ID: 1142984569

View in Genome Browser
Species Human (GRCh38)
Location 17:3688152-3688174
Sequence CACATCAGTGCTGCCTAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142984569_1142984575 7 Left 1142984569 17:3688152-3688174 CCTCTTTAGGCAGCACTGATGTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1142984575 17:3688182-3688204 TGGGGACTTAGAAGGACTCCCGG 0: 1
1: 0
2: 0
3: 12
4: 176
1142984569_1142984574 -1 Left 1142984569 17:3688152-3688174 CCTCTTTAGGCAGCACTGATGTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1142984574 17:3688174-3688196 GGCTGCTCTGGGGACTTAGAAGG 0: 1
1: 0
2: 3
3: 22
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142984569 Original CRISPR CACATCAGTGCTGCCTAAAG AGG (reversed) Intronic
901721931 1:11205812-11205834 CACATCAATCCTCCCTAAATGGG + Intronic
904808818 1:33150309-33150331 CACATCAGTGCAGCCAACAGAGG - Intronic
911101094 1:94096343-94096365 CACAGCAGTGCAGCCTAGAAAGG - Intronic
920956845 1:210627314-210627336 CACATCAGTGATGCCAGGAGAGG - Intronic
921909643 1:220533267-220533289 CACATCAGTGGTCTCTAAAGTGG + Intronic
923389941 1:233504236-233504258 CACACCACTCCTGCCTTAAGAGG + Intergenic
924829248 1:247575119-247575141 CACATCGGTTCAGCTTAAAGAGG - Exonic
1065486171 10:26238233-26238255 CACATCAATTCTGCCAAGAGAGG + Intronic
1065688682 10:28310789-28310811 CAGATCAGTGCAGGGTAAAGTGG - Intronic
1071717583 10:88112945-88112967 CAGAGCAGAGCTTCCTAAAGTGG - Intergenic
1072475784 10:95758537-95758559 CTCATCAGTTATGCCTAAGGTGG + Intronic
1073581752 10:104674228-104674250 CACATTAGAGCTGCATATAGTGG - Intronic
1074766127 10:116701175-116701197 CAAATCTGTGCTGCCTGAATTGG - Intronic
1075602290 10:123778766-123778788 CACACCAGTGCTCCATAAAATGG + Intronic
1078846215 11:15120549-15120571 CACACAAGTGTTGCCTAACGTGG + Intronic
1085869490 11:80332587-80332609 CACACCAGTGCTTCCTTAGGAGG + Intergenic
1085912740 11:80847731-80847753 CACATCTGTGCTGTCCAAAAAGG + Intergenic
1087177489 11:95108879-95108901 CTTATCAGAGCTGCCTACAGGGG - Intronic
1087471985 11:98587240-98587262 CACATTGGTTCAGCCTAAAGAGG + Intergenic
1089027482 11:115286842-115286864 CACATCACTACTGATTAAAGAGG + Intronic
1091672937 12:2466163-2466185 CACATTAGGGCTGCTAAAAGCGG + Intronic
1094496284 12:30991404-30991426 CTCATCAGAGCTGTCTGAAGTGG - Intronic
1097319888 12:58213477-58213499 CACATCACAGCTGCCTCTAGAGG - Intergenic
1097395768 12:59072860-59072882 TAGATCAGTGTTGCTTAAAGTGG + Intergenic
1098092082 12:66914497-66914519 CACATCAGTAATGACTACAGTGG + Intergenic
1101429498 12:104615169-104615191 AACTCCAGTGCTGCCTAAAATGG + Intronic
1104287139 12:127433587-127433609 CACGGCAGTCCTTCCTAAAGGGG - Intergenic
1108327237 13:49345881-49345903 CAGATCAGTGCTGCCTTGAAAGG + Intronic
