenic
1078339299 11:10487510-10487532 GCATATGTGCAGAAGGAAGATGG + Intronic
1078962648 11:16296424-16296446 GCAGCTGAGCAGAAGGAAGATGG + Intronic
1079203748 11:18396138-18396160 GCATCGGGCCAGAAGGCAGAAGG - Intronic
1079716325 11:23750775-23750797 GCATGAGGCCAGGAGGCAGAAGG + Intergenic
1083210710 11:61183678-61183700 GCAGGTGAAAAGAAGGCCGAAGG - Intergenic
1083647508 11:64181049-64181071 GAAGATGTCCAGATGGCAGCTGG + Intergenic
1084082869 11:66840415-66840437 GCAGGTCCCAAGAAAGCAGAAGG - Intronic
1084121311 11:67070632-67070654 CCAGGTGTCCAGAACGCTCAGGG + Intronic
1084457616 11:69277614-69277636 GCAGGTGGGCAGTAGGCAGTGGG + Intergenic
1084675234 11:70630224-70630246 GCAGGTGCCCTGAGGCCAGACGG + Intronic
1085205080 11:74726849-74726871 GCAGGTGTGCATGAGGCAGTGGG - Intronic
1086595458 11:88565646-88565668 ACAGGAGTCAGGAAGGCAGATGG + Intronic
1087947262 11:104177789-104177811 GGAGATGTCAAGAAGGCAGTTGG + Intergenic
1088796025 11:113267562-113267584 GGATGTGTTCAGCAGGCAGAAGG + Intronic
1089260968 11:117223779-117223801 GGAGGCTTCCAGCAGGCAGAAGG + Intronic
1089572602 11:119420360-119420382 GCAGGTCTCCCGAGGGCAGAAGG - Exonic
1089626499 11:119754507-119754529 TCAGGGATCCAGAAGCCAGAAGG + Intergenic
1089644582 11:119870306-119870328 GGAGGTGACCAGCAGGCAGCTGG - Intergenic
1089761344 11:120726396-120726418 GCAGAAGTCCAGAAGTGAGATGG + Intronic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1090806901 11:130208601-130208623 GGAGGCGTCCGGCAGGCAGATGG - Exonic
1091239523 11:134043184-134043206 ACAGATGCTCAGAAGGCAGAAGG - Intergenic
1092822543 12:12366036-12366058 GCAGCAGCCCAGCAGGCAGAGGG - Intronic
1093182974 12:15988192-15988214 GCAGGTAACGAGAAGGAAGAAGG - Intronic
1095223413 12:39647565-39647587 GCAGGAGTAGGGAAGGCAGAGGG + Intronic
1095799860 12:46260564-46260586 GGAGCAGTCCAGAAGGCAGCAGG - Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1096866482 12:54566704-54566726 GCGGGTTTCGAGAAGTCAGATGG + Intronic
1100261676 12:92938035-92938057 TCAGATGTCCAAAAGGGAGATGG - Intergenic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102898939 12:116621147-116621169 GCAGGTGACAAGGAGGCAGCGGG - Intergenic
1103211457 12:119170000-119170022 ACAGGTGCCCAGAAAGCAGGAGG + Intergenic
1103331939 12:120160198-120160220 GCAGCTGACCAGCAAGCAGAAGG - Exonic
1103987649 12:124778432-124778454 GCAGGTGTGCAACAGGCACATGG + Exonic
1104630803 12:130400471-130400493 GCAGATGACCAGCAGGCAGATGG - Intronic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105054755 12:133088045-133088067 GCTGGAGCCCAGGAGGCAGAGGG + Intronic
1105284285 13:18992175-18992197 GCAGAAGGCTAGAAGGCAGAAGG + Intergenic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284609 13:18994024-18994046 GCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284615 13:18994060-18994082 GCAGAAGGCCAGAAGCCAGAAGG + Intergenic
1105284689 13:18994482-18994504 CCAGAAGGCCAGAAGGCAGAAGG + Intergenic
1105284837 13:18995375-18995397 GCAGAAGGCCAAAAGGCAGAAGG + Intergenic
1105284900 13:18995748-18995770 CCAGATATTCAGAAGGCAGAAGG + Intergenic
1105285075 13:18996759-18996781 GCCAGAGGCCAGAAGGCAGAAGG + Intergenic
1105545716 13:21349217-21349239 GCAGATGTGCAGAGGGCAGTAGG - Intergenic
1105968329 13:25404758-25404780 GCAGGTGTCCAGCAGGCAGCTGG + Intronic
1106758766 13:32847698-32847720 GCATGTGTGAAGAAGGGAGAGGG + Intergenic
1107779031 13:43879269-43879291 GCAGGTCTCCAGAGGGCACGGGG - Exonic
1109044768 13:57395349-57395371 GAAGATGTCAAGAAGGCAGTTGG - Intergenic
1109211845 13:59544404-59544426 GCCGGTGTCCATATGGGAGAAGG + Intergenic
