ID: 1142994623

View in Genome Browser
Species Human (GRCh38)
Location 17:3753379-3753401
Sequence CATCCATGTCAATGTCCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142994618_1142994623 1 Left 1142994618 17:3753355-3753377 CCACCAGCAAGAAGTCCGTGCTT 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1142994623 17:3753379-3753401 CATCCATGTCAATGTCCACAGGG 0: 1
1: 0
2: 2
3: 15
4: 172
1142994619_1142994623 -2 Left 1142994619 17:3753358-3753380 CCAGCAAGAAGTCCGTGCTTCCA 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1142994623 17:3753379-3753401 CATCCATGTCAATGTCCACAGGG 0: 1
1: 0
2: 2
3: 15
4: 172
1142994617_1142994623 26 Left 1142994617 17:3753330-3753352 CCATGAACGTGGTAAAATGGAGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1142994623 17:3753379-3753401 CATCCATGTCAATGTCCACAGGG 0: 1
1: 0
2: 2
3: 15
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142994623 Original CRISPR CATCCATGTCAATGTCCACA GGG Exonic
900474952 1:2871818-2871840 CATCCCTGACAAAGTCCCCAAGG + Intergenic
901026741 1:6282339-6282361 CATCGATGTCACTGGCCACCAGG + Intronic
903662309 1:24985573-24985595 CCTCCAGGTCATTGCCCACAGGG + Intergenic
908977781 1:69919813-69919835 CATCCACGTCATTGTCCGCACGG + Intronic
909471341 1:76031947-76031969 CATGCATCTCAATGTCTACATGG + Intergenic
909604065 1:77491052-77491074 CATCAATGCCAATGTACACCAGG - Intronic
909929302 1:81476976-81476998 CATCCATGGATATTTCCACAGGG - Intronic
909963681 1:81880797-81880819 CACCAATGTCATTGTGCACAGGG - Intronic
910476194 1:87609911-87609933 CATCAATGTTCCTGTCCACAGGG - Intergenic
911695419 1:100885344-100885366 CATCCTTGTGAATTTCCCCAAGG + Intronic
912179638 1:107204433-107204455 CTACCATGTGAATGACCACATGG + Intronic
912247911 1:107980005-107980027 CATTTATGTAAATGGCCACAGGG + Intergenic
914216147 1:145630939-145630961 TTTCCAGGTCAATGCCCACAGGG - Intronic
914468717 1:147953597-147953619 TTTCCAGGTCAATGCCCACAGGG - Intronic
916732087 1:167575385-167575407 CATCCAGGTCATTGTGCACAGGG + Intergenic
917004857 1:170402951-170402973 CAGCCATGTGAATGTACAGAGGG + Intergenic
920555937 1:206904694-206904716 CTTCCATGTCTTTGACCACAGGG - Exonic
921163517 1:212489441-212489463 CAACCAGGTCACTGTCCTCAAGG + Intergenic
921407285 1:214794417-214794439 TCTCCATGTCATTTTCCACAGGG + Intergenic
923507375 1:234616562-234616584 CATCCATTTCTGTGCCCACATGG + Intergenic
1064180185 10:13107972-13107994 CTTGCATTTCTATGTCCACATGG + Intronic
1064360546 10:14660440-14660462 CATCCATCTCCCTGCCCACAAGG + Intronic
1064597773 10:16962791-16962813 CACTCATGTGAATGTACACAGGG - Intronic
1067809518 10:49416462-49416484 CATGCATGGAAATGTCCAGAGGG + Intergenic
1069184974 10:65411159-65411181 CATCTATGTAAATGGTCACAGGG - Intergenic
1072991420 10:100198531-100198553 CATCAATGAAAATGTCAACATGG + Intronic
1073822933 10:107285906-107285928 CATCCATGAGGATGTCCACTTGG + Intergenic
