ID: 1142993469

View in Genome Browser
Species Human (GRCh38)
Location 17:3747193-3747215
Sequence CCGGAGGCACATAGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142993457_1142993469 4 Left 1142993457 17:3747166-3747188 CCAACAGGTGATCCAATCCCACC 0: 1
1: 0
2: 1
3: 6
4: 124
Right 1142993469 17:3747193-3747215 CCGGAGGCACATAGTGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 148
1142993456_1142993469 7 Left 1142993456 17:3747163-3747185 CCTCCAACAGGTGATCCAATCCC 0: 1
1: 0
2: 0
3: 4
4: 114
Right 1142993469 17:3747193-3747215 CCGGAGGCACATAGTGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 148
1142993462_1142993469 -8 Left 1142993462 17:3747178-3747200 CCAATCCCACCTGGGCCGGAGGC 0: 1
1: 0
2: 0
3: 14
4: 161
Right 1142993469 17:3747193-3747215 CCGGAGGCACATAGTGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 148
1142993455_1142993469 12 Left 1142993455 17:3747158-3747180 CCAGGCCTCCAACAGGTGATCCA 0: 1
1: 0
2: 1
3: 18
4: 192
Right 1142993469 17:3747193-3747215 CCGGAGGCACATAGTGAGGAGGG 0: 1
1: 0
2: 0
3: 9
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142993469 Original CRISPR CCGGAGGCACATAGTGAGGA GGG Intronic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
903277731 1:22232581-22232603 CCAGGGTCACATAGTAAGGAAGG - Intergenic
904120770 1:28196293-28196315 CCTGAGCAACATAGTGAGGCAGG + Intergenic
906534341 1:46543497-46543519 CCCAAGGCCCAAAGTGAGGAGGG - Intergenic
906794609 1:48687196-48687218 CCGCAGGCACACAGAGAGCAAGG + Intronic
911063885 1:93770526-93770548 CCTGAGGGACATAGTCAGAAAGG - Intronic
913609074 1:120493042-120493064 CAGGAGCCACATAGTGAGTTGGG - Intergenic
914582117 1:149028797-149028819 CAGGAGCCACATAGTGAGTTGGG + Intronic
915917783 1:159951443-159951465 CCAGAGCCACCCAGTGAGGACGG + Intergenic
917478043 1:175385759-175385781 CCTGAGGCCCATAGTGGGGAAGG + Intronic
918278912 1:182983633-182983655 CCGGAGGTAGAGAGTGATGATGG - Intergenic
919526662 1:198661887-198661909 CCGGAGGTAGGTAGTGGGGAAGG - Intronic
924466609 1:244304246-244304268 CCGGAGGCAGAGAGTCTGGAGGG - Intergenic
1062960447 10:1569411-1569433 CAGGAGGCATGTAGAGAGGATGG + Intronic
1064107567 10:12512976-12512998 CTGGAGGAACACAGTGGGGATGG + Intronic
1067414943 10:46095751-46095773 CTGCAGGCACACAGTGGGGAGGG + Intergenic
1070849466 10:79551881-79551903 CGGGAAGCACACAGTGAGGAGGG - Intergenic
1073328448 10:102656161-102656183 CCGGGGGCACATCCTGGGGAGGG + Intronic
1080083121 11:28245191-28245213 CCAGAGTCACACAGTGAGTAAGG - Intronic
1083855261 11:65390080-65390102 CCTGAGGCTCTTAGTGAGGGTGG + Intronic
1083878150 11:65535544-65535566 CCGAAGTCACACAGTCAGGAGGG + Intronic
1084719441 11:70894822-70894844 CCAGGGGCACACAGTGAAGAAGG - Intronic
1091544311 12:1490896-1490918 GCCGAGGAACAGAGTGAGGAAGG - Exonic
1098430968 12:70419797-70419819 AAGGAGGCACTTAGGGAGGATGG + Intronic
1101619090 12:106366058-106366080 CCGGAGGCTCTTCTTGAGGAGGG + Intronic
1102913420 12:116736257-116736279 CCTGAGTCAGATAGAGAGGAAGG + Intronic
