ID: 1142995218

View in Genome Browser
Species Human (GRCh38)
Location 17:3756010-3756032
Sequence CAGGAAGAGAACCCGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 195}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142995210_1142995218 10 Left 1142995210 17:3755977-3755999 CCTCACTCCCAGAAGGAACCATG 0: 1
1: 0
2: 1
3: 34
4: 244
Right 1142995218 17:3756010-3756032 CAGGAAGAGAACCCGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 195
1142995208_1142995218 19 Left 1142995208 17:3755968-3755990 CCAGCTTGGCCTCACTCCCAGAA 0: 1
1: 0
2: 0
3: 16
4: 305
Right 1142995218 17:3756010-3756032 CAGGAAGAGAACCCGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 195
1142995215_1142995218 -8 Left 1142995215 17:3755995-3756017 CCATGCTTGGTGTAACAGGAAGA 0: 1
1: 0
2: 0
3: 13
4: 118
Right 1142995218 17:3756010-3756032 CAGGAAGAGAACCCGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 195
1142995213_1142995218 2 Left 1142995213 17:3755985-3756007 CCAGAAGGAACCATGCTTGGTGT 0: 1
1: 0
2: 3
3: 19
4: 138
Right 1142995218 17:3756010-3756032 CAGGAAGAGAACCCGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 195
1142995212_1142995218 3 Left 1142995212 17:3755984-3756006 CCCAGAAGGAACCATGCTTGGTG 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1142995218 17:3756010-3756032 CAGGAAGAGAACCCGGCTGAGGG 0: 1
1: 0
2: 0
3: 16
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142995218 Original CRISPR CAGGAAGAGAACCCGGCTGA GGG Intronic
900622582 1:3594070-3594092 CAGGAACAGAACCCAGCTCTAGG - Intronic
901345937 1:8542416-8542438 TAGGAAGAGAAGCTGGCTGAGGG + Intronic
903133799 1:21296229-21296251 AAGCATGAGCACCCGGCTGAAGG - Intronic
904311244 1:29630983-29631005 CAGGAATAGAACCTGTTTGAGGG - Intergenic
904338179 1:29811347-29811369 CAGGAAGAGAAAGAGGGTGAGGG + Intergenic
904967137 1:34383913-34383935 CAGGAACAGAAGCCTGCTGCTGG + Intergenic
905414679 1:37795600-37795622 CAGGAAGTGAACCTGGCAGGAGG + Intronic
906192084 1:43905169-43905191 CAGGAAGAGAAACAGGAGGAGGG - Intronic
908721040 1:67126255-67126277 CAGGAAGAGGAGCAGGCTGGAGG - Intronic
908977164 1:69911588-69911610 CAGGAAGAGGACTCTGCTGGAGG - Intronic
909488166 1:76197445-76197467 CAGGAAGATAATTGGGCTGAAGG + Intronic
911179088 1:94845357-94845379 CAGGAAGGGAGCACTGCTGATGG - Exonic
912666768 1:111588100-111588122 CAGGAAGAGAAGCAGGCTTATGG - Intronic
913189604 1:116402512-116402534 CAGGAAGTGAATGAGGCTGATGG - Intronic
914474385 1:148011443-148011465 CAGCACGAGAATCCGTCTGATGG - Intergenic
916661105 1:166922863-166922885 CAGGAAGAGAATCCTGTTAAGGG + Intronic
920107392 1:203563623-203563645 CAGGAGGAGAAGGGGGCTGAGGG - Intergenic
921291577 1:213662670-213662692 AATGAAGAGACCCAGGCTGACGG - Intergenic