1113271850 13:108683241-108683263 CACATCTGAGTTGCTTAAAGTGG - Intronic
1114732642 14:25010070-25010092 CATATCAGTGATTCCCAAAGAGG - Intronic
1115076887 14:29403451-29403473 TACATCATTGCAGCCTAGAGTGG + Intergenic
1117586094 14:57206956-57206978 CACATCAGAGCTTTCTAAAATGG + Exonic
1118460799 14:65985377-65985399 CACATTAGTTCTGCTTAAAAAGG - Intronic
1119461083 14:74804240-74804262 CACATCGACGCTGCCTGAAGTGG - Intronic
1120859730 14:89244123-89244145 CACCTCAGTTCTGTGTAAAGAGG - Intronic
1121235521 14:92389003-92389025 CATATTAGTTCTGCCTTAAGTGG - Intronic
1121417894 14:93791474-93791496 CACATGAGGTCTGCCTACAGGGG + Intergenic
1123986790 15:25653412-25653434 CACATTGGTTCAGCCTAAAGAGG + Intergenic
1131838739 15:96415241-96415263 CAAAGCCTTGCTGCCTAAAGTGG - Intergenic
1137683872 16:50372713-50372735 TGCATCAGTGCTGCATAAGGGGG - Intergenic
1137910945 16:52377690-52377712 CATAACTGTGCTGCCTCAAGAGG + Intergenic
1138389843 16:56662497-56662519 CGCATTAGAGCTGCCTGAAGTGG - Intronic
1139907991 16:70380037-70380059 CATCTCAGTGCTTCCTGAAGAGG - Exonic
1142511286 17:395057-395079 CACATCAGTGCCAACCAAAGGGG + Intergenic
1142984569 17:3688152-3688174 CACATCAGTGCTGCCTAAAGAGG - Intronic
1144475850 17:15588733-15588755 CAGATCAGTGCTGCCTCTACTGG + Exonic
1147113973 17:38284966-38284988 TCCATAAGGGCTGCCTAAAGGGG - Intergenic
1148229171 17:45920504-45920526 CCCAGCATTGCTGCCTCAAGGGG + Intronic
1148415631 17:47504225-47504247 TCCATAAGGGCTGCCTAAAGGGG + Intergenic
1149425916 17:56554495-56554517 CTCATTAGCACTGCCTAAAGGGG + Intergenic
1152555774 17:81052485-81052507 CACCTCAGTCCTGCCTATACTGG - Intronic
1153560457 18:6367446-6367468 CACATCAGTGCTGCCTCCTCAGG + Intronic
1161747906 19:6072775-6072797 CTCTTCAGTGCTGCCTACGGAGG + Intronic
927679570 2:25131021-25131043 TAGTCCAGTGCTGCCTAAAGTGG - Intronic
929979852 2:46668121-46668143 CACAGCAGAGCTGCCATAAGCGG - Intergenic
931436913 2:62255606-62255628 CAGATCTGAGCTGCCTAAAAAGG - Intergenic
935292543 2:101622364-101622386 CACATCAGCGCTATCAAAAGTGG - Intergenic
936469470 2:112786003-112786025 CATTTCTGTGTTGCCTAAAGAGG - Intergenic
942838504 2:180330993-180331015 CACAACAGTACTGCATAAAAAGG + Intergenic
944146593 2:196513765-196513787 CACACCAGTGGTGCTCAAAGAGG + Intronic
946709375 2:222490730-222490752 CACATAACTGCTGGGTAAAGTGG - Intronic
946883891 2:224203771-224203793 CACATCTGTGCTGTCTAATATGG - Intergenic
947170013 2:227301379-227301401 CTCATCAGTGATGCGTAATGAGG + Intronic
947440726 2:230118744-230118766 CACATAGGTGAGGCCTAAAGTGG - Intergenic
947935415 2:233999549-233999571 CAGCTCAGTGATGCCTAGAGTGG - Intronic
948495596 2:238346514-238346536 CTCATAAATGCTGCCTTAAGAGG - Intronic
