ID: 1142982194

View in Genome Browser
Species Human (GRCh38)
Location 17:3678782-3678804
Sequence AGGAGGTGTCCAGCCCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142982193_1142982194 -10 Left 1142982193 17:3678769-3678791 CCAGTCTGACAGCAGGAGGTGTC 0: 1
1: 0
2: 0
3: 11
4: 135
Right 1142982194 17:3678782-3678804 AGGAGGTGTCCAGCCCCCACTGG 0: 1
1: 0
2: 2
3: 29
4: 159
1142982192_1142982194 -9 Left 1142982192 17:3678768-3678790 CCCAGTCTGACAGCAGGAGGTGT 0: 1
1: 0
2: 3
3: 23
4: 282
Right 1142982194 17:3678782-3678804 AGGAGGTGTCCAGCCCCCACTGG 0: 1
1: 0
2: 2
3: 29
4: 159
1142982191_1142982194 -8 Left 1142982191 17:3678767-3678789 CCCCAGTCTGACAGCAGGAGGTG 0: 1
1: 1
2: 1
3: 22
4: 279
Right 1142982194 17:3678782-3678804 AGGAGGTGTCCAGCCCCCACTGG 0: 1
1: 0
2: 2
3: 29
4: 159
1142982188_1142982194 24 Left 1142982188 17:3678735-3678757 CCTGGGGTGTGGTTTGCAAGAGA 0: 1
1: 0
2: 1
3: 9
4: 146
Right 1142982194 17:3678782-3678804 AGGAGGTGTCCAGCCCCCACTGG 0: 1
1: 0
2: 2
3: 29
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142982194 Original CRISPR AGGAGGTGTCCAGCCCCCAC TGG Intronic
900165469 1:1242728-1242750 AGGAGGTGCCGAGGCCCCAGAGG + Intronic
900564768 1:3326843-3326865 AGGTGGGCTCCTGCCCCCACTGG + Intronic
900604466 1:3517610-3517632 GGGATGTGTCCAGACCCCTCGGG + Intronic
901869099 1:12127032-12127054 AGGAGGGTTCCAGCTCCCAAGGG - Intronic
902373262 1:16018139-16018161 AGAAGATTTCCAGCCCCCTCTGG - Exonic
902388200 1:16088110-16088132 AGGAGGTGCCCAGCCCGGGCTGG - Intergenic
902391692 1:16110884-16110906 AGGAGCTTGCCAGGCCCCACTGG - Intergenic
902800142 1:18824395-18824417 AGGAGCTGCCCAGCACCCAGGGG + Intergenic
904945837 1:34198060-34198082 GGGCTGTTTCCAGCCCCCACAGG + Intronic
905664569 1:39755181-39755203 AGGAGGTGTCCAACAGCTACAGG - Intronic
906038279 1:42766701-42766723 AGTCGGGGTCCAGCTCCCACGGG + Exonic
908455108 1:64296316-64296338 ACCAGGTGTCCAGCCCACTCTGG + Intergenic
911153929 1:94621306-94621328 AGGATGGATCCAGCCTCCACTGG - Intergenic
912551535 1:110488374-110488396 ATGAGGTCTCCAGCCCCCTCTGG - Intergenic
915914066 1:159930796-159930818 AGGAGGTGAGCAGCCCCCACAGG + Exonic
917297748 1:173539534-173539556 AGAAGCTGTCTAGCCACCACTGG + Intronic
918535040 1:185564698-185564720 AATATGTGTCCAGCCCCTACGGG + Intergenic
919940839 1:202284939-202284961 GGGAAGTGTCCAGCCAGCACAGG - Intronic
919943780 1:202305707-202305729 AGGAGCTGCCCAGCCTGCACAGG + Exonic
920339187 1:205265083-205265105 AGGAGGTGTCCAGGCCTCTGTGG + Intronic
920609551 1:207423629-207423651 GGAAGGTGCCCCGCCCCCACCGG - Intergenic
923007986 1:230067319-230067341 AGGCGATGCCCAGCACCCACAGG - Exonic
923031069 1:230249357-230249379 AGAAGGTGAACAGCCCCCACTGG - Intronic
1065133151 10:22643076-22643098 ATGAGGTGTCCATCACCCACAGG - Intronic
1070977548 10:80617250-80617272 AGGAGGTGCCCAGCCATCTCTGG + Intronic
1071267244 10:83975179-83975201 AGGATGAGTCCAGGACCCACTGG + Intergenic