1111890288 13:94073115-94073137 GCAGATGTCAAGGAGGGAGAGGG - Intronic
1113543332 13:111125832-111125854 GCATGTGTTCAGAAAGCAAAAGG - Intronic
1114075653 14:19159848-19159870 CCAGGTGTGCATCAGGCAGAAGG - Intergenic
1114086508 14:19239724-19239746 CCAGGTGTGCATCAGGCAGAAGG + Intergenic
1115475035 14:33805342-33805364 GCAGGGTCCCACAAGGCAGAGGG + Intergenic
1115797383 14:36953928-36953950 GAAGATGTCCAGTAGGCAGTTGG - Intronic
1116677841 14:47927849-47927871 GAAAGTGTCCAGAGGGAAGAAGG + Intergenic
1118866857 14:69711162-69711184 CCAGCTGTCCAACAGGCAGATGG - Exonic
1119640290 14:76309774-76309796 GTGGGTCTCCAGATGGCAGATGG + Intergenic
1119730597 14:76948588-76948610 GCAGGTGACTGGAGGGCAGAAGG + Intergenic
1120000432 14:79296954-79296976 GCTGGAATCAAGAAGGCAGAAGG - Intronic
1120000610 14:79298955-79298977 GCTGGAATCAAGAAGGCAGAAGG + Intronic
1121016875 14:90554262-90554284 GCAGGTGTCCAGAGGGTGGTCGG + Intronic
1121310549 14:92933104-92933126 GACGTTGTCCAGAAGGCAGTAGG + Intronic
1121333071 14:93060044-93060066 GCAGGAGACCAGAGGGCAGGAGG + Intronic
1121512553 14:94523172-94523194 GGAGGTGTCCAGGTGGCAGTTGG - Intergenic
1122154505 14:99742189-99742211 GCAGGCACCCAGAAGGCACAGGG - Intronic
1122309434 14:100785244-100785266 GCAGGGGAGCAGAAGGCAGGGGG - Intergenic
1122974320 14:105164800-105164822 GCAGGTCTCACGAAGTCAGATGG - Intronic
1124372068 15:29109684-29109706 GCTGGTGCCCAGAACGAAGAGGG + Intronic
1125477873 15:40059823-40059845 CGAGGTGTCCACTAGGCAGACGG + Intergenic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1128129040 15:65213376-65213398 GCTGGTGGCCAGGAGGGAGACGG - Intergenic
1128249511 15:66154664-66154686 GCAGGTCTCCAACAGACAGACGG - Intronic
1128282806 15:66410559-66410581 GCAGGTATCCAGACTGCTGAAGG + Intronic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128649436 15:69399899-69399921 GCAGGTGCTGAGAAGGAAGAGGG + Intronic
1128656751 15:69468285-69468307 GCAGGTCTCCAGCATGCAGCAGG - Intergenic
1129320078 15:74769819-74769841 GCAGGTGTGCCAAAGGCACAGGG + Intergenic
1129337840 15:74864382-74864404 GCATGTGTTCAGAAGAGAGAAGG + Intronic
1129426742 15:75468958-75468980 GCAGATGTCCAGTGAGCAGAAGG + Exonic
1131354992 15:91737411-91737433 GCAGAACTCCAGCAGGCAGAGGG + Intergenic
1131400344 15:92120440-92120462 GCAGGGAGACAGAAGGCAGATGG - Intronic
1131576654 15:93599015-93599037 GAAGGGGTGCAGGAGGCAGACGG - Intergenic
1132026967 15:98412001-98412023 GCAGGAGTTCAGAGGGCAGTGGG + Intergenic
1133225895 16:4340218-4340240 GCATGTGTCCAGATTCCAGAAGG - Intronic
1134220920 16:12353288-12353310 GTAGGTGTCCAGGGGCCAGATGG - Intronic
1135118072 16:19740475-19740497 GCAGCAGAACAGAAGGCAGAGGG - Intronic
1135122622 16:19779551-19779573 GCTGCTATCCAGATGGCAGATGG - Intronic
1135504886 16:23027695-23027717 GCAGAAGTCCAGGAGGGAGATGG - Intergenic
1135630721 16:24034115-24034137 GCTGGTGTCCTGCAGGCAGAAGG - Intronic
1135690003 16:24528754-24528776 GCTGGAGCCCAGAAGGCTGAAGG - Intergenic
1136095650 16:27954086-27954108 GGAAGTGTCCAGGAGGCAGTTGG + Intronic
1136230439 16:28882673-28882695 CCAGGTGTCCAGGAGGATGACGG + Intronic
1137288008 16:47032129-47032151 GGAGATGTCAAGATGGCAGATGG + Intergenic
1137534029 16:49303937-49303959 GGAGGTATCCAGCAGGCAGCTGG - Intergenic
1138535748 16:57659463-57659485 GCTCGTGTCCAGCAGGAAGACGG - Exonic
1138592517 16:58009847-58009869 GAAGAAGCCCAGAAGGCAGAGGG - Intronic
1138715785 16:59020665-59020687 GCAGTTGTCCAGTAGTCGGAAGG + Intergenic
1139483173 16:67241910-67241932 GCAGGTGTCCTGGAAGGAGAGGG - Intronic
1139527222 16:67524522-67524544 GGAAGTGTCCAGAAGGCAGCTGG - Intronic