948921530 2:241068134-241068156 CTCATCAGGGCTGCCAAGAGAGG + Intronic
1170045748 20:12083568-12083590 CACAACAGTGCTCCTTACAGAGG - Intergenic
1170747594 20:19114363-19114385 CAAATGAGTCCTGTCTAAAGAGG + Intergenic
1172054718 20:32146224-32146246 CACTACAGTGCTGCCTAGAGAGG + Intronic
1173014893 20:39216099-39216121 CACATCCGTGATACCTTAAGTGG + Intergenic
1175328587 20:58147248-58147270 CCCAACAGTGCTGCCAAAAGGGG + Intergenic
1178387862 21:32169406-32169428 AACATCACAGCTGCCTCAAGTGG + Intergenic
1179315464 21:40240151-40240173 TAGATCGGTGCTGCCCAAAGTGG - Intronic
1179436267 21:41364161-41364183 CACCTCAGTGCTGCCTAAGCTGG + Intronic
1179982855 21:44905582-44905604 TACATCAGAGCTGCCTCCAGGGG + Intronic
1184407781 22:44309643-44309665 CACACAAGTGCTGCCTGCAGGGG - Intronic
950228586 3:11256393-11256415 AAAATCAGTGCTGCCCAAAATGG + Intronic
950271513 3:11619778-11619800 AACATCTTTGCTGCCTAGAGGGG - Intronic
954124854 3:48522182-48522204 CTCCCCAGAGCTGCCTAAAGTGG - Intronic
957348763 3:78995956-78995978 AACATGGGGGCTGCCTAAAGGGG + Intronic
961392009 3:126557857-126557879 TACACCAGTGCTGGCTAAAGGGG + Intronic
961744840 3:129058058-129058080 CACTTTAGGTCTGCCTAAAGTGG - Intergenic
964426482 3:156559672-156559694 CACATCAGTGTTTCCTAAAAAGG - Intergenic
964875380 3:161361248-161361270 AAAATCAGAGCTGTCTAAAGGGG + Intronic
964893663 3:161567741-161567763 CACACCAGTGCTGGCTACTGAGG - Intergenic
965539409 3:169857507-169857529 AACAGCCGTGCTGCCTTAAGGGG + Intronic
973764148 4:54148593-54148615 AACTCCAGTGCTGCCTTAAGAGG - Intronic
974509534 4:62820424-62820446 CACATCAGAGCTTTCTAAAATGG - Intergenic
974902372 4:68016948-68016970 CAGTTCAGTGATGCCTGAAGAGG - Intergenic
975241734 4:72067241-72067263 CACTTCAGCGGTGGCTAAAGTGG - Intronic
977911391 4:102541224-102541246 CACATCAGTGGTTCTCAAAGAGG - Intronic
980549437 4:134314989-134315011 CACTTCACAGCTGCTTAAAGAGG + Intergenic
980668464 4:135971551-135971573 CACATCAGTACTGCTAGAAGGGG - Intergenic
982142347 4:152337801-152337823 CATTTCATTGCTCCCTAAAGAGG - Exonic
982833526 4:160092877-160092899 TACATCAGGGCTGTCTAAAATGG + Intergenic
983191003 4:164753325-164753347 GACATCAGTGCTGCAACAAGTGG + Intergenic
983625915 4:169801818-169801840 CACATTGGTTCAGCCTAAAGAGG + Intergenic
984881428 4:184413073-184413095 CAGATAAGAGCGGCCTAAAGAGG - Intronic
985009000 4:185563192-185563214 CACATTTGTTCAGCCTAAAGAGG + Intergenic
988987443 5:36634482-36634504 CAGATCAGTGCTTTCCAAAGTGG - Intronic
991448780 5:66729570-66729592 CACATCAATGCTGCATATTGAGG + Intronic
992161003 5:74001644-74001666 CATATCAGTGCTCCCCAAATTGG - Intergenic
995655112 5:114417639-114417661 CACATCAAACCTGCCTAATGTGG - Intronic
996595176 5:125192590-125192612 CAGATCAGTGCTCCTTAAACTGG - Intergenic