922412728 1:225391712-225391734 CAGGGAGAGGAGCAGGCTGATGG + Intronic
923145663 1:231195993-231196015 CTGGAAGAGTACCCGGCACATGG - Intronic
924029959 1:239876423-239876445 CAAGAAGAGAGCCAGGCTTATGG + Intronic
1064011331 10:11738825-11738847 CAAGAAGAGAACACGCATGATGG - Intergenic
1064926864 10:20579102-20579124 CAGGAGGCCAACCCGCCTGAGGG - Intergenic
1069924277 10:71837548-71837570 CAGGTAAACAACCCAGCTGAAGG + Intronic
1071936466 10:90536900-90536922 CAAGAAGAAAATCTGGCTGATGG - Intergenic
1072529400 10:96304533-96304555 GAAGAAGAGACCCCGGCAGACGG + Exonic
1072605467 10:96978138-96978160 CAGGAGGAGGCCCCTGCTGAAGG - Intronic
1074107104 10:110396550-110396572 CAGGGATAGAACCAGGGTGATGG + Intergenic
1074819752 10:117168952-117168974 TAGGAGGAAAACCCCGCTGAGGG + Intergenic
1076686201 10:132199530-132199552 CAGGCACAGAACCCAGGTGACGG + Intronic
1077306409 11:1870535-1870557 CAGGAAGAGGGCCTGGCTGCTGG + Intronic
1078107872 11:8370062-8370084 CAGGAGGAGACCCCGTCTGAGGG + Intergenic
1079822752 11:25151512-25151534 CAGTAAGGGTACCAGGCTGATGG - Intergenic
1080902669 11:36510398-36510420 CAGGAAGAAAGCCAGGCTGCGGG - Intergenic
1083318892 11:61833213-61833235 CAGGAAGAGGACCCGGGACATGG - Intronic
1084315471 11:68343029-68343051 CAGGAGGGGAACCCGGGTAAAGG - Intronic
1084468400 11:69340778-69340800 CAGGATGAGACCCCGGCAGCAGG + Intronic
1085250610 11:75141189-75141211 CAGGCAGAGGAACTGGCTGATGG + Intronic
1085273929 11:75286133-75286155 AAGGAAGCGAGCCCGGCTGCAGG - Intronic
1085718472 11:78893229-78893251 CAGGCAGATAACCCTGCTGATGG + Intronic
1086086259 11:82957911-82957933 CAGGAAGACAACCAGCTTGATGG - Intronic
1086203673 11:84233565-84233587 CAGGCAGAGAACCTGCCTGCAGG + Intronic
1088706906 11:112471942-112471964 CAGGAAAATAACCCGGCAGAGGG - Intergenic
1089792108 11:120952934-120952956 CAGGAAGAGGACACAGCTGACGG - Exonic
1090664349 11:128905150-128905172 CAGGAAGAGAGACCCGCTGGCGG + Intronic
1092917467 12:13201824-13201846 CAGGAACAGAATCAGGCTCAGGG + Intronic
1094425381 12:30311331-30311353 CAGGAATATAACCCACCTGATGG + Intergenic
1101021003 12:100553762-100553784 CAGGAGGAGAACCAGCCTGTGGG - Intronic
1104635895 12:130437676-130437698 CTGGGAGAGAACAGGGCTGAGGG + Intronic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1106164167 13:27227487-27227509 AAGGAAGAGCACCCGGAGGAAGG + Intergenic
1109160701 13:58970221-58970243 CAGGGAGAAAACCTGTCTGAAGG + Intergenic
1112088104 13:96053084-96053106 CACGAAGAAAGCGCGGCTGAGGG + Intronic
1113109132 13:106803092-106803114 CAGGCAGAGAGCCCAGCTGAAGG + Intergenic
1117341886 14:54798694-54798716 CAGGAACAGAACCAGTCTCAGGG + Intergenic
1117420901 14:55543862-55543884 CAGGAAGACAACCAGCTTGATGG - Intergenic
1118637587 14:67762168-67762190 CAGGAAGAGTGCCTGGCTCAGGG - Intronic
