ID: 1142994617 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:3753330-3753352 |
Sequence | GCTCCATTTTACCACGTTCA TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 62 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 3, 4: 58} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142994617_1142994622 | 25 | Left | 1142994617 | 17:3753330-3753352 | CCATGAACGTGGTAAAATGGAGC | 0: 1 1: 0 2: 0 3: 3 4: 58 |
||
Right | 1142994622 | 17:3753378-3753400 | CCATCCATGTCAATGTCCACAGG | 0: 1 1: 0 2: 2 3: 20 4: 144 |
||||
1142994617_1142994623 | 26 | Left | 1142994617 | 17:3753330-3753352 | CCATGAACGTGGTAAAATGGAGC | 0: 1 1: 0 2: 0 3: 3 4: 58 |
||
Right | 1142994623 | 17:3753379-3753401 | CATCCATGTCAATGTCCACAGGG | 0: 1 1: 0 2: 2 3: 15 4: 172 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142994617 | Original CRISPR | GCTCCATTTTACCACGTTCA TGG (reversed) | Exonic | ||