ID: 1142986035

View in Genome Browser
Species Human (GRCh38)
Location 17:3695837-3695859
Sequence CCCGCCTTCCCAAAAGTCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142986025_1142986035 -7 Left 1142986025 17:3695821-3695843 CCCGCCCTGCCCCTCCCCCGCCT 0: 1
1: 3
2: 34
3: 452
4: 3264
Right 1142986035 17:3695837-3695859 CCCGCCTTCCCAAAAGTCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1142986022_1142986035 20 Left 1142986022 17:3695794-3695816 CCCTGGAGAAGGACGCGGCGGCT 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1142986035 17:3695837-3695859 CCCGCCTTCCCAAAAGTCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1142986023_1142986035 19 Left 1142986023 17:3695795-3695817 CCTGGAGAAGGACGCGGCGGCTG 0: 1
1: 0
2: 2
3: 17
4: 186
Right 1142986035 17:3695837-3695859 CCCGCCTTCCCAAAAGTCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1142986026_1142986035 -8 Left 1142986026 17:3695822-3695844 CCGCCCTGCCCCTCCCCCGCCTT 0: 1
1: 0
2: 19
3: 351
4: 3026
Right 1142986035 17:3695837-3695859 CCCGCCTTCCCAAAAGTCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 101
1142986019_1142986035 26 Left 1142986019 17:3695788-3695810 CCAGGACCCTGGAGAAGGACGCG 0: 1
1: 0
2: 1
3: 15
4: 184
Right 1142986035 17:3695837-3695859 CCCGCCTTCCCAAAAGTCCGCGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142986035 Original CRISPR CCCGCCTTCCCAAAAGTCCG CGG Intronic
906295355 1:44646046-44646068 CCTGCCTTCCCAGAAGCCCAAGG + Intronic
907006816 1:50922565-50922587 CTCGGCTTCCCAAAAGTGCTGGG - Intronic
907150816 1:52285779-52285801 CTCCCCTTCCCCACAGTCCGTGG + Intronic
911102357 1:94104714-94104736 CCAGCTTTCCCCAAAGTCCTTGG - Intronic
913158172 1:116120788-116120810 CCTGCCTTCCCAAGATGCCGGGG - Intronic
915264302 1:154705019-154705041 CTCGCCTTGCCCAAAGTCCTGGG + Exonic
924437032 1:244050227-244050249 CTCGCCCTCCCAAGAGTCTGAGG + Intronic
1064215543 10:13397331-13397353 CCCCCCTTCCCACAAGCCTGTGG + Intergenic
1067530420 10:47067177-47067199 TCCGCCCTCCCAAAAGTGCTGGG + Intergenic
1069383169 10:67861082-67861104 CTCGGCTTCCCAAAAGTGCTGGG - Intergenic
1072926423 10:99620680-99620702 CCCGCCCTTCTAAAAGTCAGAGG - Intergenic
1075399515 10:122150886-122150908 GCCACCTTCCGAATAGTCCGTGG - Intronic
1084465475 11:69320644-69320666 CCTGCCTCCCCAAAAGTCTTAGG + Intronic
1090386510 11:126360288-126360310 CTCGCCTGCCCAGAACTCCGCGG - Intronic
1094532722 12:31292248-31292270 CTCGGCTTCCCAAAAGTGCTGGG - Intronic
1096458489 12:51807204-51807226 CCCGCCTTGCCAAATGTCCCCGG - Exonic
1100584130 12:95963777-95963799 CTCGGCTTCCCAAAAGTACTGGG - Intronic
1104013377 12:124947441-124947463 CCCGCCCTGCCAGAAGGCCGAGG - Exonic
1118054001 14:62059056-62059078 TCCACCTTCCCAAAGGTCCCAGG - Intronic
1122599626 14:102914849-102914871 GCCGCCTTCCCCAAGGTCCAAGG - Intergenic
1133616977 16:7486385-7486407 CCCGGCTTCCCAAAAGTGCTGGG + Intronic
1133915591 16:10106705-10106727 GCCAACTTCCCCAAAGTCCGTGG - Intronic
1136220298 16:28823795-28823817 CCCGCCTCCCCTGAAGGCCGGGG - Intronic