1119031805 14:71198566-71198588 CAGGAAGAGAGCCAGGTTGGTGG - Intergenic
1119899728 14:78249447-78249469 GAGAAAGAGGACCCAGCTGAAGG - Intronic
1121208765 14:92190758-92190780 GAGGTAGAGAAGCCAGCTGAGGG - Intergenic
1121452122 14:94015586-94015608 CATGAAGAGAACCTGCCTCAGGG + Intergenic
1122776786 14:104120535-104120557 CAGGAAGAGAGACAGGCTGGGGG + Intergenic
1125819872 15:42620013-42620035 CATGAAGAGAAACCAGCTTAAGG - Intronic
1126134470 15:45377638-45377660 CAGGAGGAGAACTCGGGTGGAGG + Intronic
1127577469 15:60305812-60305834 CAAGAACAGAACCAGGGTGATGG + Intergenic
1128636783 15:69307668-69307690 CAGGAAGTGAGACAGGCTGATGG + Intronic
1129780212 15:78264866-78264888 CCGGACAAGAACCCGGATGAGGG + Exonic
1131122061 15:89828879-89828901 GAGGAAGGGATCCCGGCGGAAGG + Intergenic
1132539128 16:500078-500100 CAGGGACAGAACAAGGCTGAGGG - Intronic
1133019417 16:2960665-2960687 CAGAAAGAGGCCCCTGCTGAGGG - Intergenic
1133741596 16:8655878-8655900 CAGGAAGAGGAGAGGGCTGAGGG + Intergenic
1137456720 16:48623346-48623368 CAGGAAGCGCTCCCGGCTCAGGG + Intergenic
1137803966 16:51286449-51286471 GGGGAAGAGAACCCGGCTTGAGG + Intergenic
1138534238 16:57651508-57651530 CAGGAGGAGAGCCTGGCTCAGGG + Exonic
1140432766 16:74919014-74919036 CAGGAAGAGAAGCCAGATGTAGG - Intronic
1140605416 16:76530875-76530897 CAGGAAGCGAACAGGGTTGACGG + Intronic
1141497590 16:84420555-84420577 CAGGAGGGGATCCCGGGTGAGGG - Intronic
1141662034 16:85446644-85446666 CAGGCAGAGAACCCGCTCGATGG - Intergenic
1142995218 17:3756010-3756032 CAGGAAGAGAACCCGGCTGAGGG + Intronic
1145835148 17:27949286-27949308 CAGGAAGCCAACCAAGCTGAAGG - Intergenic
1146051222 17:29555072-29555094 CAGGGAGAGAAGGCTGCTGAGGG + Intergenic
1151952822 17:77364604-77364626 CAGGAAGAGACCAGGGCTGGGGG + Intronic
1152724800 17:81939906-81939928 CTGGGAGGGAGCCCGGCTGAGGG - Exonic
1153362558 18:4213892-4213914 AAGAAAGAGGACCTGGCTGAGGG + Intronic
1155693304 18:28653174-28653196 GTGGAGGAGAACCCTGCTGAAGG + Intergenic
1156368525 18:36451672-36451694 CAGGAACAGAGCCCTGCTCAAGG + Intronic
1157313001 18:46566307-46566329 CTGGACAAGAACCAGGCTGACGG - Intronic
1157789540 18:50519362-50519384 CAGGAAGAGAATTCAGCAGAGGG - Intergenic
1158045890 18:53154785-53154807 CAGGAGGAGAAGCAGGCTGAGGG + Intronic
1160142947 18:76341651-76341673 CAGGATGGGAACTGGGCTGAAGG - Intergenic
1161035143 19:2080240-2080262 CATGAAGAGGACCCAGCAGAAGG + Intronic
1161048419 19:2149634-2149656 AAGGAAGAAAACCAGGCTCAGGG + Intronic
1162340662 19:10089797-10089819 CAGGAAGAGGACTCGTCTGTAGG + Intronic
1162791029 19:13063046-13063068 CAGGAGCAGAACCCTGCTTAAGG + Intronic
1163129862 19:15265551-15265573 CAGGAGGAGGATTCGGCTGAGGG + Exonic
1163368683 19:16889969-16889991 CAGGTAGCGATCCAGGCTGACGG - Exonic
