ID: 1143001741

View in Genome Browser
Species Human (GRCh38)
Location 17:3799021-3799043
Sequence AATCCAGGACTGGCCTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 0, 3: 41, 4: 335}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143001741_1143001751 12 Left 1143001741 17:3799021-3799043 CCAGGCCAGGCCAGTCCTGGATT 0: 1
1: 0
2: 0
3: 41
4: 335
Right 1143001751 17:3799056-3799078 AGGAGGCCCAACCCGGCACAGGG 0: 1
1: 0
2: 0
3: 5
4: 91
1143001741_1143001748 5 Left 1143001741 17:3799021-3799043 CCAGGCCAGGCCAGTCCTGGATT 0: 1
1: 0
2: 0
3: 41
4: 335
Right 1143001748 17:3799049-3799071 CAGCCTAAGGAGGCCCAACCCGG 0: 1
1: 0
2: 1
3: 6
4: 103
1143001741_1143001753 18 Left 1143001741 17:3799021-3799043 CCAGGCCAGGCCAGTCCTGGATT 0: 1
1: 0
2: 0
3: 41
4: 335
Right 1143001753 17:3799062-3799084 CCCAACCCGGCACAGGGTACAGG 0: 1
1: 0
2: 1
3: 7
4: 85
1143001741_1143001745 -8 Left 1143001741 17:3799021-3799043 CCAGGCCAGGCCAGTCCTGGATT 0: 1
1: 0
2: 0
3: 41
4: 335
Right 1143001745 17:3799036-3799058 CCTGGATTCTCTCCAGCCTAAGG 0: 1
1: 0
2: 1
3: 19
4: 226
1143001741_1143001750 11 Left 1143001741 17:3799021-3799043 CCAGGCCAGGCCAGTCCTGGATT 0: 1
1: 0
2: 0
3: 41
4: 335
Right 1143001750 17:3799055-3799077 AAGGAGGCCCAACCCGGCACAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1143001741_1143001755 19 Left 1143001741 17:3799021-3799043 CCAGGCCAGGCCAGTCCTGGATT 0: 1
1: 0
2: 0
3: 41
4: 335
Right 1143001755 17:3799063-3799085 CCAACCCGGCACAGGGTACAGGG 0: 1
1: 0
2: 0
3: 2
4: 90
1143001741_1143001759 26 Left 1143001741 17:3799021-3799043 CCAGGCCAGGCCAGTCCTGGATT 0: 1
1: 0
2: 0
3: 41
4: 335
Right 1143001759 17:3799070-3799092 GGCACAGGGTACAGGGTGCTGGG 0: 1
1: 0
2: 3
3: 36
4: 356
1143001741_1143001746 -5 Left 1143001741 17:3799021-3799043 CCAGGCCAGGCCAGTCCTGGATT 0: 1
1: 0
2: 0
3: 41
4: 335
Right 1143001746 17:3799039-3799061 GGATTCTCTCCAGCCTAAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 121
1143001741_1143001758 25 Left 1143001741 17:3799021-3799043 CCAGGCCAGGCCAGTCCTGGATT 0: 1
1: 0
2: 0
3: 41
4: 335
Right 1143001758 17:3799069-3799091 CGGCACAGGGTACAGGGTGCTGG 0: 1
1: 0
2: 2
3: 23
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143001741 Original CRISPR AATCCAGGACTGGCCTGGCC TGG (reversed) Intronic
901068448 1:6505775-6505797 CCTCCAGGGCTGGCCTGGCTGGG - Intronic
901182029 1:7348400-7348422 AATCCAAGGTTGGCCTGGCGGGG - Intronic
901198791 1:7455066-7455088 CATCCAGGGCCGGCCTGGCTGGG + Intronic
901528531 1:9839299-9839321 AATCCAGGATTGGCAGGGCCAGG - Intergenic
901561260 1:10073237-10073259 ATTCCAGGTATGGCCTGACCAGG - Intronic
902399592 1:16150709-16150731 CATCCAGCCCTGGCCTGGGCCGG + Intronic
902411548 1:16214739-16214761 AACCCAGGTCTGGCCGGGCGTGG + Intergenic
902828109 1:18991237-18991259 AATTCAAGACCAGCCTGGCCTGG + Intergenic
904341433 1:29837414-29837436 AGACCTGGCCTGGCCTGGCCTGG + Intergenic
905357361 1:37394057-37394079 AATCCAGAACTTTCCTGTCCTGG - Intergenic
907177020 1:52533761-52533783 AGTTCAAGACTGGCCTGGCATGG + Intronic
908501700 1:64749499-64749521 AATGCAGGACTGGCCGGGCACGG - Intronic
908546756 1:65169710-65169732 ATTCCAGATCTGGCCTGGTCAGG + Intronic
908729852 1:67214859-67214881 AAACCAGGACTGGGCCTGCCTGG + Intronic
911151144 1:94597774-94597796 AATCTAGGTCTGGCCAGCCCTGG - Intergenic
