ID: 1142994622

View in Genome Browser
Species Human (GRCh38)
Location 17:3753378-3753400
Sequence CCATCCATGTCAATGTCCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142994619_1142994622 -3 Left 1142994619 17:3753358-3753380 CCAGCAAGAAGTCCGTGCTTCCA 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1142994622 17:3753378-3753400 CCATCCATGTCAATGTCCACAGG 0: 1
1: 0
2: 2
3: 20
4: 144
1142994617_1142994622 25 Left 1142994617 17:3753330-3753352 CCATGAACGTGGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1142994622 17:3753378-3753400 CCATCCATGTCAATGTCCACAGG 0: 1
1: 0
2: 2
3: 20
4: 144
1142994618_1142994622 0 Left 1142994618 17:3753355-3753377 CCACCAGCAAGAAGTCCGTGCTT 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1142994622 17:3753378-3753400 CCATCCATGTCAATGTCCACAGG 0: 1
1: 0
2: 2
3: 20
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142994622 Original CRISPR CCATCCATGTCAATGTCCAC AGG Exonic
904347037 1:29879332-29879354 CCATCCCTGTCCATTTTCACTGG - Intergenic
904382133 1:30118729-30118751 CCTTCCACGCCAGTGTCCACTGG - Intergenic
906050595 1:42868233-42868255 CCACCCCTGTCATTGTCCAATGG + Intergenic
906054827 1:42907328-42907350 CCACCCATGTCAATACCCAATGG - Intergenic
909963682 1:81880798-81880820 CCACCAATGTCATTGTGCACAGG - Intronic
915570578 1:156743278-156743300 CCATCCAGGTCAATCTCCATGGG + Intronic
916732086 1:167575384-167575406 CCATCCAGGTCATTGTGCACAGG + Intergenic
917589266 1:176460010-176460032 CTGTCCATATCAATATCCACTGG + Intergenic
920703413 1:208234671-208234693 CCATCCATGTCCCTGCCCCCAGG + Intronic
924270596 1:242328198-242328220 CCATCCTTGTGATTCTCCACAGG + Intronic
1066241369 10:33539144-33539166 CCACCCAGGTCACTGTGCACAGG + Intergenic
1066714351 10:38270596-38270618 CCATCCTTGTGATTCTCCACAGG - Intergenic
1071298862 10:84241672-84241694 CCTTCCATAGCAATATCCACAGG + Intergenic
1071803268 10:89088383-89088405 CCTGCCATGTCACTGTCCCCAGG - Intergenic
1074246955 10:111703886-111703908 GCATACATGGCAATGTCCAGAGG - Intergenic
1076009961 10:126980008-126980030 CCAGTCTTGTCCATGTCCACAGG - Intronic
1076265588 10:129107558-129107580 ACATCCATGTCTCTATCCACAGG - Intergenic
1078845544 11:15115821-15115843 GCATACATGTCGTTGTCCACAGG - Intronic
1079032336 11:16994860-16994882 ACAGCCATGTCAATGACCAGAGG - Intronic
1082775317 11:57240257-57240279 CCATCCATCTCACAGTACACAGG + Intergenic
1083660342 11:64249128-64249150 CCAGCCATGTCCGTGTCCACAGG + Intergenic
1085522123 11:77145023-77145045 CCCTGCAGGTCAAGGTCCACAGG - Intronic
1086973994 11:93112786-93112808 CCCTCCATGCCCATTTCCACGGG + Intergenic
1089132618 11:116224349-116224371 TCATCCAACTAAATGTCCACAGG - Intergenic
1095434622 12:42173952-42173974 CCATCCATCTCTCTGCCCACTGG + Intronic
1096735079 12:53646925-53646947 CCACCCCTGTCATTGTCCAATGG + Intronic
1099909859 12:88816352-88816374 CCAACAATGACAATGTACACAGG - Intergenic
1100233568 12:92634523-92634545 CCACCCAGGTCATTGTGCACAGG - Intergenic
1101040875 12:100754316-100754338 TGATCCATGGCAATGACCACAGG - Intronic
1103898552 12:124291081-124291103 GCCTCCATGTCACGGTCCACTGG + Intronic
1103917333 12:124382690-124382712 CCATCCATGTCTCTGCCCTCAGG + Intronic
