ID: 1142994617

View in Genome Browser
Species Human (GRCh38)
Location 17:3753330-3753352
Sequence GCTCCATTTTACCACGTTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142994617_1142994622 25 Left 1142994617 17:3753330-3753352 CCATGAACGTGGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1142994622 17:3753378-3753400 CCATCCATGTCAATGTCCACAGG 0: 1
1: 0
2: 2
3: 20
4: 144
1142994617_1142994623 26 Left 1142994617 17:3753330-3753352 CCATGAACGTGGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1142994623 17:3753379-3753401 CATCCATGTCAATGTCCACAGGG 0: 1
1: 0
2: 2
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142994617 Original CRISPR GCTCCATTTTACCACGTTCA TGG (reversed) Exonic