912386817 1:109274872-109274894 AACACATGACTGGCCTGCCCGGG - Exonic
912564945 1:110580744-110580766 AAGTCAGGCCTGGGCTGGCCAGG - Intergenic
915139558 1:153758815-153758837 AACCCAGGCCTGGCCAGGCATGG + Intronic
915259609 1:154667335-154667357 AATCCACCACAGGCCTGGCATGG + Intergenic
916058403 1:161083361-161083383 AGTCCTGGCCTGCCCTGGCCTGG - Intronic
916074573 1:161193084-161193106 AATCCTGGACTGGGCTGGCGTGG + Intronic
916510675 1:165469992-165470014 ACTCCAGGAGTGGCAAGGCCTGG + Intergenic
917491672 1:175503598-175503620 AAGCCAGGACCTGCCTGCCCGGG - Intronic
918116562 1:181502992-181503014 CAAACAGGCCTGGCCTGGCCAGG - Intronic
918387966 1:184029586-184029608 AATCCAGGCCTGGCAAGGTCAGG + Intronic
918495361 1:185129556-185129578 AACCCAGGAATGGCCTGGAGTGG - Intronic
920134628 1:203759597-203759619 TATTCAGGACAGGCCTGGCACGG - Intergenic
920301237 1:204990310-204990332 CATCATGGCCTGGCCTGGCCTGG - Intronic
920674459 1:208029536-208029558 TTCCCAGGGCTGGCCTGGCCTGG + Intronic
922128612 1:222754655-222754677 AATCCAGGAGTGGCTTAGCTGGG - Intergenic
922937930 1:229435087-229435109 AACCCAGGACTGGCTAGACCTGG + Intergenic
923393324 1:233535497-233535519 AGTTCAGGACCAGCCTGGCCAGG + Intergenic
1063465652 10:6242384-6242406 TGCCCAGGACGGGCCTGGCCAGG + Intergenic
1063617152 10:7610261-7610283 AAGCCAGGACCTGCCTGGCTTGG - Intronic
1064421283 10:15192986-15193008 AAGCCAGGACTTGGCTGGCCTGG + Intergenic
1064455628 10:15484959-15484981 AACCCAGGACTGGCGAGGCACGG - Intergenic
1065298823 10:24302313-24302335 AATCCAGGAGTGGCCAACCCAGG - Intronic
1065389133 10:25164284-25164306 TATCCAGAACAGGCCTGGCATGG - Intergenic
1065673759 10:28152227-28152249 AATCCAGGAGTGGGCAGGCTAGG - Intronic
1065812854 10:29458484-29458506 CCTCCGGGAGTGGCCTGGCCAGG + Exonic
1065958832 10:30717010-30717032 CCTCCGGGAGTGGCCTGGCCAGG - Intergenic
1066183114 10:32982388-32982410 AATCCAGGGATGGCCAGGCACGG - Intronic
1067796080 10:49323215-49323237 AATCCAGAAATGGCCTGTCACGG + Exonic
1067970649 10:50966388-50966410 AAGCCAGGCCTGGCCGGGCGCGG - Intergenic
1069573078 10:69506337-69506359 AGTCCAGGACTTGCCTGGGGAGG + Intronic
1069589698 10:69634193-69634215 AGTCAAGGACTTGCCTGTCCTGG + Intergenic
1071450303 10:85787199-85787221 AATCCAGGACAGTCCTGGAAGGG + Intronic
1072703379 10:97661279-97661301 AATCCAGCAGTGGCCGGGCGCGG - Intronic
1073123036 10:101133483-101133505 CCTTCAAGACTGGCCTGGCCTGG - Intronic
1075092868 10:119453286-119453308 ATGCCAGGACTGGCCAGGCATGG - Intronic
1075732919 10:124646952-124646974 TACCCAGGAATGGCCCGGCCAGG - Intronic
1076409018 10:130232709-130232731 AAGCCTGGACTGCCCTGGGCTGG - Intergenic
1076454305 10:130578753-130578775 ACTCCAGGACTACCCTGCCCAGG - Intergenic
1076620414 10:131783818-131783840 CATCCAACACTGGCCTGGCATGG + Intergenic
1077074920 11:695995-696017 AAGCGCGGCCTGGCCTGGCCTGG + Intronic
1077077826 11:709236-709258 GATCCCTGACTGGCCTGGCCTGG - Intronic
1077991681 11:7417650-7417672 AACTCAAGACTGGCCTGGCCAGG - Intronic
1079308447 11:19344849-19344871 AATCCAGGAATCCCCTGGACAGG - Intergenic
1079364774 11:19799656-19799678 AATGCTGGACTGTCCTGGCAGGG - Intronic
1079468501 11:20756168-20756190 AATGCAGGTCTGGCCAGGCGCGG - Intronic
1080437606 11:32260358-32260380 AATGCAGCACTGGCCGGGCGCGG - Intergenic