1103241162 12:119414342-119414364 AGGGAGACACACAGTGAGGATGG - Intronic
1104484069 12:129134410-129134432 CCTGAGCCACAAAGTGAGCAGGG - Intronic
1106422962 13:29598742-29598764 ACTGAGGCACAGAGTGAGCAGGG - Intergenic
1109042669 13:57359540-57359562 CCAGAGGTTCATAGTGGGGAAGG + Intergenic
1112007220 13:95264472-95264494 CCGGAGGCACACAGTGGTGATGG - Intronic
1112498503 13:99924339-99924361 CTGGAAACAGATAGTGAGGATGG + Intergenic
1112552038 13:100430483-100430505 CTGGAGGAACACAGAGAGGATGG - Intronic
1113364231 13:109661595-109661617 ACAGAGGAACATAGTGAGCAAGG + Intergenic
1114216881 14:20663794-20663816 GCGGAGGCACATCGGGAGAAGGG - Intergenic
1115762737 14:36591445-36591467 ACGGAGGCACAGAGGGAGGTTGG + Intergenic
1119608766 14:76044137-76044159 GCTGAGGCACATAGGGCGGAAGG - Intronic
1121310763 14:92933894-92933916 CCTGAGGCATATGGAGAGGATGG + Intronic
1202869295 14_GL000225v1_random:145365-145387 CCAGAGGTACATAGAGAGGGTGG + Intergenic
1125486174 15:40112375-40112397 ACGGAGGCTGATAGGGAGGAGGG + Intergenic
1125591072 15:40854737-40854759 CTGGATGGAAATAGTGAGGATGG - Intronic
1126097531 15:45100098-45100120 CCGGAGGCACATCGTGTGTGTGG - Exonic
1127642782 15:60931226-60931248 ACGGAGGCACATTGGGAGGTAGG + Intronic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1129689755 15:77706464-77706486 CCTGAGGCCAATAGTGAGGAGGG - Intronic
1129851309 15:78795484-78795506 CCTGAGGCTCAAAGAGAGGAAGG - Intronic
1129935951 15:79450394-79450416 TAAGAGTCACATAGTGAGGAGGG + Intronic
1132992885 16:2806209-2806231 CCGGAGGCTAATGGTGAGCAGGG - Intergenic
1134609317 16:15595524-15595546 CCTCAGGCACCTAGAGAGGAAGG + Exonic
1134691905 16:16196591-16196613 CAGGAGGCACAGAGAGAGTAGGG + Intronic
1135728977 16:24878693-24878715 CCAGAGGAACTTATTGAGGATGG + Intronic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138459504 16:57139825-57139847 CCCAAGTCACACAGTGAGGAAGG - Intronic
1138776372 16:59728953-59728975 CCAGAGGTCCATAGTGAGAATGG - Intronic
1142894237 17:2964047-2964069 CCGGAGGCACTTCCTGGGGAAGG + Exonic
1142993469 17:3747193-3747215 CCGGAGGCACATAGTGAGGAGGG + Intronic
1143161787 17:4876714-4876736 GCGGAGGCAGAAAGTGAGGATGG - Intronic
1143434096 17:6909716-6909738 CTGGAGGCCCATGGTGAGGGTGG + Intronic
1146499751 17:33354315-33354337 CAGGGGGCTCATAGTGGGGATGG - Intronic
1147322981 17:39657115-39657137 CCGGAGGCAGAGAGGGAGCAGGG + Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1157429788 18:47615266-47615288 CCTGAGGCACAGAGGGAGCAAGG + Intergenic
1160361984 18:78291099-78291121 CTGGAGATACATAGTGATGATGG - Intergenic
1162976493 19:14209500-14209522 CAGGAGGCAAAGAGTGCGGAGGG + Intergenic
1167517164 19:49930071-49930093 TCGGAAGCACATTGTGAGAAGGG + Intronic
1167606753 19:50485394-50485416 CCTGAGGCACATCCTGGGGAAGG - Exonic
1168499331 19:56880169-56880191 CTGGAGGCAGATGGTGATGATGG + Intergenic
925930837 2:8706490-8706512 CTGGAGGCACACAGGCAGGAAGG - Intergenic
927865736 2:26586111-26586133 CCGGGGGCAGAGAGAGAGGAGGG - Intronic
932224423 2:70028503-70028525 CCAGAGGCACCCAGAGAGGAAGG - Intergenic