1072674197 10:97453465-97453487 AGGCGGTGTCCAGGCCCCTCAGG - Intronic
1073302826 10:102481335-102481357 AGCAGGTTTCCAGTCCCCACAGG + Intronic
1076048280 10:127312501-127312523 AGGAAGTGTGAAGCCCTCACTGG - Intronic
1076351186 10:129816171-129816193 AGGAGGATTCCAGCCCCCGGGGG - Intergenic
1076729739 10:132432323-132432345 AGGAGGGGCTCAGCTCCCACAGG + Intergenic
1078879215 11:15431612-15431634 AGGAGGAGGCCAGCCCCCTGGGG - Intergenic
1084618269 11:70251102-70251124 GTGAGGTGTCCAGCCAGCACAGG + Intergenic
1089127779 11:116189517-116189539 AGGAGGTCTACAGCCCCTCCTGG + Intergenic
1089331269 11:117690643-117690665 AGGAGGAGCCCAGCCACCTCTGG + Intronic
1089365448 11:117918462-117918484 CGGATGGGTACAGCCCCCACTGG + Exonic
1092992603 12:13917385-13917407 AGAGGGTCTCCAGCTCCCACTGG - Intronic
1094845187 12:34358388-34358410 AGCAGATGTCCCCCCCCCACTGG - Intergenic
1095923631 12:47556605-47556627 ATGAGATGCCCAGCCCTCACTGG + Intergenic
1096110348 12:49025122-49025144 AGGAGGTTTCCAACCCCAAGGGG + Intronic
1096463217 12:51834316-51834338 GGAAAGTGTCCAGCCCCCAAAGG + Intergenic
1096506356 12:52096054-52096076 AGGAGATGTACACCCACCACGGG - Intergenic
1101999364 12:109547186-109547208 AAGAGGCGTCCTGCCCACACTGG + Intergenic
1103524625 12:121559466-121559488 AGCTGGGGTCCAGCCCCCACGGG + Intronic
1104042342 12:125138847-125138869 GGGAGGGGTCCAGCCTCCACAGG + Intronic
1105543657 13:21336639-21336661 AGGAGCCGGCCAGCCTCCACTGG + Intergenic
1110014815 13:70387026-70387048 AGGAAGCCTCCTGCCCCCACAGG - Intergenic
1110412621 13:75220525-75220547 GGGGGCTGGCCAGCCCCCACAGG + Intergenic
1111141740 13:84127759-84127781 AGGAAGTCTCCTGCCCCCACAGG - Intergenic
1112407310 13:99132625-99132647 AGGTGCTCTCCAGCTCCCACTGG + Intergenic
1114716514 14:24831696-24831718 AGGATGTGTCCAGCCCAAATTGG + Intronic
1118189229 14:63565407-63565429 ATGAGATGCCCAGCCCTCACTGG - Intergenic
1118729159 14:68654620-68654642 AGGAAGTGCCAAGCACCCACGGG - Intronic
1119379191 14:74217980-74218002 AGGAGGTGCCCAGCACCAACAGG + Intergenic
1121211020 14:92207930-92207952 AGGAGGTGTGGAGCCTTCACAGG + Intergenic
1122557350 14:102588733-102588755 GGGAGGTTTCAAGCCCCCAAAGG - Intergenic
1123778094 15:23600451-23600473 AGGTGGTGTACAGCTCCCACTGG + Intronic
1125598215 15:40900872-40900894 AGGCTGGGGCCAGCCCCCACCGG + Exonic
1127670450 15:61189522-61189544 AGGAGGGCTGCAGCCTCCACAGG + Intronic
1128132315 15:65237117-65237139 AGGAGGTTCCCAGCCCTCCCAGG - Intronic
1128145786 15:65331849-65331871 AGGAGGTGTACAGCCTACTCAGG + Intronic
1129092440 15:73165795-73165817 ATGAGATGTTCAGCCCTCACTGG - Intronic
1130830622 15:87594867-87594889 AGGAGGGTTCCAGCCCTCAATGG - Intergenic
1132456409 16:26098-26120 AAGACGTGTCCAGGCCACACAGG + Intergenic
1132765178 16:1530902-1530924 AGGGCGTGTCCAGCCTCCACTGG - Intronic
1132913693 16:2329816-2329838 AGGAGGTGCCCAGGGCTCACAGG + Exonic