1080604092 11:33849862-33849884 AGTCCAAGACCAGCCTGGCCAGG - Intergenic
1081667471 11:44925016-44925038 TGTCCTGGCCTGGCCTGGCCTGG + Intronic
1082000488 11:47391360-47391382 CAATCAGGCCTGGCCTGGCCTGG - Intergenic
1082898537 11:58219747-58219769 GATGCAGGACAGGCCTAGCCTGG - Intergenic
1083157219 11:60831254-60831276 AATTCATGAATGCCCTGGCCAGG + Intergenic
1084548205 11:69825051-69825073 AGTCCTGGCCTGGCCCGGCCGGG + Intergenic
1084961857 11:72721069-72721091 AGCCCAGGCCTGGCCTGGCCTGG + Intronic
1085186767 11:74582378-74582400 TGTCCTGGCCTGGCCTGGCCTGG + Intronic
1085412901 11:76302072-76302094 AATCCAGGACTTGCCAGGAAGGG + Intergenic
1085472639 11:76768008-76768030 GGTCCAGGCCTGGCCTGGCCAGG - Intergenic
1085485600 11:76860760-76860782 ACACCAGGTCGGGCCTGGCCCGG + Intergenic
1085777427 11:79379276-79379298 AACTCAGGCCTGACCTGGCCTGG - Intronic
1086262062 11:84952253-84952275 AAACCAGAACTGGCCGGGCGCGG + Intronic
1086824692 11:91482039-91482061 AATCCAGGCCTGGGCCTGCCTGG - Intergenic
1088738988 11:112751485-112751507 CTTCCAGGCCTGGCCTGGCCTGG + Intergenic
1090171947 11:124613071-124613093 TAAGCAGGACGGGCCTGGCCAGG + Exonic
1090744609 11:129696050-129696072 AAGCCGGGGCTGGCCCGGCCGGG + Intergenic
1090748155 11:129723562-129723584 CAGCCAGGGCTGGCCTGGTCGGG + Intergenic
1091229585 11:133979296-133979318 AATTCAGGAGTGGCTTGGCTGGG - Intergenic
1092880212 12:12882197-12882219 AATACAAAACTAGCCTGGCCTGG + Intergenic
1093067013 12:14668739-14668761 TGTCCATGACTGGCTTGGCCAGG - Intronic
1096309912 12:50511581-50511603 AATACATGATTGGCCCGGCCTGG - Intronic
1096809142 12:54158633-54158655 GCTCCAGGTCTGGCCTGGCTTGG - Intergenic
1100314341 12:93430463-93430485 AATCCAGGACTGGCTGGGTGGGG + Intronic
1101903942 12:108811661-108811683 AAGCCCGGCCTGGCCTGTCCTGG + Intronic
1101903944 12:108811664-108811686 CACCCAGGACAGGCCAGGCCGGG - Intronic
1102189050 12:110972155-110972177 AAACCAGGACGAGCCTGGCTTGG + Intergenic
1102729537 12:115096180-115096202 AACCCAGGTCTGGCCGAGCCAGG + Intergenic
1102947959 12:117006473-117006495 CATCCAGGTGTGGCCTGGACTGG - Intronic
1103008472 12:117439727-117439749 AAGCCTGAACTGGCCTGGTCTGG - Intronic
1103152716 12:118655307-118655329 AATCCAGGAGTGGCTTCTCCAGG - Intergenic
1103324829 12:120113526-120113548 AATACAGAACTGGCCGGGCGCGG + Intronic
1104105100 12:125651726-125651748 ACTCCAGGTCTCGGCTGGCCTGG + Intronic
1105277365 13:18943835-18943857 ACTCCAGGACACGCCGGGCCGGG + Intergenic
1106433577 13:29704959-29704981 AATCCAGGATTGGCAGAGCCGGG + Intergenic
1106780979 13:33058628-33058650 AATACAGGACAGGCCGGGCATGG - Intronic
1107411178 13:40160122-40160144 AATCCAGGGCTGGCCTGCTTGGG - Intergenic
1108129227 13:47279377-47279399 AAGCCAGGACAGGCCGGGCGTGG - Intergenic
1113451683 13:110414447-110414469 GTCCCAGGACTGGCCTGGGCTGG - Intronic
1113555482 13:111230574-111230596 AAGCCAGGAGTGGCCTTGCTGGG + Intronic
1113901874 13:113802210-113802232 CAGCCAGGATTGGCCTGGGCAGG + Intronic
1116457833 14:45139770-45139792 AGTTCAAGACTGGCCTGGGCAGG + Intronic
1116783525 14:49263533-49263555 AATCCTGGACTGGCTTTGCCTGG - Intergenic
1117345492 14:54827763-54827785 CTTCCAGGACTCACCTGGCCTGG + Intergenic
1117716359 14:58585686-58585708 AATCCAGGCATGGCCTGACTGGG - Intergenic
1118106508 14:62666127-62666149 AATCCAGGACAGGCCAGGTGTGG + Intergenic