1139947559 16:70651587-70651609 GCAGGTTTGGAGAAGGCAGTGGG + Intronic
1140089734 16:71827794-71827816 GAAGATGTCAAGAAGGCAGGAGG + Intergenic
1140350634 16:74258831-74258853 GCAGGTGTTCAGAAGCCAAACGG - Intergenic
1141066175 16:80915864-80915886 GCAGGTGACCACAGGGTAGAAGG + Intergenic
1141440346 16:84025918-84025940 GCGGGGGTGCAGGAGGCAGAGGG - Intronic
1141609373 16:85172437-85172459 TCAGCTGTGCAGGAGGCAGACGG + Intronic
1141614365 16:85202240-85202262 GCCGGATTCCAGAAGGCAGTTGG - Intergenic
1141948043 16:87323678-87323700 GCAGGTCTGCAGAGGACAGACGG - Intronic
1142138694 16:88463042-88463064 GCAGGTGCCCAGAAGGAAGTGGG - Intronic
1142282675 16:89156744-89156766 GCAGGTGGAGGGAAGGCAGAGGG - Intergenic
1142562546 17:819394-819416 GCAGGTTTCCAGGAGCCACACGG + Intronic
1142879617 17:2874255-2874277 GCAAATGTCCAGTTGGCAGAGGG - Intronic
1142903187 17:3026178-3026200 TCAGCTGGCCAGGAGGCAGAGGG - Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143008387 17:3851973-3851995 GAAGATGTCCAGGAGGCAGCTGG - Intergenic
1143171112 17:4931055-4931077 AGAGATGTCCAGAAGGCAGCTGG + Intergenic
1143181519 17:4987042-4987064 CCAGGTGTCCAGGATGGAGATGG + Exonic
1143413543 17:6728050-6728072 CCTGCTGTCCAGAAGGCAGCAGG - Intergenic
1144157388 17:12519392-12519414 GCAGGTTTAAAGAAGACAGATGG - Intergenic
1144753745 17:17667481-17667503 CCAGGTTCCCAGAAGCCAGAGGG + Intergenic
1145110091 17:20154991-20155013 GAAGGTGTCAAGAAGGTAGTTGG + Intronic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1146647552 17:34585101-34585123 GCATGTGGCCAGAAGAAAGATGG - Intronic
1147150082 17:38509462-38509484 GCAGGTTTCCAGGTGGCAGCGGG + Intronic
1147441912 17:40452698-40452720 GCAGCTGCCCAGATGGCAGGAGG - Intronic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1148764507 17:50029265-50029287 GGAGGTGACCAGAGGGCAGAGGG - Intergenic
1148917702 17:50996611-50996633 GCACATGTTCAGAAGGAAGACGG - Exonic
1149219361 17:54398346-54398368 GCATGTCTTCACAAGGCAGAAGG - Intergenic
1149597387 17:57872396-57872418 GCAGGTGTGCAAAGGGAAGAAGG + Intronic
1149667500 17:58375954-58375976 GTGAGTGTCCTGAAGGCAGAAGG + Intronic
1149990265 17:61379304-61379326 CCATGTTTCGAGAAGGCAGAGGG - Intronic
1150098478 17:62400129-62400151 GGAGATGCCCAGTAGGCAGATGG - Intronic
1150173346 17:63022979-63023001 GCAGGTGTGCAGAATGCAAGAGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150718591 17:67594547-67594569 GCAGGAGGCCACAAGGCAGAGGG - Intronic
1152230962 17:79113914-79113936 CCAGGTGTCCAGGAGGCATCTGG + Intronic
1152233685 17:79127381-79127403 GCAGGTGTCCAGAGCGGTGAGGG + Intronic
1152375114 17:79914893-79914915 GCAGGTTTTCAGAAGGCAGGTGG - Intergenic
1153733670 18:8042801-8042823 GCAGGTGTACAGCAGGAAGGTGG - Intronic
1154136587 18:11785327-11785349 ATGGGTGTCCACAAGGCAGATGG + Intronic
1156177501 18:34564066-34564088 TTAGGTCTCCAGAAGGCAGAAGG + Intronic
1156828137 18:41457921-41457943 GCAGGTGCACGGAAGCCAGAGGG + Intergenic
1157126490 18:44961034-44961056 GCTGGTGTCCAGAATGATGAGGG + Intronic
1157400814 18:47385018-47385040 GCAGGTGTCCTTTTGGCAGAAGG + Intergenic
1158401597 18:57126488-57126510 TCAGATGGCCTGAAGGCAGAAGG - Intergenic
1159002793 18:62988371-62988393 GGGGGTGTCCAGAAGGAGGACGG - Intergenic
1159631897 18:70758823-70758845 GAAGTTGGCCTGAAGGCAGAAGG + Intergenic
1160003206 18:75047407-75047429 GCAGAAGGGCAGAAGGCAGAGGG - Intronic
1160063166 18:75550449-75550471 GTAGGTAACCAGCAGGCAGATGG + Intergenic
1160251178 18:77204674-77204696 GCAGGTGTCCAGGCTACAGATGG - Intergenic
1160483208 18:79261907-79261929 CCAAGTGTTCAGCAGGCAGAAGG - Intronic
1160586537 18:79916396-79916418 GCAGGTGAACAGAGGGCAAAAGG - Intronic