1132940915 16:2507689-2507711 AGGGGGTGTCCCGCCACCACAGG - Intronic
1133099004 16:3467723-3467745 AAGATGTCTCCAGCACCCACAGG - Intronic
1134094586 16:11411167-11411189 AGGAGGGGGCCAGGCCCCTCTGG - Intronic
1135752302 16:25067025-25067047 AGGAGCTGTCCCGCCCCCTCCGG - Intergenic
1138304752 16:55964497-55964519 AGGATGTGTCCAGCCTCCAAGGG + Intergenic
1141008192 16:80372751-80372773 AGTAGGTGTCAAGCCCTGACTGG - Intergenic
1141830938 16:86509831-86509853 AGGCGGGGTCCAGCGCGCACCGG + Intergenic
1141942830 16:87289771-87289793 AGGACGTGTGCAGGCTCCACGGG - Intronic
1142982194 17:3678782-3678804 AGGAGGTGTCCAGCCCCCACTGG + Intronic
1144948765 17:18982977-18982999 GGAAGGTGTCCAGCTCCCAGTGG + Intronic
1149651798 17:58280433-58280455 ACGAGGTGTCCACCTCCCCCAGG + Exonic
1151803543 17:76391613-76391635 GGAAGGTGTCCCGCCCACACAGG - Exonic
1151807280 17:76413904-76413926 AAGAGGAGTCCAGCTCCAACAGG - Intronic
1152345172 17:79747035-79747057 AGGAGCTGGCCAGGCCCCACTGG - Intergenic
1152401797 17:80070914-80070936 GGGCAGTGTCCAGCTCCCACAGG - Intronic
1152401908 17:80071440-80071462 AGGAGGTGTCCAGCAGCCTGTGG - Intronic
1152458577 17:80429830-80429852 AGGTGAGGGCCAGCCCCCACAGG + Exonic
1152554168 17:81044887-81044909 ACGGGGTGTCCGGCCCACACGGG - Intronic
1152633461 17:81420924-81420946 AGGCCGTGTTCAGCCCCCAGCGG + Intronic
1152866624 17:82727502-82727524 GGGAGGTGGCCAGCGCCCCCGGG + Exonic
1155695824 18:28684949-28684971 ATGAGGTGTCCAGCCCTGAAGGG + Intergenic
1158868116 18:61657742-61657764 AGGAGGTTTCCATCACCCTCTGG - Intergenic
1161353899 19:3808753-3808775 AGGAAGTGTCCAGCCCAGGCAGG - Intronic
1161481069 19:4510902-4510924 TGGTGGTGTCCAGGCCCCCCTGG + Exonic
1161481346 19:4512288-4512310 TGGTGGTGTCCAGGCCCCCCTGG + Exonic
1161982594 19:7637604-7637626 GGGACGTGTCCAGGCCCCACAGG + Intronic
1162069979 19:8147620-8147642 AGGAGGCATCCAGCCCCAACCGG + Intronic
1164712160 19:30364650-30364672 AGAAAGTGTCCAGCCTGCACAGG + Intronic
1166080576 19:40441765-40441787 TGGAGGTGTCCAGCTCCCTGAGG + Exonic
1166743694 19:45129805-45129827 GGGAGGGGTCCTGCCCCCATGGG + Intronic
1166976158 19:46606202-46606224 AGGAGCTCTGCAGGCCCCACAGG - Intronic
1167647954 19:50715962-50715984 AGGAGGAGTCTGGACCCCACAGG + Intronic
926929935 2:18026997-18027019 AAGAGGTCTCCATCCACCACAGG - Intronic
927204605 2:20599219-20599241 AGGAGCTGTCCTGGCCCCAGGGG + Intronic
929576868 2:43057489-43057511 AGGAGATGCCCAGCCCCCTTGGG - Intergenic
932292305 2:70592861-70592883 AAGAGGTTGGCAGCCCCCACTGG + Intergenic
932406071 2:71513311-71513333 AAGAAGTGGCCGGCCCCCACGGG + Exonic
933994431 2:87657379-87657401 AGGGGATGACCAGCCCTCACTGG - Intergenic
936299427 2:111293534-111293556 AGGGGATGACCAGCCCTCACTGG + Intergenic
936458363 2:112692856-112692878 AGGAGGAGTACAGACCACACTGG - Intergenic
941079335 2:161041877-161041899 GGGATGTACCCAGCCCCCACAGG - Intergenic
942200647 2:173567669-173567691 AGGAAGTGCCCAGCTCCCAGAGG - Intergenic