933503521 2:83147173-83147195 CTGGAGTCACATAGTGAAGCAGG + Intergenic
940716679 2:157233769-157233791 CTGTAGGCACAAAGTGATGATGG - Intergenic
940857450 2:158740460-158740482 CCTGAGGCACTTTCTGAGGAGGG + Intergenic
943580059 2:189674357-189674379 GCAGAGGCAGATAGTGAGGGCGG + Intronic
945593166 2:211759468-211759490 CCGGAGGAAAATACTGAGGCAGG - Intronic
946136383 2:217651118-217651140 CCAGAGGAAGATAATGAGGATGG - Intronic
948187804 2:236035037-236035059 CTGCAGGCGCATTGTGAGGAAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1170671770 20:18440766-18440788 CAGGAGGCACAGAGTGACAAGGG + Intronic
1171391654 20:24805333-24805355 CAGGGGGCACATAGTGAGAGAGG + Intergenic
1172183005 20:33015005-33015027 ACGGAGGCCCAGAGTCAGGAAGG + Intronic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1173234212 20:41228994-41229016 CTGGAGGCAGATGGTGATGATGG - Intronic
1173681667 20:44886182-44886204 CCCGAAGCAGATAGTGAGGGAGG - Intronic
1174161270 20:48552358-48552380 GCGGAGACACATCGTGAGGAAGG - Intergenic
1179249896 21:39663972-39663994 CCGCAGGCACCCAGAGAGGAAGG + Exonic
1180153154 21:45962780-45962802 CAGGAGGCAGATAATGGGGAGGG - Intergenic
1181094512 22:20496183-20496205 GGGGAGGGAGATAGTGAGGAAGG - Intronic
1183173601 22:36205602-36205624 CCCGAGGCACACAGGGTGGAGGG + Intergenic
1183179760 22:36252230-36252252 CCCGAGGCACACAGGGTGGAGGG - Intergenic
1183947191 22:41333105-41333127 ACTGAGGCACAGAGTGGGGAGGG + Intronic
1184499356 22:44862443-44862465 CCGGAGGCACCTGGGGAGCACGG + Exonic
1185271368 22:49930668-49930690 ACGCAGGCACACACTGAGGATGG + Intergenic
1185296636 22:50058069-50058091 CCGAAGGCAGATGGGGAGGAGGG + Intergenic
950451253 3:13067066-13067088 CCAGGGTCACATAGTGAGGCAGG + Intronic
950681997 3:14591888-14591910 CAGGAGGCACATCAAGAGGAAGG + Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
952387408 3:32852234-32852256 CCGGAGGCACATCCTGGAGAAGG + Intronic
952824178 3:37511057-37511079 CCAGAGTCACATAGACAGGAGGG + Intronic
953136141 3:40183294-40183316 CCTGAGGGACATCCTGAGGAAGG + Intronic
954259179 3:49426286-49426308 CCTGACCCACACAGTGAGGAGGG - Exonic
954958288 3:54541336-54541358 ACAGAGGCACATAGAGAAGATGG + Intronic
960452409 3:117826550-117826572 AGGGAGGGACATAGGGAGGAAGG + Intergenic
961356025 3:126340604-126340626 CCTAAGGCACACAGAGAGGAAGG - Intergenic
965604678 3:170486176-170486198 CCAGGGCCACATCGTGAGGAGGG + Intronic
965781399 3:172289741-172289763 GCGGAGGCACATCCTGAGGCTGG - Intronic
967131173 3:186471966-186471988 CAGGTGGCACATGGGGAGGAGGG - Intergenic
967283371 3:187844054-187844076 CCAGAGGCTCATTGTCAGGAAGG + Intergenic
967807544 3:193728999-193729021 CCGGGTGCACTCAGTGAGGAAGG - Intergenic
969058173 4:4414877-4414899 GCTGAGGCATATCGTGAGGAGGG + Intronic
969858424 4:10018127-10018149 CCAGAGGCACAATGTGAAGAGGG + Intronic
979206628 4:118046211-118046233 CCATAGGCACATGGTGAGGGTGG - Intronic
981281997 4:142969188-142969210 CTGTAGGCAAATTGTGAGGAGGG + Intergenic
983857774 4:172666914-172666936 CAGGAGGCAGATTCTGAGGAGGG + Intronic