1162046203 19:8002071-8002093 TCAGGTGTCCACTGGGCAGAGGG - Intronic
1162585550 19:11556038-11556060 ACAGATGTCCAGGAGGCAGGTGG + Intronic
1162736037 19:12747672-12747694 GCAGGAGGCTAGAGGGCAGAGGG - Intronic
1163664591 19:18597372-18597394 GGAGGTTCCCAGAAGGCTGACGG - Intronic
1164575347 19:29402533-29402555 GCGGGTGTCCTGCAGGCACAGGG - Intergenic
1165113120 19:33513541-33513563 GCAGTTGTCCAGACGGGACATGG - Intronic
1165216083 19:34273836-34273858 CCAGGTGGCGAGAAGGAAGATGG + Intronic
1166015127 19:39973968-39973990 GGAGGTGTCCAGGAGGCTGCTGG + Intronic
1166231578 19:41428013-41428035 GAAGGTGGCCAGGAGGGAGAGGG + Intronic
1166601351 19:44097848-44097870 GCAAGTTTCCAGAAGTAAGAGGG + Exonic
1166625313 19:44346668-44346690 GCAGCTTTCCAGCAGGCAGCAGG - Intronic
1167135575 19:47613322-47613344 CCAGGTCTCAAGAATGCAGAAGG + Intronic
925009532 2:471611-471633 CCTGGTGTCTACAAGGCAGAAGG + Intergenic
925247706 2:2399137-2399159 GCTGGTGTCCACAGGGCAGGGGG + Intergenic
925834326 2:7929309-7929331 TCTGGAGTCCAGAATGCAGAGGG - Intergenic
925901780 2:8514060-8514082 GCAGGAGGCCAGGAGACAGAGGG + Intergenic
926119502 2:10234545-10234567 GCAGGTGGCCAGATGCCTGAAGG + Intergenic
926210164 2:10863335-10863357 GCAGGTGTCCAGCAGGTGGCTGG + Intergenic
926316831 2:11716061-11716083 GCAGGTGACCAGCTGGCAGTTGG + Intronic
927696916 2:25245325-25245347 GCAGATGTCTGGAAAGCAGAGGG + Exonic
928619338 2:33072607-33072629 GCAGGTGAAAGGAAGGCAGAAGG + Intronic
929646688 2:43635909-43635931 GGAGCTGTGCATAAGGCAGAGGG + Intergenic
931078874 2:58746497-58746519 GCAGTTGTCCAGGAAGCAGTGGG + Intergenic
931547806 2:63408488-63408510 GGGGGTGGCCAGAAGGAAGACGG + Intronic
933651945 2:84856689-84856711 GGGGGTGTCCAGGAGGCAGCGGG - Intronic
934049358 2:88197621-88197643 GGAGGTGAACAGCAGGCAGAGGG - Intergenic
935374990 2:102386857-102386879 ACAGGACTCCAGAAGGCAAATGG + Exonic
935613089 2:105046522-105046544 ACAGATGTCCAGGAGGCAGGTGG - Intronic
936247133 2:110837965-110837987 GCAGGGATCCAGAAGAGAGAGGG - Intronic
936577488 2:113668449-113668471 CCAGGGGCCCAGAAGCCAGAAGG + Intergenic
937932970 2:127219931-127219953 GCTGCTGCCCAGAAGGCTGACGG - Intronic
937957295 2:127428510-127428532 GCCGCTGTCCGGGAGGCAGATGG - Exonic
938227260 2:129626724-129626746 GCAGGAATCCAGCAGGCTGAGGG + Intergenic
938490244 2:131757348-131757370 CCAGGTGTGCATCAGGCAGAAGG - Intronic
938758719 2:134404153-134404175 GCAAGTGTGAAGAAGGCACATGG + Intronic
938960062 2:136332896-136332918 GCTGGGGTCCAGGAGGAAGAGGG + Intergenic
939060117 2:137411723-137411745 GCATTCTTCCAGAAGGCAGAAGG + Exonic
939141764 2:138362426-138362448 GCAAGTGTCCAGCAGGCAACTGG + Intergenic
940848425 2:158665168-158665190 GTAGTTCTCCAGAAGGGAGACGG + Intronic
941694612 2:168537813-168537835 GGAGATGTCCAGTAGGCAGTTGG - Intronic
943551450 2:189345309-189345331 GCAGCTTTCCAGCAGGCAGCTGG + Intergenic
944731274 2:202520381-202520403 GCAGCTGCCAAGATGGCAGAGGG + Intronic
945119104 2:206440562-206440584 GCAGGTGGCCAGAAGGTCCATGG - Intergenic
945259553 2:207831155-207831177 GCAGCTGCACAGAAGGCAGCAGG - Intronic
946206652 2:218113806-218113828 GCAGGGGTTCACCAGGCAGAAGG - Intergenic
946474224 2:219992213-219992235 GCAGGGCTCCAGAGTGCAGAGGG + Intergenic
947869993 2:233429726-233429748 GCAGCAGGGCAGAAGGCAGACGG + Intronic
948087978 2:235266708-235266730 GCAGGAGTGCAGGATGCAGAGGG - Intergenic
948585393 2:239015838-239015860 GCAGCTGTGCAGAAGGCCGCAGG - Intergenic
948802705 2:240440082-240440104 GAAGGTGGCCAGGAGGGAGAAGG + Intronic
1169241956 20:3989602-3989624 ACATGTGTGCAGAAGGAAGATGG - Intronic