1075450477 10:122548380-122548402 CATCAATGTGAATCTCCACCTGG + Intergenic
1076283587 10:129272305-129272327 CCTCTATGTCAAGGCCCACACGG + Intergenic
1076786789 10:132753844-132753866 CTGCCTTGTCATTGTCCACACGG + Intronic
1079941227 11:26683079-26683101 CATGCATGTAAGTGTGCACATGG + Intronic
1080842786 11:35999912-35999934 CATCCTTGTAAATGTCTCCATGG - Intronic
1081122256 11:39282058-39282080 CATTCATGTAAATATCCGCATGG + Intergenic
1082755537 11:57072343-57072365 CAACCATCTTCATGTCCACATGG + Intergenic
1082775318 11:57240258-57240280 CATCCATCTCACAGTACACAGGG + Intergenic
1082992409 11:59219173-59219195 CATCCATGTAAATCTCAACGTGG + Intergenic
1083810971 11:65106822-65106844 CATCCATGTGGATGTGCACAAGG + Intronic
1085240490 11:75050052-75050074 CATCCATGTCAGTGAGCAGAGGG - Intergenic
1085335326 11:75688784-75688806 CATCCATGTCATCTTCCATATGG - Intergenic
1089175205 11:116543800-116543822 CATGCATGTGCATGTGCACATGG - Intergenic
1090496602 11:127218950-127218972 TATCCATGGCAAAGTCCCCAAGG + Intergenic
1093358919 12:18200596-18200618 CATCCATATAAATGTTCAAATGG - Intronic
1095563816 12:43597106-43597128 CCTGCATGCCATTGTCCACATGG + Intergenic
1095788373 12:46136413-46136435 CAGCCCTGCCAGTGTCCACATGG - Intergenic
1096755285 12:53794260-53794282 CACCCATGTCAATGTCTAGCAGG - Intergenic
1098616861 12:72537089-72537111 TACCCATGTCAATTTCTACAAGG + Intronic
1099058992 12:77882284-77882306 CAACCATGTGATTATCCACAAGG + Intronic
1100233567 12:92634522-92634544 CACCCAGGTCATTGTGCACAGGG - Intergenic
1103180376 12:118906189-118906211 TATCCATCTCTATGTCTACAGGG + Intergenic
1103330089 12:120148224-120148246 CTCCCATGTCAAAGTCCAGAAGG - Exonic
1103745293 12:123118779-123118801 CATCCTCGTTAATGTCAACACGG + Intronic
1103827102 12:123748034-123748056 CATTCATGTCGATTTCCAGAAGG + Intronic
1103898554 12:124291082-124291104 CCTCCATGTCACGGTCCACTGGG + Intronic
1103917334 12:124382691-124382713 CATCCATGTCTCTGCCCTCAGGG + Intronic
1106653893 13:31721520-31721542 CTTCCATCTCAATGTTCACATGG - Intergenic
1106673715 13:31934662-31934684 CATCCATGTGAATGGCATCATGG - Intergenic
1107125100 13:36838029-36838051 CATCCAGGTCATTGTGCACAGGG - Intergenic
1107344922 13:39449011-39449033 CAACCATGTCAATGCACAAATGG + Intronic
1108584601 13:51859336-51859358 CATGCATGTGACTGTGCACATGG + Intergenic
1110648604 13:77918090-77918112 CATCCCTATCAATGTCTACAAGG - Exonic
1111133298 13:84004010-84004032 CATCTATGTCAATATTTACAGGG - Intergenic
1112557357 13:100480913-100480935 GATCCATGTCAAAATCCCCAGGG + Intronic
1115511970 14:34146707-34146729 CATCTATGTCAAAATTCACATGG + Intronic
1115562142 14:34592497-34592519 CATCGGTGTAAATGTCAACATGG + Intronic
1118637024 14:67757305-67757327 CATCCCTCACAATGTCCACAAGG + Intronic
1118923067 14:70167558-70167580 CATCCATCTCAATGCCCTTAGGG + Exonic
1118927686 14:70207713-70207735 CATCCCTTTGAATGTCCTCATGG + Intergenic