1121019526 14:90570714-90570736 AATCCAGGTCGCGCCTGGGCTGG - Intronic
1121098535 14:91234100-91234122 GCTCCAGGACCGGCCGGGCCAGG - Exonic
1121341304 14:93106746-93106768 CACCCAGCACAGGCCTGGCCAGG + Intronic
1121437867 14:93930800-93930822 ACTCCAGGATTCCCCTGGCCTGG + Intergenic
1121445805 14:93978037-93978059 AACCTAGGAGGGGCCTGGCCTGG - Intergenic
1121707875 14:96012986-96013008 AAACCAGGCCTGGGCTTGCCTGG + Intergenic
1122600179 14:102917485-102917507 AATCTAGGAATGGCCTGCCCAGG + Intergenic
1122857584 14:104567290-104567312 GAGCCAGGGCTGCCCTGGCCTGG + Intronic
1123687656 15:22810840-22810862 AATCCATCACTGGTCTGGGCAGG + Intronic
1125479222 15:40069196-40069218 ACTCCAGGGCTGGCCGGGCCAGG - Intergenic
1125955364 15:43787287-43787309 AACCCAGGCCTGGCCGGGCGTGG - Intronic
1128686307 15:69688499-69688521 AATCCAGGAGTGGCTTGGCTGGG - Intergenic
1129325849 15:74799976-74799998 ATGCCAGGTGTGGCCTGGCCAGG - Intronic
1130092198 15:80830411-80830433 GAGCCAGGACTGGCATGCCCTGG + Intronic
1130878036 15:88031424-88031446 ACCCCAGGACTGGCCTGGGTAGG - Intronic
1132906301 16:2284488-2284510 CCTCCAGGACGGGCCTGGTCAGG + Intronic
1132946730 16:2535887-2535909 AATCCAGGAGAGGCCAGGCTGGG - Intergenic
1133031464 16:3013222-3013244 AACTGAGGACTGGCCTGGCTTGG + Exonic
1133184971 16:4089586-4089608 AACCCAGGAGTGGCATGGCTGGG + Intronic
1135428126 16:22357337-22357359 ACTACAGTACTGGCCTGGCACGG - Intronic
1135514731 16:23121445-23121467 AGCCTAGGCCTGGCCTGGCCCGG + Intronic
1135996357 16:27252364-27252386 AACCCAGGAATGGCCAGGCACGG + Intronic
1137871775 16:51956608-51956630 AAGCCAGGCCTGGCTTGGACAGG + Intergenic
1138185179 16:54971247-54971269 AAGCCAGCACTGCCCTGGCCGGG + Intergenic
1138221944 16:55259269-55259291 AATCCTGGTCTGGCTTGGCCTGG - Intergenic
1139386536 16:66576104-66576126 AACTCAGGACTGGCCGGGCGCGG + Intronic
1139474642 16:67196942-67196964 AATCCAGGACAGAGGTGGCCAGG - Intronic
1142134366 16:88444835-88444857 TTTCCAGGCCTGCCCTGGCCTGG + Intergenic
1142355572 16:89600049-89600071 GATCCAGGCCTGGCCAGGCAGGG + Intergenic
1142492272 17:286767-286789 AAGCCAGGACTCGCTTGCCCTGG - Intronic
1142595505 17:1027821-1027843 AATAGAAGTCTGGCCTGGCCCGG - Intronic
1142753148 17:2000190-2000212 AAACTAGGAAAGGCCTGGCCGGG - Intronic
1143001741 17:3799021-3799043 AATCCAGGACTGGCCTGGCCTGG - Intronic
1143068006 17:4264913-4264935 AGTCCAGGACAGGCCGGGCGTGG + Intergenic
1143107101 17:4535351-4535373 AAGCCAGGCCTCGACTGGCCTGG - Intronic
1143112605 17:4560641-4560663 AATCCAGAACAGGTCTGGGCAGG + Exonic
1143890423 17:10098256-10098278 CCTCTAGGACTAGCCTGGCCAGG + Intronic
1144653607 17:17021753-17021775 GGTGCAGGGCTGGCCTGGCCTGG + Intergenic
1145092059 17:19994178-19994200 AATTCAGGCCAGGCCAGGCCTGG - Intergenic
1146109508 17:30075523-30075545 AATCGAGGGATGGCCTGGCCTGG - Intronic
1146341895 17:32026717-32026739 AATGTAGTCCTGGCCTGGCCTGG - Intronic
1147264776 17:39227936-39227958 AAGGCTGGACTGGCCTGGGCTGG - Intergenic
1148198718 17:45733616-45733638 TAGACAGGAATGGCCTGGCCGGG + Intergenic
1148755776 17:49972268-49972290 GATCCAGGAGTGGCCCCGCCGGG + Intronic
1148896682 17:50843021-50843043 AATCCAGGCCCAGCCTAGCCTGG + Intergenic
1149382717 17:56109895-56109917 AATGCAGGGCTGGCCAGGCTGGG + Intergenic
1151205433 17:72502901-72502923 AAGTCAGGACTGGTTTGGCCAGG + Intergenic