1169262359 20:4148528-4148550 GCAGAGGTCCAGAAGCCAGGAGG - Intronic
1169533195 20:6507321-6507343 GCAGGTGTCCTGAGGCCATATGG + Intergenic
1170139102 20:13107405-13107427 AATGGTGTCCAGATGGCAGAGGG + Intronic
1170159479 20:13297197-13297219 GCTGTTTTCCAGAATGCAGAAGG + Intronic
1172183957 20:33020023-33020045 GGAGGTGCCGAGAAGGCTGATGG - Intronic
1172414976 20:34757769-34757791 GAAGGGCTCCAGAAGGCAGCTGG + Exonic
1172781816 20:37441188-37441210 GCAGCTGACAAAAAGGCAGATGG - Intergenic
1172871234 20:38136700-38136722 GCAGGTGTGAGGAGGGCAGAGGG - Intronic
1174451633 20:50624335-50624357 GCAGGTGGGCAGCAGGCAGTGGG + Intronic
1175252276 20:57616773-57616795 TCAGGTGTCCTCAGGGCAGAGGG + Intronic
1177919032 21:27127185-27127207 GCATGTGTTCTGAAGGTAGAGGG + Intergenic
1177961088 21:27667055-27667077 GCAGCTCTTCACAAGGCAGAAGG + Intergenic
1179021362 21:37643783-37643805 AAAGGTCTCCTGAAGGCAGAGGG + Intronic
1179738681 21:43404293-43404315 CCAGCTGTCCAGAGGGCATAGGG - Intergenic
1180187944 21:46149686-46149708 CCAGGTGTCCACAAGACAAAAGG + Intronic
1180204352 21:46248359-46248381 GCAGCTCCCCAGAAAGCAGATGG + Intronic
1180291355 22:10853014-10853036 CCAGGTGTGCATCAGGCAGAAGG - Intergenic
1180494160 22:15882436-15882458 CCAGGTGTGCATCAGGCAGAAGG - Intergenic
1180610474 22:17093707-17093729 GCAGCTGTCCAGAAAGCATGAGG - Intronic
1180928580 22:19573512-19573534 GCAGAAGGGCAGAAGGCAGAAGG + Intergenic
1181405146 22:22679129-22679151 CCAGGTGTCCATGAGGTAGACGG - Intergenic
1182041750 22:27243455-27243477 GCAGGTGTCAAGAAGTTATAGGG + Intergenic
1182173266 22:28255302-28255324 TTAGGTGCCCAGAAGGCAAAGGG - Intronic
1182787642 22:32920827-32920849 GCAGGAGACTGGAAGGCAGAGGG + Intronic
1183076878 22:35432867-35432889 GCAGGTGTCTCGGGGGCAGATGG + Intergenic
1183449162 22:37881733-37881755 GCAAATGTCCATAGGGCAGAGGG + Intronic
1183714835 22:39527552-39527574 GCAGCTGTCTGGAAGGCAGCAGG - Intergenic
1183933003 22:41246799-41246821 CACGGTGTGCAGAAGGCAGAGGG - Intronic
1184508264 22:44917157-44917179 GAAGGTGTGCAGAGGGCAGCCGG + Intronic
1185078615 22:48696640-48696662 GCAGGTGTCCAGGCAGCTGATGG + Intronic
1185222953 22:49638115-49638137 GCAGCTGCCCAGCAGGCAGCGGG - Intronic
1185422744 22:50744215-50744237 CCAGGGGCCCAGAAGCCAGAAGG - Intronic
949265216 3:2149186-2149208 GAAGGCCACCAGAAGGCAGACGG - Intronic
950334347 3:12181823-12181845 GGAGGAGTCCTGAAGGCTGATGG + Intronic
950436552 3:12983734-12983756 GGAGCTGTCCAGAGGGGAGAGGG - Intronic
950590788 3:13934724-13934746 GCAGGTGTCCAGAAGTGAGGAGG + Intergenic
950711982 3:14819545-14819567 GCAGGTGTCCAGAAGTGAGGAGG + Exonic
951301319 3:21000707-21000729 GAAGCTGTTCAGAAGGCAGTAGG + Intergenic
953140418 3:40224471-40224493 GCAGGTGTAAAGCAGGCAGGAGG - Intronic
953271489 3:41449403-41449425 GGAAATGTCCAGAAGGCAGATGG + Intronic
953357580 3:42267524-42267546 GAAGATGCCCAAAAGGCAGAGGG + Intergenic
954750292 3:52809756-52809778 GCAGTTGTCCAGGTGGGAGAGGG - Intergenic
955751858 3:62191524-62191546 GCAGGTGTCCTGGAGCCAGCCGG + Exonic
956327822 3:68072513-68072535 GCAGGAGTCCAGGTGACAGATGG + Intronic
956449987 3:69364383-69364405 GGAGGTGCCCACCAGGCAGATGG - Intronic
957177247 3:76827328-76827350 GTAAGTGTTCAGAAGTCAGAAGG - Intronic
960545209 3:118906399-118906421 GGAAGTGTCCACCAGGCAGATGG + Intronic
960591397 3:119369224-119369246 GAAGGTGTAGAGTAGGCAGAGGG + Intronic
960811945 3:121634311-121634333 GCAGGTGGCCAGGAGGCAACAGG - Exonic
961378404 3:126481991-126482013 GCAGGTGGCCAGGAAGCAGAGGG + Exonic
961455659 3:127022693-127022715 CCAGCTGTCCAGCAGGCACAGGG - Intronic