984285503 4:177723444-177723466 CCGTAGCCATAGAGTGAGGATGG - Intergenic
988682157 5:33494154-33494176 CCTGAGGCAGAAAGTCAGGAGGG + Intergenic
990274947 5:54185269-54185291 CCAGAGGAAAATAGTGAGGAAGG - Intronic
990550312 5:56869373-56869395 CTGGAGACACATAGTGGTGATGG + Intronic
995845266 5:116487298-116487320 CCAGAGGCAGCTAGTGAGGATGG - Intronic
996710466 5:126538192-126538214 CCGGAGGAAGAAAGTGAGGGGGG - Intergenic
997532300 5:134589253-134589275 TAGGAGGCACAGAGTCAGGACGG + Intergenic
999517801 5:152318511-152318533 CCAGAGACACATAGAGAGAAGGG - Intergenic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1003848235 6:10196194-10196216 CCGCAGGCAGAGAGTGAGGAAGG - Intronic
1005989852 6:30896085-30896107 ACAGAGGCACACAGAGAGGAGGG - Intronic
1009344869 6:62600913-62600935 CAGAAGCCACATAGTGAGAAAGG - Intergenic
1013224705 6:108112451-108112473 ACGGAGGCACATAGTGATTGTGG + Intronic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1021043517 7:15892740-15892762 TGGGAGGCACATGGTGAGAATGG + Intergenic
1028651512 7:93155341-93155363 CCAGAGACCCACAGTGAGGAAGG + Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029413980 7:100431534-100431556 CCGGGGGCAGAGGGTGAGGAAGG + Exonic
1031654053 7:124329623-124329645 CCAGAGACATACAGTGAGGAAGG + Intergenic
1034626836 7:152499987-152500009 CTGGGGGCAAATTGTGAGGAAGG - Intergenic
1036502824 8:9329157-9329179 CGGGAGGCCCATAGGTAGGAAGG + Intergenic
1037131950 8:15417180-15417202 CAGGAGGAAGATAGTGAAGAGGG - Intergenic
1037940213 8:22945590-22945612 CTGGAGGCAGAGAGTGGGGATGG - Intronic
1038426559 8:27467821-27467843 CCAGAGGCATACAGTGAGGCAGG + Intronic
1038577020 8:28713538-28713560 CCTGAAACACATGGTGAGGAAGG + Exonic
1039608820 8:38902932-38902954 CAGGCGGCACATGGTGAAGAGGG - Intronic
1043927472 8:86053474-86053496 CCTGGGGCTCATGGTGAGGAGGG - Intronic
1046791619 8:118328244-118328266 GCAGAAGCACATAGTAAGGAAGG - Intronic
1046895004 8:119463139-119463161 CCAGAGGCCCATGGTGAGAATGG - Intergenic
1051343742 9:16134022-16134044 CCGCAGGCACTAAGTGAGCACGG + Intergenic
1053274227 9:36771146-36771168 CAGGGGGCACATGGTGGGGAAGG - Intergenic
1057350502 9:94293215-94293237 GGGGAGGCACACAGTGTGGAAGG - Intronic
1057396316 9:94683606-94683628 CCACAGCCACATAGTCAGGAGGG - Intergenic
1057733697 9:97633581-97633603 CCGGAAGGACATAGAGCGGAAGG + Intergenic
1060269755 9:122132097-122132119 ACGGAGGCTCAGAGAGAGGAAGG - Intergenic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061670224 9:132184384-132184406 CCTGAAGCACACAGTGGGGAGGG + Intronic
1203735577 Un_GL000216v2:135777-135799 CCAGAGGTACATAGAGAGGGTGG - Intergenic
1189607405 X:42694631-42694653 CCTGAGGCCCTGAGTGAGGATGG + Intergenic
1189857640 X:45239284-45239306 GCTGTGGCACATAGTGGGGAGGG + Intergenic
1192118058 X:68430210-68430232 CCGCTGGCACAGTGTGAGGAAGG + Intronic
1197829412 X:130626039-130626061 GCCAAGGCTCATAGTGAGGAGGG - Intronic
1200137971 X:153884068-153884090 AGGGAGGCAAAGAGTGAGGAAGG - Intronic
1200247158 X:154532309-154532331 CCGGTGGCACACAGGGAGGGAGG + Intronic