1151751269 17:76039602-76039624 AATCCAGGTCTGCATTGGCCCGG - Exonic
1152045548 17:77932781-77932803 ATTCCAGGACTGGTCGGGCCAGG + Intergenic
1152624322 17:81381283-81381305 ATCCCAGCACTGGCCTGGCCCGG - Intergenic
1153705047 18:7736801-7736823 AAACCAGGCCTGGCCCTGCCTGG - Intronic
1154358468 18:13640654-13640676 GGTCCAGGGCTGGCTTGGCCCGG + Intronic
1156038438 18:32793050-32793072 AATACAGGCCTGGCCAGGCATGG + Intergenic
1156050794 18:32931253-32931275 AAACCAGGACTGTCCTAGCCTGG - Intergenic
1159047506 18:63383218-63383240 AATTCAGGAAGGGCTTGGCCAGG - Intergenic
1160388855 18:78515143-78515165 AGCCCAGGTCTGTCCTGGCCAGG + Intergenic
1160749360 19:726791-726813 AATCAATGACTGGCCGGGCACGG - Intronic
1161073504 19:2273922-2273944 AATCAGGGCCAGGCCTGGCCGGG + Intronic
1161229902 19:3168969-3168991 ATTTCAAGACTAGCCTGGCCAGG - Intergenic
1162484042 19:10947743-10947765 ATTCCAGTACTGGCCGGGCCTGG + Intergenic
1162615584 19:11798194-11798216 AATCCAGGCCAGGCCAGGCCAGG - Intronic
1163498489 19:17661401-17661423 AATAGAGGACTGGCCAGGCATGG + Intronic
1163596177 19:18222251-18222273 AGTCCAGCCCTGGCCTGGGCCGG - Exonic
1164816926 19:31211501-31211523 AAGGCAGGACTGGGCTAGCCTGG + Intergenic
1165615714 19:37198460-37198482 AACACTGGAATGGCCTGGCCTGG - Intronic
1165994820 19:39836616-39836638 AATCCGGGTCTGGTCTGGCTGGG + Exonic
1166814362 19:45533637-45533659 ACTCCAGGGCAGGCCAGGCCAGG + Intronic
1166814365 19:45533650-45533672 AAGCTTGGCCTGGCCTGGCCTGG - Intronic
1166945456 19:46393542-46393564 CATCCAGGGCTGGCCGGGCACGG + Intergenic
1167426479 19:49432345-49432367 CATCCAGGCCTGCCCTGCCCCGG + Intronic
1167527186 19:49991824-49991846 AATCCAGGACTGCACTGTCTCGG - Intronic
1167538494 19:50070725-50070747 TGCCCTGGACTGGCCTGGCCTGG + Intergenic
1168376778 19:55886584-55886606 AAACCAGGGATGGCCTGGCATGG - Intergenic
925090993 2:1155982-1156004 TGTCCTGGCCTGGCCTGGCCTGG - Intronic
926400497 2:12491596-12491618 GGTGCCGGACTGGCCTGGCCAGG + Intergenic
927137187 2:20105540-20105562 GATCCAGGGCTGGCTTTGCCCGG + Intergenic
927694667 2:25231607-25231629 CATCCAGGTCTGTCTTGGCCAGG - Exonic
927757374 2:25719837-25719859 CAGGCAGGACTGGACTGGCCAGG - Intergenic
928319278 2:30270250-30270272 AAACCAGGGCTGGCTTGCCCTGG + Intronic
928332076 2:30365350-30365372 AATCCCAGATTGGGCTGGCCTGG + Intergenic
933752465 2:85611823-85611845 ACTCCTGGCCTGGCCTGGCCCGG - Intronic
934656524 2:96119261-96119283 AATCCAACACTGGCCTGGCGGGG - Intergenic
935113670 2:100114670-100114692 AATGCAGGGCTGGCCAGGCGTGG - Intronic
935898219 2:107760613-107760635 AACCCAGGTCTGGCCTGGTGCGG - Intergenic
936020694 2:108992836-108992858 CTCCCAGGACTGACCTGGCCTGG + Intergenic
937127400 2:119483208-119483230 CATCCAGCACAGGCCTGGCATGG - Intronic
937653416 2:124346778-124346800 AATCCAGTACTGACCAGGCATGG + Intronic
938263830 2:129912556-129912578 CAGACAGGACTGGCCTGGCTGGG - Intergenic
940035167 2:149305086-149305108 TATTCAGGAGTGCCCTGGCCTGG - Intergenic
945819836 2:214650578-214650600 AATCCAGGAATGGCTTTGCTGGG - Intergenic
946654067 2:221926105-221926127 AATTCTGAACTGGCCTGACCAGG + Intergenic
947623193 2:231604081-231604103 CACCCAGGGGTGGCCTGGCCTGG + Intergenic
948659015 2:239495336-239495358 AATCCAGGGCTGGGCTGGGGAGG + Intergenic
1171871976 20:30535523-30535545 AGTTCAAGACTAGCCTGGCCAGG - Intergenic