961632195 3:128309274-128309296 GCAGGTGCAAAGAGGGCAGAGGG + Intronic
961791205 3:129378149-129378171 TCAGGTGTCATGAAGGCAGCAGG - Intergenic
961855461 3:129865921-129865943 GCAGATGTCCAGCAGGCAGTAGG + Intronic
961921218 3:130428406-130428428 GAAGGTGTCTAGAAGGCTGGGGG + Intronic
962957600 3:140280427-140280449 GGAGATATCCAGAAGGTAGAAGG + Intronic
963265191 3:143233172-143233194 GGAGGAGTCCAGATGGCAGTTGG - Intergenic
963946018 3:151146270-151146292 GCAGATGGCAGGAAGGCAGAGGG - Intronic
966452573 3:180078601-180078623 GCAGGTGTGCAAAAGGCAAGAGG - Intergenic
966642966 3:182210748-182210770 GCAGGAGTTCAGAGGGCAGGAGG + Intergenic
967308395 3:188082252-188082274 GCAGATGTTCAGAGGTCAGATGG + Intergenic
968465771 4:749898-749920 GCAGGAGCCCAGGAGGCAGAGGG - Intronic
968737435 4:2304648-2304670 GCAGGAATGCAGAAGGCAGTTGG + Exonic
969363230 4:6678565-6678587 GCTGGTGTCCAGAAGACATCTGG - Intergenic
969386060 4:6849190-6849212 GCAGGGGTCCAGGAGGCAGATGG + Intronic
969447497 4:7253552-7253574 GGAGGTGTCCAGGGGGCAGGTGG + Intronic
969513309 4:7631934-7631956 GCACCTGCCCAGAAGGCAGCTGG - Intronic
969606002 4:8202609-8202631 GCAGGTGTGCAGATGGAAGGTGG + Intronic
970671236 4:18398824-18398846 GCATGTGTCCAGGAGGGAGCTGG - Intergenic
971257464 4:25028508-25028530 GCAGCTGCAGAGAAGGCAGATGG + Exonic
972174429 4:36386142-36386164 GCAGGAGATCAAAAGGCAGAAGG - Intergenic
972264306 4:37444309-37444331 GTAGGGGTCCTCAAGGCAGAAGG - Exonic
972584005 4:40419924-40419946 GGGAGTTTCCAGAAGGCAGAGGG + Intergenic
972625787 4:40797366-40797388 GGAGATGTCAAGAAGGCAGCTGG - Intronic
972966880 4:44521133-44521155 ACAGGTGTAAAGAAAGCAGATGG + Intergenic
973194924 4:47428701-47428723 ACAGGTGTCCAGAAAGAAGTGGG - Intergenic
975191304 4:71466168-71466190 GCTGGTGTGTAGAAGGCAAAAGG - Intronic
975653713 4:76620285-76620307 GAAGGTGTCCAACAGGCAGTTGG + Intronic
976399111 4:84587658-84587680 GCAAGTCTTCAGAGGGCAGAGGG - Intronic
976494253 4:85708663-85708685 GCTGATGTCAAGAAGTCAGAGGG + Intronic
979693283 4:123583580-123583602 GCTGGAGCCCAGGAGGCAGAAGG - Intergenic
980706659 4:136505336-136505358 GAAAGTGCACAGAAGGCAGATGG + Intergenic
981158710 4:141471318-141471340 GCTGGTGTGGAGAAGGCAGGTGG + Intergenic
981901479 4:149870204-149870226 GCAGATGTACAGAGGGAAGACGG - Intergenic
982370599 4:154628670-154628692 GAAGATGTCAAGAAGGCAGCTGG - Intronic
982527490 4:156497752-156497774 CCAGGTCTTCAGATGGCAGAAGG + Intergenic
983853052 4:172606990-172607012 GCAGGTGTCTAGTAGTCAGTGGG + Intronic
983921433 4:173349818-173349840 CCAGGTGTTCAGAAGGCAGTGGG + Intergenic
985057755 4:186050024-186050046 GGAGCAGTCCAGAAGACAGATGG - Intergenic
985433548 4:189905029-189905051 TCAGCTCTTCAGAAGGCAGAAGG + Intergenic
985531355 5:435565-435587 GGAGATGTCCAGAAGGAACAGGG - Exonic
986043145 5:4012324-4012346 CCAGGTGTCCTGGAGACAGAAGG + Intergenic
986543866 5:8874192-8874214 TCAGGTGTCCAGGAGGCTGCAGG - Intergenic
987290684 5:16505628-16505650 CCAGCTGTCCTGAAGGGAGAGGG - Intronic
988448939 5:31320331-31320353 GCAACTGTCTAGAAGGGAGAGGG - Intronic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
992626316 5:78638619-78638641 GCAGGCGGCCGGAGGGCAGAGGG - Intronic
993152576 5:84179751-84179773 GTAGGTGTTCAGCAAGCAGAGGG - Intronic
996784073 5:127219320-127219342 GTTGGTGTCCAGTAGGCAGTTGG + Intergenic
998058594 5:139100868-139100890 AAAGGTGTCTAGTAGGCAGATGG + Intronic
998108307 5:139482209-139482231 GCCAGTGTCCGGGAGGCAGAAGG - Exonic
998306543 5:141083250-141083272 GCTGGAACCCAGAAGGCAGAAGG - Intergenic
998613377 5:143713309-143713331 GCAGATGACCAGAAGGTGGAGGG - Intergenic