1163687110 19:18717891-18717913 CAGGAAGAGGACCTGGCAGTAGG + Intronic
1164243371 19:23409600-23409622 CAGAAAGAGAAGCCAGCTGGTGG + Intergenic
1165913109 19:39241819-39241841 CAGGAAGGGAACCGGGGTCAAGG - Intergenic
1167231327 19:48285795-48285817 TAGGAAGAATATCCGGCTGAGGG - Exonic
1167441640 19:49512724-49512746 CAGGAAGGGAGCGAGGCTGAAGG + Exonic
1167729396 19:51242468-51242490 CTGGAAGACAACCAGGCTTAAGG - Intronic
925800559 2:7595369-7595391 CATGCAGAGAACCCAGCTGCTGG - Intergenic
926697641 2:15781963-15781985 TAGGAAGTGACCCAGGCTGAAGG + Intergenic
929357315 2:41041354-41041376 CAGGAAGAGAGCCATCCTGAAGG + Intergenic
932549105 2:72748719-72748741 CAGGAAGGGAACCCCAATGATGG + Intronic
932600739 2:73123430-73123452 AAGGAAGAGAAACCCCCTGAAGG - Intronic
932720469 2:74135078-74135100 CAGGAAAAGAACCCGGATCCTGG + Intronic
934055487 2:88248009-88248031 GAGAAAGAGAACCCAGCAGAGGG - Intergenic
934736750 2:96693509-96693531 CAGGAAGACCACCCGAATGAAGG - Intergenic
935132154 2:100268753-100268775 GAGGAAGAGAACCAGGTGGAAGG - Intergenic
935694750 2:105761380-105761402 CAGAAAGAGAAACAGGCTAATGG - Intronic
935972100 2:108539795-108539817 GAGGAAAAGAACCAGGATGATGG - Intronic
937615541 2:123917747-123917769 CAGGAAAAGAACCAGGTTTAGGG - Intergenic
938122434 2:128643474-128643496 TAGGAAGAGGACCCAGATGAAGG + Intergenic
938135187 2:128750790-128750812 CAGGAAGAAATGCCTGCTGAGGG + Intergenic
938539748 2:132276134-132276156 AAGTAAGAGAGCCCAGCTGAAGG + Intergenic
938746544 2:134283823-134283845 CAGAAAGAGAACCCAGCGGCCGG - Intronic
945179154 2:207074353-207074375 AAGGTAGAGAACCCAGCTGGTGG - Exonic
947721126 2:232369826-232369848 CAGGAGGGGAAACCGGCTGCTGG + Intergenic
948545378 2:238724910-238724932 CAGGAAGAGCAGCAGGCTCAAGG + Intergenic
1169532266 20:6498400-6498422 CAGGTAGAGAAGCCGGCCAAGGG + Intergenic
1171868676 20:30509043-30509065 AAGTAAGAGAGCCCAGCTGAAGG + Intergenic
1172223820 20:33291121-33291143 CAGGATGGGAGCCCGGCTGGTGG - Intronic
1172516978 20:35541955-35541977 CTGTAAGAGAACGCGGCTAAAGG + Intergenic
1173188588 20:40859659-40859681 CAGGCAGAGAACGGGGCTGCTGG + Intergenic
1175681928 20:60995378-60995400 CATGCAGAGAACACGTCTGATGG - Intergenic
1178416780 21:32411560-32411582 CAGAAAGAAAATGCGGCTGAGGG - Intergenic
1179838165 21:44051523-44051545 ATGGAAGAGAACCAAGCTGAAGG + Intronic
1182831002 22:33304444-33304466 CAGGTAGAGGGCCAGGCTGATGG + Exonic
1183018192 22:35007059-35007081 CAGGATTAGAACCCTGCTCAAGG + Intergenic
1185171167 22:49295468-49295490 CAGGGAGGGAACCTGGCTGGAGG - Intergenic
1185346535 22:50313067-50313089 CAGGAAGTCATCCTGGCTGAAGG + Exonic
952484339 3:33794952-33794974 AATGGAGAGAACCCTGCTGAAGG - Intergenic