1140404709 16:74700948-74700970 CCTGCCTTCCCCAAAGTCACTGG + Intronic
1141612839 16:85192856-85192878 CCCTTCTTCCCAAAAGGGCGAGG - Intergenic
1142986035 17:3695837-3695859 CCCGCCTTCCCAAAAGTCCGCGG + Intronic
1143233327 17:5376090-5376112 CTCGGCTTCCCAAAAGTGCTGGG + Intronic
1144668356 17:17117129-17117151 CCCTCCTTCCCAAACATTCGAGG + Intronic
1144931746 17:18864698-18864720 CCAGCCTTCCCAGAGGTCCCAGG + Intronic
1152675236 17:81636835-81636857 CCCGCCTCCCCCACAGGCCGAGG + Intronic
1152811430 17:82384534-82384556 CCCGCCTTCCCAATAGAGCGTGG + Intergenic
1153862291 18:9225220-9225242 CTCGACTTCCCAAAAGTGCTGGG - Intronic
1156054574 18:32983910-32983932 CCTGCCTTGCCAAAAATCTGTGG - Intronic
1161612891 19:5253133-5253155 CCCACCTTGTCAAAAGTCGGAGG + Intronic
1162456341 19:10787216-10787238 CTCGGCCTCCCAAAAGTACGGGG - Intronic
1162781878 19:13010886-13010908 CCCGCCTCCCCATATGTCCCTGG + Intronic
1163124117 19:15235255-15235277 CCCGGCCTCCCAAAAGTGCTGGG + Intergenic
1166808226 19:45499466-45499488 CCCTCCTCCCCAAAACCCCGAGG - Intronic
1167567584 19:50266737-50266759 CCCGCCTTGGCAACAGTCCCTGG - Intronic
926430939 2:12785261-12785283 CATGACTTCCCAACAGTCCGCGG + Intergenic
942528510 2:176882416-176882438 CCCAACTTCCCAACAGGCCGTGG - Intergenic
1169271986 20:4207622-4207644 CCCTGCTTCCCAAAAATTCGTGG - Intergenic
1176553932 21:8244785-8244807 CTCGGCCTCCCAAAAGTGCGGGG + Intergenic
1176572854 21:8427809-8427831 CTCGGCCTCCCAAAAGTGCGGGG + Intergenic
1179174790 21:39000585-39000607 CCCTACTTCCCAAGAGTTCGAGG - Intergenic
1180609371 22:17085526-17085548 CCCTCCTTCCCCGAACTCCGCGG - Intronic
1180765926 22:18345859-18345881 CCCGCCTTTCCTGGAGTCCGAGG - Intergenic
1180780387 22:18516519-18516541 CCCGCCTTTCCTGGAGTCCGAGG + Exonic
1180813103 22:18773840-18773862 CCCGCCTTTCCTGGAGTCCGAGG + Intergenic
1180841305 22:18960122-18960144 CCAGCCTCCCCACAAGTCCTGGG - Intergenic
1181060193 22:20278672-20278694 CCAGCCTCCCCACAAGTCCTGGG + Intronic
1181199280 22:21208156-21208178 CCCGCCTTTCCTGGAGTCCGAGG + Exonic
1181400481 22:22647701-22647723 CCCGCCTTTCCTGGAGTCCGAGG - Exonic
1181648888 22:24248090-24248112 CCCGCCTTTCCTGGAGTCCGAGG + Intergenic
1181702460 22:24628799-24628821 CCCGCCTTTCCTGGAGTCCGAGG - Exonic
1182839739 22:33379132-33379154 CCTGCCTTCCCAGAGGTCCATGG + Intronic
1203227545 22_KI270731v1_random:86750-86772 CCCGCCTTTCCTGGAGTCCGAGG - Intergenic
1203258936 22_KI270733v1_random:161823-161845 CTCGGCCTCCCAAAAGTGCGGGG + Intergenic
952054855 3:29432055-29432077 CCTGCCTTCCCAAAAATAAGGGG + Intronic
955034533 3:55253713-55253735 CACCCCTTCCCAAAAGCCCGTGG + Intergenic
961793808 3:129395143-129395165 CTCGCCCTCCCAAAAGTGCTGGG + Intergenic
967414287 3:189199587-189199609 CTCGGCTTCCCAAAAGTGCTGGG - Intronic
972649680 4:41004588-41004610 CCCGCCTTGCCCAAAGTGCTGGG - Intronic
973075039 4:45914284-45914306 TCCGCCTTCCCATCAGGCCGTGG + Intergenic
976597090 4:86904641-86904663 CCCGCCTACTCAAAAGGCTGAGG + Intronic
976600720 4:86935303-86935325 CTCGGCTTCCGAGAAGTCCGCGG - Intronic
978287436 4:107095255-107095277 TCTGCCTGCTCAAAAGTCCGTGG + Intronic