999070393 5:148738106-148738128 GGAGGTGTCCAGCATTCAGATGG - Intergenic
999177333 5:149640565-149640587 GCAGGTGTCCATCAGGCAGTTGG + Intergenic
999265804 5:150266137-150266159 ACAGCAGTCCAGAAGGCAGGAGG - Intronic
1001586714 5:172837877-172837899 GCTGGTGTGCAGAAGGCAGCAGG - Intronic
1002452174 5:179325393-179325415 GCAGATGTCCTGGAGACAGAAGG + Intronic
1004756028 6:18611314-18611336 GGAGATTTCCAGAAGGCTGAAGG + Intergenic
1005254237 6:23982897-23982919 GCACGTGTGCATAAGGCATAAGG - Intergenic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1013086983 6:106865277-106865299 TCAGTTGTCCAGAAGACAGTTGG + Intergenic
1013180446 6:107712802-107712824 GAAGGTGTCAGGAAGACAGATGG + Intronic
1013601271 6:111707299-111707321 GAAGGTGTTCAGTAGGCTGAAGG - Intronic
1013723280 6:113057982-113058004 GCAGCTGTCAAGTAGGCAGATGG - Intergenic
1015096980 6:129427677-129427699 GGAGGGATCCAGAAGGCAGTTGG - Intronic
1015151938 6:130049791-130049813 GGAGATGTCCAGTAGGCAGGTGG - Exonic
1015856685 6:137632464-137632486 GCAGGTGTCCTGCTGGGAGAAGG - Intergenic
1016814792 6:148293532-148293554 ACAGCTGTCAAGAAGGCAGGTGG - Intronic
1017940481 6:159048481-159048503 GCAGAATTCCAAAAGGCAGATGG - Intergenic
1018379154 6:163241762-163241784 GCGGGTGTGTAGAAGGCAAAAGG + Intronic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019194677 6:170274160-170274182 GCTGGTGCTCAGAAGGCAGATGG - Intergenic
1019273749 7:165017-165039 GGATGTGCCCAGAAGGCGGAGGG + Intergenic
1019323527 7:426282-426304 GTAGGGGTGGAGAAGGCAGAAGG + Intergenic
1019567141 7:1689928-1689950 CCAGGTGTCCAGAGGGCTCAAGG - Intronic
1019606359 7:1912138-1912160 GCAGGGGTCCAGATGGCGGCAGG + Intronic
1021942477 7:25691485-25691507 GCAGATGTCCATAAGGAAGATGG + Intergenic
1022509390 7:30925638-30925660 TCAGGGGTCTTGAAGGCAGAAGG - Intergenic
1022545046 7:31179076-31179098 GGAGTTGTGCAGAAGGCAGAGGG + Intergenic
1023266342 7:38410200-38410222 TCAGGTTGGCAGAAGGCAGAGGG + Intronic
1023361431 7:39420056-39420078 GCAGATTTACTGAAGGCAGATGG - Intronic
1023614067 7:42000676-42000698 GCATGTGGCTAGAAGGCTGAGGG + Intronic
1023778820 7:43636575-43636597 GCTGGTGGCCAGAGGACAGAAGG + Intronic
1024152455 7:46586478-46586500 GTTGGAGTCAAGAAGGCAGATGG + Intergenic
1024565153 7:50674473-50674495 ACAGGTGTCCCCGAGGCAGAGGG - Exonic
1026617480 7:71918668-71918690 GCACGTTCCCAGAAGGAAGAAGG + Intronic
1030080238 7:105771336-105771358 GCAGGTGTCAAGCAGGGAGGAGG + Intronic
1030182025 7:106720098-106720120 ACAGATGTCCAGTAGGCAGTTGG + Intergenic
1031255207 7:119438082-119438104 GCATGTGGTCACAAGGCAGATGG + Intergenic
1032672927 7:134101449-134101471 GGAGGGGTCCAGCAGGCAGTTGG + Intergenic
1035185574 7:157123310-157123332 GCAAGTGTCCAGGGGGCAGCAGG - Intergenic
1036008282 8:4692151-4692173 GCTGGTTTCCAGAAGGGACAGGG - Intronic
1036497486 8:9282736-9282758 GCAGACGTCCAAAAAGCAGAGGG + Intergenic
1036645105 8:10607823-10607845 GTAGATGCCCAGGAGGCAGAAGG - Exonic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037734064 8:21553004-21553026 GGAGGTCTCCACAAGGCAGAAGG + Intergenic
1037817256 8:22118788-22118810 ACAGGTGCAGAGAAGGCAGAGGG - Intronic
1038073300 8:24042429-24042451 ACATATTTCCAGAAGGCAGAAGG - Intergenic
1038099128 8:24352429-24352451 GCAGCTGTCTACAAGCCAGAAGG - Intronic
1038408058 8:27336916-27336938 GCTTGAATCCAGAAGGCAGAGGG - Intronic
1041686020 8:60645260-60645282 GCAGGTTTCCAGAAAGTGGAAGG - Intergenic
1041738333 8:61134069-61134091 GGAGATGTCCAGCAGGCAGCTGG + Intronic
1043779450 8:84313047-84313069 GCAGGTGTGCAGAAGACAAGAGG - Intronic
1044435141 8:92153070-92153092 ACAGGTGTACAGCAGGAAGAGGG - Intergenic