1105279899 13:18957432-18957454 CCATCTCTCTCACTGTCCACTGG + Intergenic
1105981172 13:25518016-25518038 CCATCCATTGGAATGTCCTCTGG + Intronic
1107125101 13:36838030-36838052 CCATCCAGGTCATTGTGCACAGG - Intergenic
1108873785 13:55019471-55019493 ACATCCATGCCAATATCTACTGG - Intergenic
1115351568 14:32401058-32401080 CCTTACATGACAATGTCCAGAGG - Intronic
1116929317 14:50673958-50673980 CCTTCCATCTCGATGTTCACAGG + Intergenic
1117942881 14:60987761-60987783 GCTTCCATGTCACTGTCAACTGG + Intronic
1118923066 14:70167557-70167579 CCATCCATCTCAATGCCCTTAGG + Exonic
1120564197 14:86034694-86034716 CTAGCCAAGTCAATGTCCACAGG + Intergenic
1120621367 14:86768873-86768895 CAAATCATGTCAATGTCCATTGG - Intergenic
1122641537 14:103162659-103162681 CCGTCCAGGTCACTGTGCACAGG - Intergenic
1123141444 14:106082895-106082917 CCATGCATGGCCATGTCCTCAGG + Intergenic
1123672882 15:22678222-22678244 CGATCCATGTGAAAGTCCAGAGG + Intergenic
1124324937 15:28751513-28751535 CGATCCATGTGAAAGTCCAGAGG + Intergenic
1124528786 15:30484527-30484549 CGATCCATGTGAAAGTCCAGAGG + Intergenic
1124571338 15:30866900-30866922 CCACCCCTGTCATTGTCCACTGG - Intergenic
1124571789 15:30871113-30871135 CCATTCCTGTCATTGCCCACTGG + Intergenic
1124769871 15:32523166-32523188 CGATCCATGTGAAAGTCCAGAGG - Intergenic
1126283706 15:46987053-46987075 CCATCCCTGTCATTGCCCAATGG + Intergenic
1130856361 15:87843061-87843083 GCATACATCTCAGTGTCCACAGG + Intergenic
1131984838 15:98032712-98032734 CCATATATCACAATGTCCACAGG - Intergenic
1132626498 16:894100-894122 CCACCCATGCCCCTGTCCACCGG + Intronic
1133784309 16:8963206-8963228 CCTTCCATCTCCATGTCCTCGGG + Exonic
1134807903 16:17141268-17141290 CCATCCACGGCAATGCCCTCTGG + Exonic
1137508721 16:49079578-49079600 CCATCCACAGCACTGTCCACTGG - Intergenic
1142994622 17:3753378-3753400 CCATCCATGTCAATGTCCACAGG + Exonic
1145170686 17:20653872-20653894 CCATCCCTGTGAGTGCCCACGGG - Intergenic
1157572148 18:48720293-48720315 CCATGCAGGACAATGACCACTGG - Intronic
1164233353 19:23310720-23310742 CTTTCCTTGACAATGTCCACAGG + Intronic
925499306 2:4486134-4486156 CCACCCCTGTCACTGTCCAATGG - Intergenic
926415534 2:12645994-12646016 CCATCCATGTCACTGTTGAAAGG - Intergenic
926826872 2:16914464-16914486 CCATCCCTGTCATTGCCCAATGG + Intergenic
930237202 2:48899739-48899761 ACATTCTTGTCAATGTCCAGAGG + Intergenic
931226704 2:60337996-60338018 CCAACCATGGCAATGTCAACTGG - Intergenic
936562993 2:113557945-113557967 CCATTCCTGTCATTGTCCAATGG - Intergenic
936662614 2:114559154-114559176 CCATACAAGGCAATGTGCACAGG - Intronic
937852465 2:126647940-126647962 CCATCCCTGTCATTGCCCAATGG - Intergenic
939127441 2:138194087-138194109 CCATCCAGGTCATTGTGCACGGG - Intergenic
939334061 2:140802346-140802368 TCATCAATATAAATGTCCACTGG - Intronic
939700470 2:145385288-145385310 CCATACATGTGAATTTCCAAAGG - Intergenic
939755436 2:146103691-146103713 CCATCCCTGTCATTGACCAAAGG + Intergenic
940040062 2:149350886-149350908 CCATCCTGGTGAGTGTCCACAGG + Intronic
942348488 2:175028340-175028362 CCTTCCATGGCTATGGCCACAGG - Intergenic
943111475 2:183611373-183611395 CCACCCATGTAAATGACCCCAGG - Intergenic
946656538 2:221954441-221954463 CCTTCCAAGACTATGTCCACAGG + Intergenic