953244325 3:41176931-41176953 CAGGAGGTGAACCTGGCTGGTGG + Intergenic
953927393 3:46989397-46989419 CAGGAAGGGAACCCAGAGGAGGG + Intronic
954256589 3:49411755-49411777 CCGGAAGAGTACCGGGCTGGCGG + Intronic
955353816 3:58214059-58214081 CAGCAAGAGAAGCCAACTGAAGG - Intronic
955591427 3:60540048-60540070 CAGGAAGAGAGAGGGGCTGAAGG + Intronic
956212364 3:66814940-66814962 CAGGGAGAGAAAAGGGCTGAAGG - Intergenic
956510442 3:69988021-69988043 CAGGAAGTGAACAGGGCTCAGGG + Intergenic
960963350 3:123088088-123088110 CTGGGAGATAACCCGGCAGAGGG - Intronic
961473978 3:127135693-127135715 GAGGAAAAGAACCCGCGTGACGG - Intergenic
961977248 3:131039453-131039475 CAGGAAGAGAGCTGGGCTGCCGG - Intronic
966871535 3:184293026-184293048 AAGGAAGAGAGACAGGCTGACGG - Exonic
966902672 3:184498325-184498347 CAGGAAAAGAACACGGAGGAGGG - Intronic
966913885 3:184574519-184574541 AAGGAAGAGAATCGGGCAGAGGG - Intronic
968425257 4:518989-519011 CAGGAAGAGCATCAAGCTGATGG - Intronic
972474044 4:39433949-39433971 CAGGAAGGGAGCCAGGCAGAGGG + Intronic
974259238 4:59503551-59503573 CAGGCACTGAACCCAGCTGAGGG + Intergenic
978701377 4:111650697-111650719 AGGGAAGAGAACAAGGCTGATGG - Intergenic
979193897 4:117897161-117897183 CATGAGGAGCACCAGGCTGATGG - Intergenic
982228481 4:153187054-153187076 CAGGAAGATAACCCTGATGAAGG + Intronic
984154410 4:176176671-176176693 CAGAAAGAGAACACGGGAGAAGG - Intronic
985904583 5:2823403-2823425 CAAGAAGAGAAGGCGGTTGATGG + Intergenic
986734047 5:10655163-10655185 CAGGGAGAGAAGCGGGCAGAGGG - Intergenic
990314550 5:54571719-54571741 CAGGCACAGAACCCAGCTCAGGG - Intergenic
990537502 5:56737130-56737152 CTGGAAGATTACCTGGCTGAAGG - Intergenic
990556739 5:56943966-56943988 CAGGAAGAGAACCAGATTTAGGG + Intronic
991086330 5:62651311-62651333 CAGGAGGAGAAGCCAGCTGTAGG - Intergenic
992092152 5:73326857-73326879 CAGGGAGGGAAGCTGGCTGATGG + Intergenic
997042140 5:130269569-130269591 CAGGAAGAGAAACTAGCTGAAGG - Intergenic
997791779 5:136768546-136768568 CAGGAAGAGCATCTAGCTGAGGG - Intergenic
998388022 5:141769426-141769448 TAGGATGAGGGCCCGGCTGATGG - Intergenic
998806780 5:145924934-145924956 CAGGAAGAGAAGCCAGCAGTTGG + Intergenic
999821848 5:155236589-155236611 GAGGAAGAGAACCCGAAAGAGGG + Intergenic
1001170893 5:169417975-169417997 CAGGAAGAGAAAGTCGCTGAAGG + Intergenic
1001756598 5:174175123-174175145 CACGCAGAGACCCAGGCTGATGG + Intronic
1006390727 6:33756826-33756848 CAGGAAGAAAACCCAGTTCAAGG + Intergenic
1006396639 6:33791545-33791567 CAGCAGGAGAGCCAGGCTGAAGG - Intergenic
1006478548 6:34273578-34273600 CAGGAAGAGAAACCTGGGGAAGG + Intergenic
1007663032 6:43498001-43498023 CCAGAAGAGAGCCAGGCTGAGGG - Intronic
1010445116 6:75940872-75940894 CAGGAAGAGAAAGGGGGTGAGGG - Intronic
