ID: 1142994623 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:3753379-3753401 |
Sequence | CATCCATGTCAATGTCCACA GGG |
Strand | + |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 190 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 15, 4: 172} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1142994618_1142994623 | 1 | Left | 1142994618 | 17:3753355-3753377 | CCACCAGCAAGAAGTCCGTGCTT | 0: 1 1: 0 2: 1 3: 8 4: 112 |
||
Right | 1142994623 | 17:3753379-3753401 | CATCCATGTCAATGTCCACAGGG | 0: 1 1: 0 2: 2 3: 15 4: 172 |
||||
1142994617_1142994623 | 26 | Left | 1142994617 | 17:3753330-3753352 | CCATGAACGTGGTAAAATGGAGC | 0: 1 1: 0 2: 0 3: 3 4: 58 |
||
Right | 1142994623 | 17:3753379-3753401 | CATCCATGTCAATGTCCACAGGG | 0: 1 1: 0 2: 2 3: 15 4: 172 |
||||
1142994619_1142994623 | -2 | Left | 1142994619 | 17:3753358-3753380 | CCAGCAAGAAGTCCGTGCTTCCA | 0: 1 1: 0 2: 0 3: 6 4: 85 |
||
Right | 1142994623 | 17:3753379-3753401 | CATCCATGTCAATGTCCACAGGG | 0: 1 1: 0 2: 2 3: 15 4: 172 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1142994623 | Original CRISPR | CATCCATGTCAATGTCCACA GGG | Exonic | ||