948211390 2:236195845-236195867 CTATCCACGACAAAGTCCACAGG - Intronic
1172330512 20:34073076-34073098 ACATCCATGTGAATGTGCATTGG + Intronic
1175520031 20:59596672-59596694 CTATGCATGCCAATGTCCAGAGG - Intronic
1178535542 21:33407319-33407341 CATTGCATGTGAATGTCCACTGG + Intronic
1178842147 21:36146366-36146388 CCATCCATGTCTGTCTTCACTGG - Exonic
1180342563 22:11629593-11629615 CCATACATGTCTAAGTACACAGG + Intergenic
1181526898 22:23494974-23494996 CCTTTCATGTCAAAATCCACTGG + Intergenic
1181685032 22:24522416-24522438 CCATCCATGCCAATGCCCTGTGG - Intronic
1183029929 22:35096062-35096084 CCAGGCATGGCAATGTCCAGAGG + Intergenic
1183334624 22:37239578-37239600 CCATCCATCTCAACGTACAAGGG + Intronic
949245979 3:1925720-1925742 CCACCCCTGTCAATGCCCAATGG + Intergenic
951549718 3:23864929-23864951 TCATCCATGTTAATGACCACTGG + Intronic
952577833 3:34795848-34795870 GTCTCCATGCCAATGTCCACAGG + Intergenic
953328904 3:42035509-42035531 CCCTCCATGTCACTGCTCACAGG - Intronic
955010669 3:55011382-55011404 CCATCCAGGTTTATGTCCTCAGG - Intronic
955732089 3:61997773-61997795 ACATGAATGTCAATGTCTACAGG + Intronic
957963705 3:87294656-87294678 ACATCCATGCCAATGTCTACTGG - Intergenic
958025103 3:88040338-88040360 CCATCCCTGTCATTGTCCAGTGG - Intergenic
959386991 3:105721655-105721677 CCATACATGTTCATGTCCAGGGG + Intronic
960223249 3:115142168-115142190 CACTCCATGTCAAGGACCACAGG + Intronic
966825277 3:183959875-183959897 CCATCCAGATGAATGTCCACAGG + Intronic
967852338 3:194091590-194091612 CCATCCATGTCCATGTCAACTGG + Intergenic
969457307 4:7307417-7307439 CCATCCAGGCCAGGGTCCACAGG + Intronic
972081324 4:35153968-35153990 CCATCCACATCTATGTCCAAAGG - Intergenic
974644509 4:64673971-64673993 CCACCCATGTCATTGCCCAATGG - Intergenic
975445693 4:74462679-74462701 CCATCCATGCCAGTGCACACAGG + Intergenic
977031751 4:91892605-91892627 CCACCCTTGTCATTGTCCAATGG + Intergenic
977930301 4:102743023-102743045 CCATCCCTGTCATTGCCCAATGG - Intronic
978458401 4:108922063-108922085 CCATCCTTGTCTCTGTCCTCAGG + Intronic
978898962 4:113926017-113926039 CCATCCCTGTCATTGCCCAATGG - Intronic
983705148 4:170648470-170648492 CCATCCAGGTCATTGTGCACAGG - Intergenic
990359869 5:55007495-55007517 CCATCCCTGCCAATGTTCTCTGG + Intronic
993171413 5:84424273-84424295 CCATCCATCTCAATTTGGACTGG + Intergenic
993203499 5:84848338-84848360 CCATCCCTGTCGTTGTCCAATGG + Intergenic
994052173 5:95374691-95374713 CCTTCCCTGTCAATGCCCACAGG + Intergenic
998404089 5:141863812-141863834 CCAGCAATGTCAATATCCAGCGG + Exonic
998728825 5:145050401-145050423 CCTCCCATCTCAATGACCACTGG + Intergenic
1001769390 5:174281573-174281595 CCTTCCATGCCAGTTTCCACTGG + Intergenic
1003975562 6:11340308-11340330 AGATCAATGTCAATGTCCACAGG + Intronic
1004139535 6:13003776-13003798 CTCTCTATGTCCATGTCCACGGG + Intronic
1007387399 6:41529066-41529088 CCATTCATGTCACTGTCCACAGG + Intergenic
1009502982 6:64441175-64441197 CCATCCATATCAATTTTCAAGGG + Intronic
1011970212 6:93212886-93212908 AAATCCATGTCATTGGCCACAGG - Intergenic
1012515379 6:100053202-100053224 CCAACCATGTCAAGCTCCCCAGG - Intergenic
1013098358 6:106966748-106966770 CCATCCTTGTCATTGTCCAGTGG + Intergenic
1018396435 6:163381334-163381356 ACATCCATGTCAGTGACCTCTGG - Intergenic