1171943169 20:31350536-31350558 AATTCAGGAGTGGCTTGGCAGGG - Intergenic
1172034594 20:32002135-32002157 AAACCAGGCCAGGCCTGGACAGG - Exonic
1172445432 20:34990831-34990853 CACCCAGGGCTGGCCTGGCTGGG + Intronic
1173220833 20:41131847-41131869 AGTGCAGGTCTGCCCTGGCCTGG + Intergenic
1174011508 20:47453514-47453536 AATCCAGGAGTGGCTTTGCTGGG + Intergenic
1174796888 20:53529597-53529619 AGTTCAAGACTGGCCTGGCCTGG + Intergenic
1175069274 20:56318296-56318318 GATACAGAACTGGCCTGGCATGG + Intergenic
1175252337 20:57617023-57617045 AATCCAGGAATGGCATTTCCAGG - Intronic
1176216910 20:63952341-63952363 AAGCCAGCACTGTGCTGGCCAGG + Intronic
1176273201 20:64247163-64247185 ATCCCAGGACTGGGCTGCCCGGG + Intergenic
1178487455 21:33027886-33027908 AAGCGAGGACTGGCCTGCGCTGG + Exonic
1178987340 21:37318125-37318147 AATCCAAAACTGGCCGGGCGCGG + Intergenic
1179190514 21:39118610-39118632 CATCCAGGCCTGGTCTGTCCTGG - Intergenic
1179397716 21:41056599-41056621 TATTCAGGACTGGACTGTCCTGG - Intergenic
1179767952 21:43588085-43588107 CATCCAGTACTGGCCCGGCACGG + Intronic
1179885698 21:44313397-44313419 AGTCCTGGGCTGGCCAGGCCTGG + Intronic
1179939388 21:44628219-44628241 AAGCCAGGGCTCGCCTGCCCGGG - Exonic
1180087539 21:45514676-45514698 GATTCAGGGCCGGCCTGGCCTGG - Exonic
1180144376 21:45911051-45911073 AATCCAGCACTGACGTGGGCTGG - Intronic
1180675342 22:17582468-17582490 ACTCAGGGACTGGCCTGGCTAGG + Intronic
1180797187 22:18611615-18611637 AGTCCAGCCCTGGCCTTGCCAGG - Exonic
1181224536 22:21383656-21383678 AGTCCAGCCCTGGCCTTGCCAGG + Exonic
1181254096 22:21551157-21551179 AGTCCAGCCCTGGCCTTGCCAGG - Exonic
1181715452 22:24723966-24723988 AATCCATGAATGGCCTGGCGTGG - Intronic
1181802962 22:25359130-25359152 AAAAGAGGCCTGGCCTGGCCAGG + Intronic
1182120654 22:27784244-27784266 CACTCAGGCCTGGCCTGGCCTGG - Intronic
1182237629 22:28888825-28888847 AACCCAGGTCTGGCCGGGCGCGG + Intronic
1183948452 22:41339760-41339782 AAAACAGGACTGCCCAGGCCTGG - Intronic
1184274430 22:43402015-43402037 ACTCCAGGCCTGGCCTGGTGCGG + Intergenic
1184974580 22:48051979-48052001 TAACCTGGGCTGGCCTGGCCGGG - Intergenic
1185048116 22:48539233-48539255 AAGACAGGACTGGCCCAGCCAGG + Exonic
1185306679 22:50121493-50121515 AACCCAGCACTGCCCAGGCCGGG - Intronic
949438997 3:4060280-4060302 AATCCATGTCTGGCCTGCCAGGG + Intronic
949881372 3:8663600-8663622 ATTCCTGGACTTGCCTGGGCTGG - Intronic
950030117 3:9846589-9846611 CAGCCTGGCCTGGCCTGGCCTGG - Intronic
951187478 3:19730508-19730530 AAGCCAGGCCAGGCCAGGCCAGG - Intergenic
954448789 3:50560699-50560721 ATCCCAGGACTGCCTTGGCCTGG + Intronic
954514065 3:51155267-51155289 AATCCAGGGCAGGGCTGGGCTGG - Intronic
954674263 3:52307051-52307073 TATCCTAGCCTGGCCTGGCCTGG + Intergenic
955245485 3:57220961-57220983 AATGTAAGAGTGGCCTGGCCTGG - Intronic
955317850 3:57953631-57953653 ACTCAGGGCCTGGCCTGGCCTGG - Intergenic
956121886 3:65974562-65974584 AATCCAAGACTGGCCTAGCTGGG + Intronic
956868836 3:73396439-73396461 AATCCAGGATGGGGCTGACCAGG + Intronic
957681191 3:83438375-83438397 AACCCATGACTGTGCTGGCCTGG - Intergenic
959484684 3:106913380-106913402 TCTCCTGGACTGGCCTGGCCCGG - Intergenic
960155989 3:114297655-114297677 TCTCCATGAATGGCCTGGCCTGG - Intronic
960628309 3:119702914-119702936 AAAGCAGGAGTGGCCAGGCCAGG - Intergenic