1121857898 14:97287366-97287388 CATCCATTTTAATGTACACCAGG - Intergenic
1122641536 14:103162658-103162680 CGTCCAGGTCACTGTGCACAGGG - Intergenic
1126690063 15:51282060-51282082 AATCCTTGTCACAGTCCACAGGG + Intronic
1127187646 15:56495790-56495812 CATTAAAGTCAATCTCCACAGGG - Intergenic
1128684316 15:69672304-69672326 CAAGCTTGCCAATGTCCACATGG + Intergenic
1131978954 15:97976895-97976917 AATCCATCTGATTGTCCACACGG + Intergenic
1132763867 16:1524783-1524805 CTTCCAGGGCAATGTCCAGAAGG - Exonic
1133379686 16:5319583-5319605 CATCCAAGACAAGGTCCACGTGG - Intergenic
1134659086 16:15970266-15970288 GATGCATCTCCATGTCCACATGG + Intronic
1134694436 16:16212725-16212747 CAGGCCTGACAATGTCCACAAGG + Intronic
1134977397 16:18581905-18581927 CAGGCCTGACAATGTCCACAAGG - Intergenic
1135590095 16:23698954-23698976 CATTCTTGTCAAAGTCCTCATGG - Intronic
1142994623 17:3753379-3753401 CATCCATGTCAATGTCCACAGGG + Exonic
1147483870 17:40793875-40793897 CCTCGATGTCAAGGTCCACTTGG - Exonic
1148711809 17:49687402-49687424 CAGCCAGGTCACTGTCCCCATGG - Intergenic
1155499297 18:26470986-26471008 CATCCCTGTCAGAGCCCACAAGG - Intronic
1159132640 18:64297259-64297281 CATCCATATTATTTTCCACAGGG + Intergenic
1159266240 18:66083598-66083620 CATTCATGTCAATATTCAAATGG + Intergenic
1164233354 19:23310721-23310743 TTTCCTTGACAATGTCCACAGGG + Intronic
1164977649 19:32585629-32585651 CACCCATGCCAATCTCCACATGG - Intronic
926353857 2:12022021-12022043 CCTCCATGTCAATTCCCAGAAGG - Intergenic
927559536 2:24060149-24060171 CCTCCATTTCATTGTCCACTTGG - Intronic
930237203 2:48899740-48899762 CATTCTTGTCAATGTCCAGAGGG + Intergenic
931226703 2:60337995-60338017 CAACCATGGCAATGTCAACTGGG - Intergenic
934537658 2:95149116-95149138 AATCCCTGTCAATGTCAAGAGGG - Exonic
939334060 2:140802345-140802367 CATCAATATAAATGTCCACTGGG - Intronic
939700469 2:145385287-145385309 CATACATGTGAATTTCCAAAGGG - Intergenic
939755437 2:146103692-146103714 CATCCCTGTCATTGACCAAAGGG + Intergenic
942825446 2:180169727-180169749 AATCCTTGGCAATTTCCACATGG - Intergenic
945696748 2:213116319-213116341 CATCCATTTCCATGTTTACATGG + Intronic
947834070 2:233162889-233162911 CATCCCTGACCATGTCCAGAGGG - Intronic
948818336 2:240525376-240525398 CATCCATGACAATGCCCCCAAGG - Intronic
948930280 2:241127450-241127472 CACCCATGTCATTATCCCCAGGG - Exonic
1170438029 20:16350377-16350399 CAGCCAGGACAATGTCCAGAGGG + Intronic
1170728244 20:18948731-18948753 CATCCACGTCCTAGTCCACAGGG + Intergenic
1171246619 20:23615220-23615242 CATCCATGTCCATAGCCAAAAGG - Intergenic
1180124876 21:45784081-45784103 CATCCCTGTCAAGGTAGACAAGG - Intronic
1180342564 22:11629594-11629616 CATACATGTCTAAGTACACAGGG + Intergenic
1181821865 22:25482552-25482574 CACCCATGTCAGTGTCCTCTTGG + Intergenic
952789314 3:37186774-37186796 CATCCCTGTGGTTGTCCACATGG + Intergenic
955006682 3:54975127-54975149 CCTCCCTGTCAATGACCACTTGG - Intronic