1020614118 7:10437203-10437225 CCATCCATGCCACTCCCCACAGG - Intergenic
1023971013 7:44991005-44991027 CCATCCAGGTCATTATGCACAGG - Intergenic
1024234370 7:47386676-47386698 CCATCCAGCACAGTGTCCACAGG + Intronic
1024743680 7:52383054-52383076 CCACCCAGGTCATTGTGCACAGG - Intergenic
1029424671 7:100488361-100488383 CCCACCATCTCAATGTACACAGG - Exonic
1030368860 7:108674825-108674847 CCATCCCTGTCATTGCCCAATGG + Intergenic
1032150843 7:129428196-129428218 TCATCCATGGCAATGGCCAAAGG - Exonic
1033491433 7:141847218-141847240 ACATCTGTGTCTATGTCCACAGG + Intergenic
1034491229 7:151394182-151394204 CCACCCATCCCAATGTCCTCAGG + Intronic
1035230744 7:157464066-157464088 CCATCCATGTCACAGTTCATGGG + Intergenic
1035901516 8:3462213-3462235 CCACCCATGTCAATGGTCAATGG + Intronic
1036481984 8:9148132-9148154 CCATCCCTGTCACAGTCCGCTGG - Intronic
1037616996 8:20528168-20528190 CCAGCCATGCCAATGTCCAAGGG - Intergenic
1037838975 8:22230817-22230839 CCAGACATGTTCATGTCCACAGG + Intronic
1038185852 8:25274166-25274188 ACAACCCTGTCAATGTTCACTGG + Intronic
1041911843 8:63097407-63097429 CCACCCAGGTCATTGTGCACAGG + Intergenic
1044740775 8:95323846-95323868 CCACCCAGGTCATTGTGCACAGG - Intergenic
1046310561 8:112431165-112431187 ACATCAATGTCAATATCCAGAGG - Intronic
1049033724 8:140058298-140058320 CCCTCCCTGTAAATGTCCACGGG + Intronic
1049225189 8:141447265-141447287 CCATCCATGGCCAGGGCCACAGG - Intergenic
1049907161 9:228819-228841 GCAGCCATGTGAATGTCTACAGG - Intronic
1050424897 9:5502526-5502548 CCTCCCATGTGAATGTGCACAGG + Intergenic
1051274094 9:15382463-15382485 AAATCCATGTCAAAGCCCACTGG + Intergenic
1052769096 9:32671218-32671240 CCAAACATGTCAAGATCCACTGG - Intergenic
1053731224 9:41059029-41059051 CCATTCCTGTCATTGTCCAATGG + Intergenic
1054697286 9:68373060-68373082 CCATTCCTGTCATTGTCCAATGG - Intronic
1056504887 9:87249035-87249057 CCATCCCTTTCAATGTTCAAAGG - Intergenic
1056570208 9:87808214-87808236 CCACCCAGGTCATTGTGCACAGG + Intergenic
1058124681 9:101178173-101178195 CCACCCATGTCATTGCCCAATGG + Intronic
1058565145 9:106275578-106275600 CCATCCATATCAATTTGCAAGGG + Intergenic
1060178896 9:121518093-121518115 CCATCCCTGTCATTGCCCAGTGG + Intergenic
1061259763 9:129473508-129473530 CCTTTCATGTCAAAATCCACTGG - Intergenic
1062188305 9:135230286-135230308 CCATCCATGTCACTGTGAGCAGG + Intergenic
1186279611 X:7977912-7977934 CCATCCCTGTCATTGCCCAATGG + Intergenic
1186688696 X:11952203-11952225 CCACCCATATCAGTGACCACTGG - Intergenic
1190227388 X:48556774-48556796 CCAACAATGGCAATGTCCAGTGG - Intronic
1192502039 X:71660769-71660791 CCTTCCATGACTCTGTCCACGGG + Intergenic
1192506796 X:71690986-71691008 CAATTCCTATCAATGTCCACTGG + Intergenic
1192513090 X:71737723-71737745 CAATTCCTGTCAATGTCCACTGG - Intergenic
1192513607 X:71743790-71743812 CAATTCCTGTCAATGTCCACTGG + Intergenic
1192519901 X:71790560-71790582 CAATTCCTATCAATGTCCACTGG - Intergenic
1194525979 X:94978029-94978051 CCATTCATGTACATGTGCACTGG + Intergenic
1195204460 X:102582377-102582399 CAATTCATTTCAATATCCACAGG + Intergenic
1199989082 X:152974476-152974498 CCATGCATCTCTATGTCCTCTGG + Intergenic
1201519028 Y:14851976-14851998 CCACCTATGTCTATCTCCACTGG + Intergenic