960818980 3:121706920-121706942 AACCCATGACTGGCCAGGCACGG + Intronic
961139367 3:124542880-124542902 AATCCAAGATTGGCTTTGCCTGG + Intronic
961365886 3:126398952-126398974 GAACCAGGCCTGGCCTGGCCAGG - Intronic
962231168 3:133666744-133666766 AATTCAGGCCTGGCCAGGCATGG + Intergenic
964350327 3:155796898-155796920 AATGAAGGACAGGCCTGGCATGG + Intronic
964428664 3:156580311-156580333 TATCCAGCACAGACCTGGCCTGG + Intergenic
966163545 3:176992092-176992114 AACCCATGAATGGCCTGGCGTGG - Intergenic
966820078 3:183917326-183917348 AACCCAGGGCAGGACTGGCCAGG + Intergenic
968047157 3:195630900-195630922 AGTCCAGGAGGAGCCTGGCCAGG + Intergenic
968307490 3:197659144-197659166 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
968976688 4:3825778-3825800 AATTCAGGAGGGGCTTGGCCAGG - Intergenic
969315138 4:6377358-6377380 AATCCAGGTGTGTCCTGGCTGGG + Intronic
969317623 4:6391430-6391452 AGTCCAGGACTTGCCTGGCGAGG - Intronic
970159471 4:13174579-13174601 ATTGTAGGACTGGACTGGCCTGG - Intergenic
970922419 4:21410674-21410696 AATTCAGAAATGGCCTGGCTGGG - Intronic
971402416 4:26288212-26288234 AATCCAGGAGTGGCTTAGCTGGG + Intronic
972274700 4:37546304-37546326 AAACCAGGACTGGGCCTGCCTGG + Intronic
973632915 4:52836183-52836205 AATGCAGGAGTGGCTTTGCCAGG + Intergenic
973970690 4:56211390-56211412 AAGCCAGGCATGGCCTGGGCAGG - Intronic
974373675 4:61049021-61049043 AATCCTGGACTAGAGTGGCCTGG - Intergenic
974880720 4:67753844-67753866 AGTCCATGGTTGGCCTGGCCTGG - Exonic
975579934 4:75897146-75897168 AATAAAGGTGTGGCCTGGCCAGG - Intronic
977179839 4:93859555-93859577 AGTCCAAGACCAGCCTGGCCAGG + Intergenic
978375674 4:108073057-108073079 AATCAAGGATTAGCCAGGCCTGG - Intronic
982189667 4:152841322-152841344 GATACAGAACTGGCCTGGCACGG - Intronic
982752582 4:159179750-159179772 AATCCAGCTCTGCCCTGCCCAGG - Intronic
985520428 5:371637-371659 AGTCCAGGACTGGTCAGCCCAGG - Intronic
985650218 5:1104092-1104114 GACCCAGGAGGGGCCTGGCCTGG + Intronic
985744447 5:1638233-1638255 AGTCCAGGAGGAGCCTGGCCAGG - Intergenic
986000387 5:3626657-3626679 AAGGCAGGAGTGTCCTGGCCTGG + Intergenic
986557960 5:9030345-9030367 AATCCAGGAGTCGCCTCACCAGG + Intergenic
987554902 5:19434078-19434100 AATCCAGCATTGGCCGGGCGCGG - Intergenic
993219303 5:85070064-85070086 AAGCCAGGTGTGGCCTGGGCAGG + Intergenic
995555416 5:113323232-113323254 AATCCAGGAGTGGCTTGGCTGGG - Intronic
997603069 5:135153723-135153745 AGACCAGGACTGGTCTGACCTGG - Intronic
997667362 5:135642396-135642418 AACCCAGGACTGCCCTGTCAGGG + Intergenic
998016219 5:138734400-138734422 ACTCCAGGACTGGGCATGCCAGG - Intronic
998371981 5:141667716-141667738 AATACAGTACTGGCCGGGCGTGG - Intronic
998408104 5:141886027-141886049 AATCCCAGTCTGGCCAGGCCTGG + Intergenic
999187940 5:149726742-149726764 AATGAAGGAGCGGCCTGGCCTGG - Intergenic
999261651 5:150242129-150242151 AGTCCAGGCCTGGGGTGGCCGGG + Intronic
1000264286 5:159619826-159619848 AATCCAGGACTGGAAGGTCCAGG + Intergenic
1001629666 5:173165368-173165390 CCTCTAGGACTGGCCTAGCCTGG - Intergenic
1001779566 5:174356226-174356248 TATTCAGGGCTGGACTGGCCTGG - Intergenic
1001855201 5:175004772-175004794 ACTGCAGGACTGGCCTGCCCTGG + Intergenic
1002599197 5:180344751-180344773 ACGCCAGGCCTGCCCTGGCCAGG + Intronic
1002640620 5:180629025-180629047 AATCCAGGACTGACCCGTCGTGG + Intronic