1044698123 8:94943085-94943107 GGAGATGTCCAGCAGGCAGCAGG + Intronic
1045064831 8:98435770-98435792 GCGGGTGTGCAGTGGGCAGAGGG + Intronic
1045215862 8:100147677-100147699 GCATTTCTCCAGAAGGCAGTGGG + Intergenic
1046619015 8:116508048-116508070 GAAGATGCCCAGAAGGCAGTTGG + Intergenic
1047446758 8:124927054-124927076 GCACGTGGCCAGAACCCAGAGGG + Intergenic
1048053355 8:130840231-130840253 GCTGGGGTTCAGAAGGCAGATGG + Intronic
1048161070 8:132022629-132022651 GAAGATGTGGAGAAGGCAGATGG + Intergenic
1048163139 8:132039017-132039039 GGAGGTGTCCAGAAGGTTCAGGG + Exonic
1048356042 8:133654789-133654811 GAAGGAGCCCAGCAGGCAGAAGG + Intergenic
1049204003 8:141354975-141354997 GCAGGGTTCCACAAGGCAGAGGG - Intergenic
1049229187 8:141473318-141473340 GGAGGGGCCCAGCAGGCAGACGG - Intergenic
1049342039 8:142118380-142118402 GCAGGTGGCCACATGCCAGATGG + Intergenic
1049402537 8:142436004-142436026 GCCTGTGTCCAGGAGACAGAGGG + Intergenic
1049569852 8:143364294-143364316 GCAGTTCTCCAGAAGCCAGCAGG + Intergenic
1049726272 8:144147965-144147987 GCGGGTGGCCAGAAGGCAGCGGG + Intergenic
1051798780 9:20907484-20907506 GAGGATGTCCAGAAGGCAGCAGG - Intronic
1052736140 9:32344569-32344591 GAAGGCTTCCAGAAGGCAGAAGG - Intergenic
1053644605 9:40113076-40113098 CCAGGTGTGCATCAGGCAGAAGG - Intergenic
1053761377 9:41351775-41351797 CCAGGTGTGCATCAGGCAGAAGG + Intergenic
1054325628 9:63710956-63710978 CCAGGTGTGCATCAGGCAGAAGG - Intergenic
1054539971 9:66262893-66262915 CCAGGTGTGCATCAGGCAGAAGG + Intergenic
1054767392 9:69053700-69053722 GTATTTGTCCAGCAGGCAGATGG + Intronic
1055551995 9:77439929-77439951 GGAGATGTCTAAAAGGCAGATGG + Intronic
1055673784 9:78634352-78634374 GCAGGTCTTCAGCAGGCAGCAGG - Intergenic
1056848622 9:90061841-90061863 GCTGGTGTAATGAAGGCAGAGGG - Intergenic
1057602798 9:96473202-96473224 GAAAGTGTCCAGTAGGCAGATGG - Intronic
1057721064 9:97532291-97532313 TCATGGGTCCAGAGGGCAGAGGG - Intronic
1058495847 9:105558257-105558279 GCAGGTGCCCAGAATGCTGGAGG - Intronic
1058773673 9:108263829-108263851 GTACCTGTCCAGAAGGCAGCTGG - Intergenic
1059763297 9:117359922-117359944 GCAGGAGTTAAGAAGTCAGATGG + Intronic
1060567273 9:124604220-124604242 GGAGGTGCCCAGGAGGCAGTTGG - Intronic
1061536325 9:131252438-131252460 GCAGCTTTCCAGAAGGCAGCCGG - Intergenic
1061562967 9:131418280-131418302 ACAAGTTTCCAGAAGGAAGAGGG - Intronic
1062647322 9:137555287-137555309 GCAGGTGGCCAGGAGGCTGAAGG + Exonic
1186302035 X:8210854-8210876 GCTGGTGTTCAGGAGTCAGACGG - Intergenic
1186388643 X:9135739-9135761 GAAAGTGTCCTGGAGGCAGAGGG + Intronic
1186628274 X:11318864-11318886 GCAGCTGCCAAGAAGACAGAGGG + Intronic
1187338668 X:18402340-18402362 GCAGGACTCCAGCGGGCAGAGGG - Intergenic
1189268875 X:39736470-39736492 GGAGGTGACCAGCAGGCAGAAGG + Intergenic
1191675934 X:63792503-63792525 GCCGGGGTTCTGAAGGCAGAGGG + Intergenic
1192250240 X:69407135-69407157 GCAGTGGTCCAGGAGACAGATGG + Intergenic
1192571424 X:72209344-72209366 GGAGATGTCCAGAAGGCAGCTGG - Intronic
1193492955 X:82171917-82171939 GGAGCTGACCAGAAGGTAGATGG + Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195113423 X:101670055-101670077 GCAGATATCCAGAAGAGAGATGG - Intergenic
1195116771 X:101707164-101707186 GCAGATAACCAGAAGGGAGATGG + Intergenic
1195371392 X:104178247-104178269 GCATGAGCCCAGGAGGCAGAGGG - Intronic
1196179299 X:112672514-112672536 GAATGTCTCCAGCAGGCAGATGG + Intronic
1198379570 X:136071131-136071153 GGAGATGTCCAGCAGGCAGATGG + Intergenic
1200146432 X:153928539-153928561 GCACGTGACCAGCAGGCAGCCGG - Intronic
1201739509 Y:17308399-17308421 GAGGGTGGCAAGAAGGCAGATGG - Intergenic