998066067 5:139159968-139159990 CACTTCTGTGATGCCTAATGAGG - Intronic
998752472 5:145338202-145338224 CACAACAGTGGTGTCTAATGGGG - Intergenic
999360612 5:150983060-150983082 CACATCAATAATCCCTAAAGGGG + Intergenic
999642678 5:153687656-153687678 TACATCTGTGCTGCCTGATGTGG - Intronic
1002570131 5:180135504-180135526 TACACCAGTGCTGCCCACAGTGG + Intronic
1003434579 6:6074138-6074160 TACCTCAGTGCTTCCTCAAGTGG - Intergenic
1005470504 6:26157889-26157911 CACAGCTGTCTTGCCTAAAGAGG + Intergenic
1009558615 6:65208773-65208795 GACACCAGTGATGCCCAAAGTGG + Intronic
1010836103 6:80588921-80588943 CACATCTATGCTGGCTGAAGTGG - Intergenic
1010856244 6:80844061-80844083 GAGATCAGTGCTGCCTATATAGG + Intergenic
1011133915 6:84079371-84079393 CAGAGCAGTGTTACCTAAAGGGG + Intronic
1012120741 6:95363705-95363727 AACATCACAGCTGCCTAATGTGG + Intergenic
1013485088 6:110589217-110589239 CATATCTGTGCTGCCCAAAGTGG + Intergenic
1016475549 6:144423078-144423100 CACATCTGTGCAGAATAAAGAGG + Intronic
1021427991 7:20524901-20524923 CACAGCAGTGTTTCCCAAAGTGG + Intergenic
1022280071 7:28899300-28899322 CATATGAATGCTGCCTAAATGGG + Intergenic
1024265564 7:47603747-47603769 CCCATCAGTGCTCCGTAAAATGG + Intergenic
1028464813 7:91139119-91139141 TTCATCAGTGCTCCCTCAAGAGG + Intronic
1031595583 7:123646311-123646333 TACATTAGTTCAGCCTAAAGAGG + Intergenic
1036757904 8:11483506-11483528 CATCTCAGTGCTGCCAAATGAGG + Intergenic
1038288019 8:26223433-26223455 CAAATCAGAGATGCCTCAAGAGG + Intergenic
1041667003 8:60455516-60455538 CAGAGCAGGGCTGCCTAATGTGG - Intergenic
1044064370 8:87681668-87681690 CACATTACTGCTGCACAAAGAGG + Intergenic
1045742400 8:105376783-105376805 CAGATTATTGCTGCCTAATGTGG + Intronic
1045923198 8:107556691-107556713 AACATCACAGCTGCCTAATGTGG - Intergenic
1050836833 9:10092405-10092427 CACATCAGTGATGCTTTTAGAGG - Intronic
1051618929 9:19032681-19032703 CACATCAGTTCTGGCGAATGTGG - Intronic
1061334281 9:129920827-129920849 CACATGAGTGCTTGGTAAAGCGG + Intronic
1062168538 9:135121505-135121527 CATGCCAGTGCTGACTAAAGTGG - Intergenic
1062506030 9:136877005-136877027 CACAGCAGGGCTGCCTACTGGGG - Intronic
1062590754 9:137273453-137273475 CCCAGCAGTGCTGCCTTCAGCGG + Exonic
1187616921 X:21005889-21005911 CATATCTGTGCTGTCTAAAACGG + Intergenic
1189955413 X:46272490-46272512 AACATCACAGCTGCCTAAGGTGG + Intergenic
1192708639 X:73556150-73556172 TACATTAGTACAGCCTAAAGAGG + Intergenic
1193286956 X:79724556-79724578 CCCCTCTGTGCTGCCTACAGGGG + Intergenic
1194770390 X:97896761-97896783 CACATCAGTGATTCCTATAGAGG + Intergenic
1199508010 X:148587993-148588015 CACACCTATGCTCCCTAAAGAGG - Intronic
1199671186 X:150149608-150149630 CCCATAAGTGCTTCCTAAAGTGG - Intergenic