955697475 3:61651542-61651564 AATCCAGGTCAATTCCCACATGG - Intronic
955732090 3:61997774-61997796 CATGAATGTCAATGTCTACAGGG + Intronic
955867974 3:63405665-63405687 CCTCCACATCACTGTCCACATGG - Intronic
956203582 3:66732808-66732830 TATCCATGTAAAATTCCACAGGG + Intergenic
958025102 3:88040337-88040359 CATCCCTGTCATTGTCCAGTGGG - Intergenic
958602118 3:96308387-96308409 CATCTTTGTCAATGTGAACAAGG + Intergenic
958795128 3:98698996-98699018 CAACCATTTCTTTGTCCACATGG - Intergenic
961667420 3:128502075-128502097 CATCCATGCTGATGTTCACAAGG + Intergenic
962429429 3:135305969-135305991 CATCCAGGTGACTGTCCAGAGGG + Intergenic
963719608 3:148846463-148846485 TATCCATGTCATTGTCTAAATGG - Intronic
964865166 3:161250790-161250812 CATCGGTGTCACTTTCCACAGGG - Exonic
969457308 4:7307418-7307440 CATCCAGGCCAGGGTCCACAGGG + Intronic
971194905 4:24463434-24463456 CTTCCATTTAAATGTCCCCAGGG - Intergenic
972329633 4:38052674-38052696 CATGCATGTAAGTGTCCACTAGG - Intronic
974945150 4:68517627-68517649 CATCGATTTCAATGTCCTCCTGG + Intergenic
975445694 4:74462680-74462702 CATCCATGCCAGTGCACACAGGG + Intergenic
975824973 4:78309755-78309777 CAGACCTGGCAATGTCCACAGGG - Intronic
977643873 4:99389649-99389671 AAACCTTGACAATGTCCACATGG - Intergenic
978458402 4:108922064-108922086 CATCCTTGTCTCTGTCCTCAGGG + Intronic
979014623 4:115418333-115418355 CACCCAGGTCATTGTGCACAAGG + Intergenic
979294323 4:119013111-119013133 TATCCATGCAAATGTCAACATGG - Intronic
983971641 4:173882756-173882778 CATCCAAGTCCCTGTCCTCAAGG + Intergenic
985337996 4:188916462-188916484 CATCCATTTCAAAGCCCAAAGGG + Intergenic
985684607 5:1275464-1275486 CATCCAGGCCAATGAACACAAGG + Intronic
991423394 5:66465055-66465077 CCACCATGTCATTTTCCACAGGG - Intergenic
994277011 5:97851171-97851193 CATAGATGCCCATGTCCACAGGG - Intergenic
996358267 5:122619953-122619975 CATCCATATAAATGTTCAAATGG + Intergenic
997462099 5:134059632-134059654 CATCCTTGTCCATGACAACAGGG + Intergenic
999217080 5:149944322-149944344 CAGGCTTTTCAATGTCCACAAGG - Exonic
1000396551 5:160781132-160781154 AATCCAGGTGAATGACCACAAGG + Intronic
1000805857 5:165791053-165791075 CATCCATTAAAATGTCCATATGG + Intergenic
1002484267 5:179523880-179523902 CATCCCTGTCCAAGGCCACAGGG - Intergenic
1002500307 5:179643608-179643630 CATCCCTGTCCAAGGCCACAGGG + Intronic
1003975563 6:11340309-11340331 GATCAATGTCAATGTCCACAGGG + Intronic
1005519260 6:26584331-26584353 TCACCATGTCAATGTCCACCAGG - Intergenic
1006819046 6:36876092-36876114 CATCCAGCTCAAGGGCCACAAGG - Intronic
1007387400 6:41529067-41529089 CATTCATGTCACTGTCCACAGGG + Intergenic
1010799740 6:80161637-80161659 CATTCCTGTCAGTGTCCACATGG + Intronic
1013098359 6:106966749-106966771 CATCCTTGTCATTGTCCAGTGGG + Intergenic
1018971955 6:168536220-168536242 CATCCATGACCATCTCAACACGG + Intronic
1019967444 7:4511366-4511388 CAGCCATGGGAATATCCACAGGG + Intergenic