944986417 2:205182808-205182830 ACGAGGTGCCCAGCCACCAGTGG - Intronic
947473404 2:230418498-230418520 AGGAGCTGTAAAGCCACCACAGG - Intronic
948225948 2:236309500-236309522 AGGAGGTGTGGAGGCCCCCCAGG + Intergenic
948883151 2:240870535-240870557 GGGTGGGGTCCAGCCCTCACAGG + Intronic
1168790630 20:573528-573550 GGGATGCGTCCAGCCCCCTCTGG - Intergenic
1169192422 20:3666666-3666688 AGGGGGTGTCTAGACCCCGCGGG - Intergenic
1172244774 20:33438395-33438417 AAGAGCTCTCCAGGCCCCACAGG + Intronic
1178365609 21:31986713-31986735 AGCATGTGCACAGCCCCCACAGG - Intronic
1178887281 21:36494095-36494117 AGCAGGTGTCCACCCAGCACGGG - Intronic
1181027007 22:20132275-20132297 CCGAGGTGCCCAGCCCGCACTGG - Intronic
1183117308 22:35701932-35701954 AAGAGATGTACAGCCCCCATGGG - Intergenic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183452738 22:37905874-37905896 ACGAGGTGTCCCGCCTCCAAAGG + Intronic
1184442043 22:44522950-44522972 AGGGGGTGCCCAGCCCCTCCAGG - Intergenic
1185116176 22:48939632-48939654 AGGAGTAGCTCAGCCCCCACAGG + Intergenic
1185347741 22:50317771-50317793 AGGAGCTGGCCAGGCCCCACTGG - Intronic
950545954 3:13638045-13638067 AGGAGGGGTCCAGAAGCCACAGG - Exonic
950727477 3:14926248-14926270 AGGATGTGTGCAGGCCCCAGGGG - Intronic
953660965 3:44891223-44891245 AGAAGATGTCCAGCACCCTCTGG - Intronic
956952597 3:74299431-74299453 AGCAGCTGTGCAGCCCCCACTGG - Intronic
960801561 3:121545633-121545655 GGGAGGTGTCCTCACCCCACGGG - Intronic
961037621 3:123653494-123653516 AGGAGGAGTCCAGTCCACCCAGG - Intronic
961311717 3:126006507-126006529 AGAAGGTGTACAGCCTCCCCAGG - Exonic
962286850 3:134093522-134093544 AGGAGGAGCCCAGACCCAACTGG + Intronic
967323043 3:188212811-188212833 ACACGATGTCCAGCCCCCACAGG - Intronic
968292235 3:197547706-197547728 AGGGAGAGGCCAGCCCCCACGGG - Intronic
968566450 4:1316049-1316071 AGGATGTGTGCAGACACCACAGG - Intronic
968573964 4:1356360-1356382 TGGTGGTGTGCAGCCCCCCCAGG + Intronic
968662196 4:1803287-1803309 AGGAGGTGCCCGGTGCCCACCGG + Intronic
969055732 4:4401534-4401556 AGGAGGTGTCCATGTCCCAAAGG - Intronic
970340970 4:15106475-15106497 AGGATGTGTCCTGACTCCACGGG - Intergenic
970349340 4:15185630-15185652 AGGAGGTGGCCATCCTCCTCTGG - Intergenic
973893069 4:55387224-55387246 ATGAGATGCCCAGCCCTCACCGG + Intergenic
984342935 4:178481988-178482010 GGGCTGTGTCCAGCCCCCACAGG - Intergenic
985678085 5:1242594-1242616 AGGAGGGGCCCAGCCCTCCCAGG + Intronic
985769405 5:1799563-1799585 AGGGGGTGTCCAGCGACCCCGGG - Intronic
985786408 5:1897595-1897617 AGGAAGTAGCCAGCCCCCACAGG - Intergenic
985923853 5:3000486-3000508 AGGTGGTCAGCAGCCCCCACAGG + Intergenic
986374364 5:7115057-7115079 AGGGGGTGTTCAGCCACAACTGG + Intergenic
989164853 5:38423957-38423979 AGGAGGGCTCCTGCCCTCACAGG + Intronic
992384929 5:76275539-76275561 AGTAGGTGTCAAGTCCCCAGGGG + Intronic
999146878 5:149402133-149402155 AGGAGGTGTCCAGACCCATGTGG + Intronic