1012987240 6:105887854-105887876 CAAGCAGAGAACCCTGCTGTGGG - Intergenic
1015783865 6:136900660-136900682 CAGGAAGACAACCAGCTTGATGG + Intronic
1017941589 6:159057977-159057999 CAGGAAAAGACCCCGAATGATGG + Intergenic
1018616337 6:165690441-165690463 CTGGAGGAGAGCCAGGCTGAAGG - Intronic
1019103004 6:169647282-169647304 CAGGAAAAGGTCCCGGCTGAGGG + Intronic
1024230598 7:47360676-47360698 CAGCAAGAGACCAGGGCTGATGG - Intronic
1024996030 7:55273768-55273790 CAGGAGGCTACCCCGGCTGATGG + Intergenic
1025212140 7:57025874-57025896 CAGGAAGAGCACCCGTGGGAGGG - Intergenic
1025659814 7:63550954-63550976 CAGGAAGAGCACCCGTGGGAGGG + Intergenic
1026944172 7:74305825-74305847 CAGGGAGAGAAGCCAGCTGGGGG - Intronic
1030766935 7:113421780-113421802 CAGGAGCAGAACCCAGCTGAGGG - Intergenic
1030798900 7:113825029-113825051 CAGGAGGAGAACCTGACTGCAGG - Intergenic
1031594715 7:123636563-123636585 CAGGAAGAGAGTCTGGCTCATGG - Intronic
1033070742 7:138199415-138199437 TAGGAAGAGAACCCAGCTTTTGG - Intergenic
1034297684 7:149988769-149988791 AAGGTAGAGAACAGGGCTGAGGG + Intergenic
1034808339 7:154108084-154108106 AAGGTAGAGAACAGGGCTGAGGG - Intronic
1035736882 8:1894939-1894961 CAGGAAGAGAACCTGTGTGAGGG - Intronic
1038584957 8:28779914-28779936 CAGGCACAGAACCCGGCACATGG - Intronic
1040034151 8:42852239-42852261 AAGGAAGAGAACTTGGCTGAGGG - Intronic
1043030985 8:75133038-75133060 CAGAAAGAGAAGCCAACTGAAGG - Intergenic
1048361784 8:133703661-133703683 CAGGAAGAGAGGCCTGCTGCAGG - Intergenic
1048650998 8:136477558-136477580 TGGGAAGACAACCCAGCTGAGGG + Intergenic
1048806903 8:138249562-138249584 CAGGAAAGGAACCCAGCAGATGG + Intronic
1049804788 8:144533927-144533949 CAGGAAGAGCCCCCGGGGGAGGG + Intronic
1050583884 9:7089905-7089927 TAGGAATGGAACCCAGCTGACGG - Intergenic
1055712403 9:79077445-79077467 CAGGAAGAACACTGGGCTGAGGG - Intergenic
1056048302 9:82741895-82741917 CATGAAGAGAACACGCCTCATGG - Intergenic
1056692813 9:88822568-88822590 CAAGGAGAGAAACTGGCTGAGGG + Intergenic
1060251199 9:121987993-121988015 CCGGAAGAGGACCAGGCTGTTGG - Intronic
1186658889 X:11647530-11647552 GAGAAAGAGAATCCAGCTGAAGG + Intronic
1188626656 X:32293411-32293433 CAGGAAGAGAACCAGAAGGAGGG + Intronic
1190285349 X:48957616-48957638 CCGGGAGAGAACCCGGATGAGGG + Exonic
1190493359 X:51004252-51004274 CAGAAAAAGGACCCAGCTGACGG + Intergenic
1190759461 X:53427610-53427632 CAGGAGTAGAACCTGCCTGAGGG + Intronic
1192736171 X:73851367-73851389 CAGGAAAAGATGGCGGCTGAAGG - Intergenic
1195067952 X:101254505-101254527 CAGGCAGATAACCTCGCTGAGGG - Exonic
1196067996 X:111487171-111487193 CAGGAAGAGAAGCAGAATGAGGG - Intergenic
1197899603 X:131355980-131356002 CAGAAAGAAGACCAGGCTGAAGG - Intronic
1199770008 X:150969235-150969257 AAGGAAGAGGACCTGGCTGAGGG - Intergenic