ID: 1142996194

View in Genome Browser
Species Human (GRCh38)
Location 17:3761914-3761936
Sequence CCGGAGCCACCACGGTGTTT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142996194_1142996207 15 Left 1142996194 17:3761914-3761936 CCAAAACACCGTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1142996207 17:3761952-3761974 CGGTGCCTCCCCTTGGGGATGGG 0: 1
1: 0
2: 1
3: 10
4: 115
1142996194_1142996200 8 Left 1142996194 17:3761914-3761936 CCAAAACACCGTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1142996200 17:3761945-3761967 CACTCCCCGGTGCCTCCCCTTGG 0: 1
1: 0
2: 2
3: 20
4: 230
1142996194_1142996201 9 Left 1142996194 17:3761914-3761936 CCAAAACACCGTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1142996201 17:3761946-3761968 ACTCCCCGGTGCCTCCCCTTGGG 0: 1
1: 0
2: 0
3: 13
4: 129
1142996194_1142996208 16 Left 1142996194 17:3761914-3761936 CCAAAACACCGTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1142996208 17:3761953-3761975 GGTGCCTCCCCTTGGGGATGGGG 0: 1
1: 0
2: 1
3: 31
4: 223
1142996194_1142996198 -5 Left 1142996194 17:3761914-3761936 CCAAAACACCGTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1142996198 17:3761932-3761954 TCCGGACAACGGTCACTCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 49
1142996194_1142996206 14 Left 1142996194 17:3761914-3761936 CCAAAACACCGTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1142996206 17:3761951-3761973 CCGGTGCCTCCCCTTGGGGATGG 0: 1
1: 0
2: 4
3: 29
4: 207
1142996194_1142996202 10 Left 1142996194 17:3761914-3761936 CCAAAACACCGTGGTGGCTCCGG 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1142996202 17:3761947-3761969 CTCCCCGGTGCCTCCCCTTGGGG 0: 1
1: 0
2: 2
3: 23
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142996194 Original CRISPR CCGGAGCCACCACGGTGTTT TGG (reversed) Exonic
900544008 1:3218418-3218440 CCGGGGCCACCTCGGTGTGCGGG + Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
902250647 1:15152828-15152850 CCGGAGCCGCCACGGAGTTCTGG - Intronic
902966963 1:20012344-20012366 CCTGTGCCACCACTGTATTTTGG - Intergenic
902999696 1:20256304-20256326 CTGGGGCCAACAGGGTGTTTGGG + Intergenic
903006454 1:20302093-20302115 GCCAAGCCACCACGGTGTCTGGG - Intronic
920080959 1:203372644-203372666 AGGGAGCCACCACCATGTTTGGG + Intergenic
924841249 1:247711906-247711928 CTGGAGTCACCACAGTGTTCAGG + Exonic
1065483692 10:26217125-26217147 CCCGAGACACCGCGGTCTTTGGG - Intronic
1080393050 11:31865763-31865785 CAGGAGCCAGCAGGGTGTGTGGG + Intronic
1083626347 11:64073951-64073973 CCTGAGCCCCCAGGGTGCTTTGG + Intronic
1088626381 11:111733308-111733330 CCCGAGCCAGCACAGTGTCTGGG + Intronic
1090150725 11:124380825-124380847 TTGGATCCACCATGGTGTTTAGG - Intergenic
1090152010 11:124394675-124394697 TTGGATCCACCATGGTGTTTAGG - Intergenic
1101853294 12:108421685-108421707 CAGGAGCCACGACGGTGCTTTGG + Intergenic
1107055095 13:36094661-36094683 CTGGAGCCACTAGGGGGTTTAGG - Intronic
1108486009 13:50925838-50925860 CCAGAGACACCAAGGTGGTTAGG - Intronic
1108615588 13:52128974-52128996 CCGGAGCCGCCACAGGGCTTCGG - Intronic
1120124274 14:80722338-80722360 CTGGAGTCACCACAGTGTTCAGG - Intronic
1127883856 15:63181924-63181946 CCTGATTCACCAGGGTGTTTGGG + Intergenic
1132127836 15:99245187-99245209 CCAGTACCACCACGTTGTTTTGG - Intronic
1135182736 16:20289796-20289818 CTGGAGCCAGCACAGTGTGTGGG - Intergenic
1141532702 16:84657809-84657831 GCGGAGCCACCACTGTGTCGCGG + Exonic
1142996194 17:3761914-3761936 CCGGAGCCACCACGGTGTTTTGG - Exonic
1144749449 17:17638302-17638324 CCTGTGCCACCACTGTATTTTGG + Intergenic
934771789 2:96912176-96912198 CCGGAGCCAGCAGGGTCCTTCGG + Intronic
937218196 2:120326012-120326034 CCTCAGCCATCAAGGTGTTTGGG - Intergenic
937432345 2:121849565-121849587 CCTGAGCCACCGTGGTGTTGGGG + Intergenic
1173824935 20:46042246-46042268 GAGGAGCCACCAAGGGGTTTTGG + Intronic
1183246965 22:36701423-36701445 CAGGAGCCGCCACGGTGTAAAGG - Intronic
969538659 4:7772120-7772142 CAGGGGCACCCACGGTGTTTCGG + Intronic
975496967 4:75046001-75046023 CCGGGGCCTCCACGGTGGGTGGG + Intronic
983453180 4:167931616-167931638 CCTGACCCACCATGGTGCTTTGG + Intergenic
985653985 5:1120462-1120484 CCGGGGACACCACGGTGTGCTGG + Intergenic
985950819 5:3220294-3220316 CTGGAGCCACGAGGGTGTTGGGG - Intergenic
992772249 5:80059728-80059750 CCGGGGGCACCACCGTGCTTGGG - Exonic
995676577 5:114669255-114669277 CCTGAGGCAGCACAGTGTTTGGG - Intergenic
998406366 5:141876776-141876798 CGGGACCCACCAAGGTGTGTGGG + Intronic
1005716159 6:28550290-28550312 CCCGGGCCACCACTGTATTTTGG + Intergenic
1035353380 7:158261935-158261957 GCGCAGCCACCACGGGCTTTAGG - Intronic
1038182541 8:25242730-25242752 CCTCAGCCACCACAGTCTTTAGG - Intronic
1043891314 8:85654854-85654876 CCGTGTCCACCACGGTGTTGTGG + Intergenic
1045937502 8:107697875-107697897 CAGAAGCCACCTCAGTGTTTAGG + Intergenic
1049595896 8:143483250-143483272 CCCGAGCCAGCACGGTGATGGGG - Intronic
1062003074 9:134226511-134226533 CAGGAGGCACCAGGGTGTCTGGG - Intergenic
1186374897 X:8988530-8988552 CACGATCCACCACGGTGTTCAGG + Intergenic