1002373122 5:178770178-178770200 AGGAGGGGCCCAGCCTCCACAGG - Intergenic
1003162018 6:3644164-3644186 TGGAGGTCACCAGTCCCCACAGG - Intergenic
1003572791 6:7267044-7267066 AGGACGTGACCAAGCCCCACGGG + Intergenic
1003902804 6:10670504-10670526 AAGAAGTGTCCAGCCCCAAATGG + Intergenic
1006301065 6:33193695-33193717 GGGAGGTGGCCAGCCCGCAGAGG - Exonic
1007204898 6:40141110-40141132 AGTAGTTGTCCATCCACCACTGG - Intergenic
1007415695 6:41689963-41689985 ATGAGCTGTCCAGGTCCCACTGG + Intronic
1007490952 6:42221467-42221489 AGGAGCTGTCCAGACCACACAGG - Intergenic
1007516078 6:42412451-42412473 AGGAGGTTTGCAGCTCACACAGG + Intronic
1008030444 6:46688302-46688324 AGGCGCTGCCCAGCGCCCACTGG - Exonic
1008875721 6:56324361-56324383 AAGAGGTCTCCAGCCACCACAGG + Intronic
1013992721 6:116273570-116273592 AGGAGTTGACCATCCCCCTCAGG - Intronic
1016429091 6:143964231-143964253 AGGAGGTTTCCAGCCCTCACTGG + Intronic
1018910027 6:168096533-168096555 AGGGGATGTCCAGGCCACACAGG + Intergenic
1019373174 7:674159-674181 GGGAGGTGTCCAGGCCCCCCAGG - Intronic
1021608585 7:22433987-22434009 AGGATGTGTCCAGCCACCCAGGG + Intronic
1024865946 7:53905156-53905178 AGGATGAGTCCAGGACCCACTGG - Intergenic
1033332756 7:140429801-140429823 AGGAGAGGGCTAGCCCCCACAGG - Intergenic
1033707928 7:143906504-143906526 AGGAGCTGGCCAGACCCCAGAGG + Intergenic
1033756949 7:144403763-144403785 GGCAGGTGTGCAGCCCGCACGGG + Intronic
1034255919 7:149724645-149724667 AGGAGGTATCCAGGCCCTGCGGG - Exonic
1035064616 7:156095735-156095757 AGAAGGTGCCCAGCCCACACCGG + Intergenic
1036575758 8:10026435-10026457 AGGAGTTGCCCAGCCAACACAGG + Intergenic
1036776565 8:11616998-11617020 AGGTGGTGTACAGCCCCCCAGGG - Intergenic
1037036635 8:14177198-14177220 AATAGGTGCCCAGTCCCCACTGG - Intronic
1048303222 8:133266472-133266494 AGGAGGTGACTTGCCCCCACAGG - Intronic
1048987306 8:139741428-139741450 AGTAGGTGCTGAGCCCCCACTGG + Intronic
1049203423 8:141352515-141352537 AGGGGGTGTCCAGCTCCAATAGG + Intergenic
1050457105 9:5844953-5844975 AGGATGTGTCCTGGCCCCTCTGG + Intergenic
1050992353 9:12170291-12170313 AGAAGCTGTCCAGCTCCCAAAGG - Intergenic
1052516478 9:29487039-29487061 AGCAGGTGTCCCCCACCCACAGG - Intergenic
1059247782 9:112863115-112863137 TGAAGGTGTCCAGCTCCCTCAGG + Intronic
1060519569 9:124286728-124286750 AGAAGGTGACCAGGCCCCTCAGG - Intronic
1061363663 9:130158998-130159020 TGGGGGTGTCCACCCCACACTGG - Intergenic
1061422523 9:130480012-130480034 AGGAGGTCTCCTGCCTCCAAGGG + Intronic
1062562465 9:137147756-137147778 GGGAGGTGAGCAGCCCCCCCGGG - Intronic
1186253153 X:7690979-7691001 AGCAGGTGTCCAGCCGCCTGTGG - Intergenic
1187325498 X:18282910-18282932 AGGAGGAGTCCTTCCCCCTCAGG - Intronic
1190247889 X:48702524-48702546 AGGAGATGTCCAGACCCCATAGG + Intronic
1197707257 X:129643134-129643156 CGGAGGAGCCCAGCCCCTACAGG + Intergenic
1200399953 X:156013625-156013647 AAGAGGTGTCCAGGCCACACAGG - Intergenic