978753564 4:112279917-112279939 CTCGCCCTCCCAAAAGTGCTGGG + Intronic
981548322 4:145916852-145916874 TCTGCCTTCCTAAAAGCCCGAGG + Intronic
984123171 4:175771320-175771342 CTCGGCCTCCCAAAAGTCCTGGG - Intronic
987458997 5:18184099-18184121 CCCGCCCCCCCAACAGTCCCTGG + Intergenic
992507249 5:77398920-77398942 CACACCTACCCCAAAGTCCGAGG + Intronic
995748961 5:115433977-115433999 CCAGCCTTGCCTAAAGTCCCTGG - Intergenic
1003114239 6:3272897-3272919 CCTGTCTTTCCAAAAGTCCAAGG - Exonic
1006053374 6:31361147-31361169 CCCGACTCCCCAAAAGGCCCTGG - Intergenic
1006776416 6:36596171-36596193 CTCGGCTTCCCAAAAGTTCTGGG + Intronic
1006834232 6:36986794-36986816 CACGCCTTCCTCAGAGTCCGTGG + Intergenic
1007556912 6:42773764-42773786 CTCGGCTTCCCAAAAGTGCTGGG + Intronic
1012831140 6:104204700-104204722 CCCTCCTTCCAAAAAGTCAGGGG + Intergenic
1016860035 6:148708300-148708322 CCAGCATTCCCAAAATTCTGTGG + Intergenic
1018456966 6:163961733-163961755 ACCACCTTCCCAAAATTCAGTGG + Intergenic
1019693538 7:2431710-2431732 CCTGGCTTCCCAAAAGTAAGTGG - Intronic
1019859777 7:3646937-3646959 CCCTCCTTCCCCCAAGTCCCTGG - Intronic
1020924697 7:14310880-14310902 CCCACCTTCCCCAAAGTGCTGGG - Intronic
1027375433 7:77543672-77543694 CCCGCCTTCCCATAAGCCCCAGG + Intronic
1029286808 7:99471452-99471474 CCCGACTCCCCAAAAGGCCCAGG - Intergenic
1031504083 7:122559518-122559540 CTCGGCTTCCCAAAAGTGCTGGG - Intronic
1032019024 7:128396430-128396452 CCTGCCTTCCCCTAAGTCAGTGG + Intronic
1032062809 7:128739129-128739151 CCCGCCGTCCCAACAATCCCGGG + Intergenic
1034498748 7:151436899-151436921 CCCGCATTTCCAAAAGACAGAGG + Intronic
1036586943 8:10133163-10133185 ACCGCCTTCCCCACAGTCCGTGG - Intronic
1039940761 8:42088632-42088654 CTCGGCTTCCCAAAAGTGCTGGG + Intergenic
1044606197 8:94050193-94050215 CCCCCCTCCCCAACAGTCCCTGG + Intergenic
1048181861 8:132202596-132202618 TCTGCCTTCCCTAAAGTCCTAGG + Intronic
1048371203 8:133777910-133777932 CCAGCCATCCCAATAGTCCCTGG - Intergenic
1049236272 8:141513928-141513950 CCCGCCTGCCCAAACAGCCGTGG - Intergenic
1057084312 9:92194641-92194663 CTTGCCTTCCCAAAAGTACTGGG - Intergenic
1057290049 9:93800683-93800705 CACACCTTCCCCAAAGTCAGAGG + Intergenic
1057793203 9:98137651-98137673 CCCCACTACCCAAAAGTCTGCGG - Exonic
1060914777 9:127381126-127381148 CTCGGCTTCCCAAAAGTGCTGGG + Intronic
1061611701 9:131750965-131750987 CCCAGCTACCCAAAAGCCCGAGG - Intergenic
1061646163 9:132003746-132003768 CCCCCCTTCCCAAAAGTACTGGG - Intronic
1062057737 9:134477241-134477263 CCCGCCTTCCCAAGAGTGATCGG - Intergenic
1203475128 Un_GL000220v1:143832-143854 CTCGGCCTCCCAAAAGTGCGGGG + Intergenic
1185653096 X:1662954-1662976 CCCGGCCTCCCAAAAGTGCTGGG + Intergenic
1186745835 X:12567652-12567674 CCCTCTTTCCCCAAAGTCCTTGG - Intronic
1186981721 X:14964205-14964227 CTCACCTTCCCAGAAGTCTGTGG - Intergenic
1195475582 X:105281260-105281282 CCCTACTCCCCAAAAGTCCCCGG - Intronic
1197263179 X:124337632-124337654 CCCATCTTCCCAAAATTCCAAGG - Intronic
1197654827 X:129105618-129105640 CCCGCCTTCCCCCCAGTCCATGG - Intergenic