ID: 1142994617

View in Genome Browser
Species Human (GRCh38)
Location 17:3753330-3753352
Sequence GCTCCATTTTACCACGTTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142994617_1142994622 25 Left 1142994617 17:3753330-3753352 CCATGAACGTGGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1142994622 17:3753378-3753400 CCATCCATGTCAATGTCCACAGG 0: 1
1: 0
2: 2
3: 20
4: 144
1142994617_1142994623 26 Left 1142994617 17:3753330-3753352 CCATGAACGTGGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1142994623 17:3753379-3753401 CATCCATGTCAATGTCCACAGGG 0: 1
1: 0
2: 2
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142994617 Original CRISPR GCTCCATTTTACCACGTTCA TGG (reversed) Exonic
902114232 1:14107711-14107733 GCTCCATTTTAACCAGATCATGG + Intergenic
902924919 1:19689776-19689798 GCTCCCTTTCACCCCATTCAGGG + Intronic
904432164 1:30471302-30471324 GCTCCTTTTTACCACCTTATGGG + Intergenic
915235297 1:154475993-154476015 TCTCCATTTTAAAACGTGCAAGG + Intronic
915841976 1:159220982-159221004 GCTCCATTTGAACAGGGTCAGGG + Intergenic
920521235 1:206628446-206628468 GCTCCTTTTCACCATCTTCAGGG - Intergenic
1069629035 10:69886598-69886620 GCTCCTTTCTACCATGTTCAAGG - Intronic
1074369205 10:112885891-112885913 GCTCCATTTTCCCTCCTTCTGGG + Intergenic
1078345771 11:10546674-10546696 GCTCTATTTTACAAAGTTGAAGG - Intergenic
1086913084 11:92495673-92495695 ACTCCATTTTACTAGGTACAGGG - Intronic
1090720525 11:129468072-129468094 GCTCCTTTTTCTCATGTTCATGG - Intergenic
1107156613 13:37174563-37174585 TTTCTATTTTACCACCTTCAAGG + Intergenic
1107651978 13:42553799-42553821 GCTCTATTTTACCACAGTCTGGG - Intergenic
1111151975 13:84264697-84264719 GCTCAATGTTATCACATTCAAGG - Intergenic
1113239167 13:108316983-108317005 GCCCCATCTCACCACGTTCTAGG + Intergenic
1115478664 14:33840623-33840645 GCTCCATCTTCCCACCTTCTTGG + Intergenic
1115989497 14:39137765-39137787 GCTTCATTTTCCCACTTTCCTGG - Intergenic
1117747910 14:58890384-58890406 GCTCCATTTTAACACTTTGTTGG - Intergenic
1117814560 14:59583467-59583489 CCTCCCTTTTCCCACCTTCAAGG - Intergenic
1118552640 14:66972566-66972588 GCCCCATTTTGTCACATTCAAGG + Intronic
1130065284 15:80597623-80597645 CCTCCATTTTGCCACTTTCAAGG - Exonic
1132461117 16:55343-55365 GCTCCATTTTACGAAGGGCAAGG - Intronic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1155382137 18:25235459-25235481 ACTTCATTTCACCACGTTAATGG + Intronic
1155801276 18:30106855-30106877 GCTCCATTTTAACAAATTTATGG - Intergenic
1157281468 18:46348964-46348986 GCTCCATGCAACCAAGTTCAAGG - Intronic
1164149179 19:22533551-22533573 GGTCCCTTTTTCCACATTCAAGG + Intergenic
927405254 2:22758931-22758953 GCTGCATTTGACCACATTCTGGG - Intergenic
932074258 2:68648169-68648191 GATCCATTTTACCACTTGAACGG + Intronic
941164728 2:162073327-162073349 GCTCCGTCTTACCACGCTAAGGG - Intronic
941495776 2:166200386-166200408 TCTCCTTTTTACTAAGTTCATGG + Intronic
945167800 2:206964721-206964743 GCTCCTTTTTCCCAGTTTCAGGG + Intronic
946498497 2:220220341-220220363 GTTCCATCTTTCCACTTTCAAGG - Intergenic
1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG + Intronic
950500023 3:13357877-13357899 GCCCCATTTTAACACCCTCAAGG + Intronic
955887218 3:63613290-63613312 GGACCATTTTACCATGTGCATGG - Intronic
961022748 3:123522996-123523018 TCACCATGATACCACGTTCACGG + Intronic
963622231 3:147624790-147624812 GCTCCAAATTGCCAAGTTCAGGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964829377 3:160866333-160866355 GCTAGATTTTACCAGGCTCATGG + Intronic
965327629 3:167327596-167327618 GCTTCATTTTAAAACATTCATGG + Intronic
970432541 4:16001928-16001950 GATCCATTTTATCAGGATCAGGG + Intronic
990780062 5:59350498-59350520 GCTTCCTTTTGCCACATTCATGG - Intronic
996749283 5:126872825-126872847 GATCCACTTTAGCATGTTCAGGG - Intronic
1004666053 6:17749583-17749605 GCTACATTTTATCACCTTAAAGG + Intergenic
1005324886 6:24690367-24690389 GCCCCCTTTTCCCAGGTTCAAGG + Intronic
1009478698 6:64128330-64128352 GCTCCATTTTAGAAAGTTCATGG - Intronic
1011844645 6:91548373-91548395 TCTCCATTTGACCACGTGAATGG - Intergenic
1020363805 7:7358064-7358086 TCTCCCTATTACCACTTTCAGGG + Exonic
1022206494 7:28169270-28169292 GCTCCACTTCAGCACTTTCAGGG - Intronic
1027140034 7:75650323-75650345 GCTCCAAATTACCACTTACAGGG - Intronic
1027601169 7:80243363-80243385 TCTCAATTTTACCACTTTAAGGG - Intergenic
1036687838 8:10923694-10923716 CCTCCGTGTCACCACGTTCATGG - Intronic
1037163848 8:15802819-15802841 GCTACATTTAGCCACGTTCTGGG - Intergenic
1042424326 8:68629325-68629347 TCTCCATCTTACCACTTTTAGGG - Intronic
1052275688 9:26673639-26673661 GCTCCATTTTGCAATGTTCTTGG - Intergenic
1055122025 9:72671517-72671539 ATTCCATTTTACCACCTTTATGG - Intronic
1185973850 X:4696058-4696080 GCCCATTTTGACCACGTTCATGG - Intergenic
1190629403 X:52369939-52369961 GCTGTATTTGACCACTTTCATGG - Intronic
1190633288 X:52410486-52410508 GCTATATTTGACCACTTTCATGG + Intergenic
1191605579 X:63058491-63058513 GCTGCATTTCACCTCTTTCATGG - Intergenic
1199751996 X:150828651-150828673 GCTCCATTTGACTACAATCAGGG + Intronic