1020068962 7:5212869-5212891 TATCCATGTCAATCTCCTGAGGG + Intronic
1022886644 7:34653539-34653561 GAACCATATCAATGCCCACAAGG + Intergenic
1023971012 7:44991004-44991026 CATCCAGGTCATTATGCACAGGG - Intergenic
1024234371 7:47386677-47386699 CATCCAGCACAGTGTCCACAGGG + Intronic
1024743679 7:52383053-52383075 CACCCAGGTCATTGTGCACAGGG - Intergenic
1026267749 7:68810210-68810232 CATCCATGTCACTCTCCCCAAGG - Intergenic
1028576209 7:92354397-92354419 AGTCCATGTGAATGGCCACATGG + Intronic
1028920342 7:96303736-96303758 CTCCCATGTCAGTGGCCACATGG + Intronic
1031088990 7:117330103-117330125 CACCCATGTCTAGGACCACATGG - Intergenic
1033592290 7:142819851-142819873 GAACCATCTCAAAGTCCACACGG + Intergenic
1034384870 7:150732635-150732657 TTTTCATGTCGATGTCCACATGG + Intronic
1034633607 7:152549985-152550007 CCTCATTGTCAAAGTCCACAGGG + Intergenic
1035826984 8:2655293-2655315 CGTCCATCTCACTGTCCACCAGG - Intergenic
1037620731 8:20561396-20561418 CCTCCATCTCAGTGTCCACTTGG + Intergenic
1039373804 8:37013339-37013361 CATCTATGTCAATGAGCAGAGGG - Intergenic
1041911844 8:63097408-63097430 CACCCAGGTCATTGTGCACAGGG + Intergenic
1042371850 8:68000806-68000828 CATCTTTGTCAATGATCACATGG - Intronic
1044740774 8:95323845-95323867 CACCCAGGTCATTGTGCACAGGG - Intergenic
1046260860 8:111765833-111765855 CACTCATGTCTATGTCCACTAGG - Intergenic
1049033726 8:140058299-140058321 CCTCCCTGTAAATGTCCACGGGG + Intronic
1049225188 8:141447264-141447286 CATCCATGGCCAGGGCCACAGGG - Intergenic
1049644574 8:143730315-143730337 CATCCATGTCCACGTCGAGAAGG + Exonic
1050424898 9:5502527-5502549 CTCCCATGTGAATGTGCACAGGG + Intergenic
1051821481 9:21174618-21174640 CATTTATGAAAATGTCCACAAGG + Intergenic
1055674461 9:78641281-78641303 CAGCCATGTGAATTGCCACATGG - Intergenic
1056492474 9:87121210-87121232 CAGCCATGTCAGTGTCCCCCAGG + Intergenic
1056570209 9:87808215-87808237 CACCCAGGTCATTGTGCACAGGG + Intergenic
1059741474 9:117154769-117154791 CATCAATGTCATTGTACTCAAGG - Intronic
1060123843 9:121023246-121023268 CATCCCTGTCTGTGTCCACCAGG + Intronic
1060757772 9:126225528-126225550 GGTCCATGTCCTTGTCCACAGGG + Intergenic
1061992775 9:134168976-134168998 CAGCCTTATCCATGTCCACATGG + Intergenic
1062185524 9:135216229-135216251 CCCCCATGTCAACCTCCACAAGG + Intergenic
1062280216 9:135748560-135748582 CTTCCTTGTCACTGTCCACCAGG - Intronic
1185583784 X:1230222-1230244 CATCTATCTCCATGACCACAGGG - Intergenic
1188837678 X:34978429-34978451 CACCCATGTGAATGTACACATGG + Intergenic
1191932021 X:66383981-66384003 CTTCCAAGACAATGTCTACATGG - Intergenic
1193392765 X:80948817-80948839 CATCACTGTGAATGCCCACATGG - Intergenic
1195204461 X:102582378-102582400 AATTCATTTCAATATCCACAGGG + Intergenic
1196157788 X:112449884-112449906 CATTCAGATCAATGGCCACATGG - Intergenic
1199108509 X:143901760-143901782 CACTCATGACAATGTCCTCAAGG - Intergenic
1200811601 Y:7491214-7491236 CATGGATGCCAACGTCCACACGG + Intergenic