1003749786 6:9042455-9042477 AATCCAGAAGTGGCTTGGCTGGG + Intergenic
1005615880 6:27572877-27572899 AATGGAGGACTAGCCTGGCACGG + Intergenic
1005953221 6:30646549-30646571 TGTCCAGGACTGGGCTGGCGGGG - Exonic
1007325282 6:41054748-41054770 AATTGAGGACTCTCCTGGCCAGG - Intronic
1007790898 6:44307508-44307530 AGCCCAGGACTGGACTGGCAAGG - Exonic
1007842364 6:44727377-44727399 TATCCAGGGCTGTCATGGCCTGG + Intergenic
1007843880 6:44738416-44738438 TTTTGAGGACTGGCCTGGCCAGG - Intergenic
1008174167 6:48246188-48246210 AAACCAGGAGTTGCTTGGCCTGG - Intergenic
1010477842 6:76311002-76311024 AATCTAGGAATGGCCTAGCTGGG - Intergenic
1011734689 6:90298369-90298391 ATTCCTGGTCTGCCCTGGCCAGG + Intergenic
1012891157 6:104899063-104899085 AATTCAAGACCGGCCTGGCCAGG - Intergenic
1014057256 6:117030562-117030584 ACCCCAGGGCTGGGCTGGCCTGG - Intergenic
1017981080 6:159401643-159401665 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1018130901 6:160731809-160731831 ATGCCAGGACTGGGCTGCCCAGG + Exonic
1018688098 6:166319083-166319105 AATCCAGGAGTGGGCTGGGGTGG - Intergenic
1018734555 6:166677808-166677830 AAAACAAGACTGGCCTGGTCTGG + Intronic
1019168774 6:170117004-170117026 AGCCCAGGACTGGCCTCTCCTGG - Intergenic
1019307383 7:342281-342303 CATCCCGGTCTGGCCAGGCCTGG - Intergenic
1019530705 7:1501865-1501887 AATGGAGGCCTGGCCTGGCCTGG - Intronic
1019533599 7:1516013-1516035 AAATCAGGACTGCCCTGGACAGG - Intergenic
1020109110 7:5438164-5438186 AGGCCAGGACAGGGCTGGCCAGG + Intronic
1022097952 7:27152464-27152486 CCGCCAGGCCTGGCCTGGCCGGG + Intronic
1022107364 7:27206018-27206040 AGTCCTGGACTGGCGTTGCCAGG + Intergenic
1022175659 7:27869639-27869661 CATCCAGGACGGGGCAGGCCAGG + Intronic
1022233690 7:28440506-28440528 AAGCCAGGGCAGGACTGGCCTGG - Intronic
1022871712 7:34487024-34487046 AATCCAGTTCTGGCCGGGCGCGG + Intergenic
1023112385 7:36826778-36826800 GATCCAGGACTGGCCAAGCAAGG - Intergenic
1024629294 7:51234348-51234370 ATGCCAGGTCTGGCCTTGCCGGG - Intronic
1026083115 7:67240003-67240025 ACTGCAGGACTGGCCGGGCGTGG - Intergenic
1026962544 7:74417846-74417868 AGGCCAGGACAGTCCTGGCCCGG - Intergenic
1027257327 7:76439413-76439435 AGCCCAGGACTGGCCAGGCACGG + Intronic
1027281520 7:76612628-76612650 AGCCCAGGACTGGCCAGGCACGG - Intronic
1029172759 7:98642516-98642538 AGTCCAGGAGTGGCCTTGCTGGG + Intergenic
1029174670 7:98656101-98656123 AACCCAGGAGTGTCCAGGCCTGG - Intergenic
1029274855 7:99397923-99397945 AAGCCAAGGCTGACCTGGCCCGG - Exonic
1029431664 7:100535089-100535111 TTTCCAGCTCTGGCCTGGCCTGG + Intergenic
1029700252 7:102241812-102241834 AATCCAGGATTAGCCAGGCGTGG + Intronic
1030687858 7:112505039-112505061 AATCCAAGACTTGCCAGGCAGGG - Intergenic
1030715144 7:112800704-112800726 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1032068217 7:128788793-128788815 AACCCAGTACTGGTCTGGCCAGG + Intergenic
1035171315 7:157018964-157018986 GCTCCAGGACTGTCCTTGCCGGG - Intergenic
1035682084 8:1495520-1495542 GAGCCAGGACTGCGCTGGCCCGG + Intergenic
1037717493 8:21412352-21412374 ATTCCAGGCCTGGCCTGGGGAGG - Intergenic
1038783442 8:30588956-30588978 AAAAAAGTACTGGCCTGGCCGGG + Intronic
1039502912 8:38031073-38031095 GATCCAGGAGAGGCCTGGCCTGG + Intronic
1039818789 8:41118202-41118224 AATGAAGGACTGGCCTCACCAGG - Intergenic
1040293048 8:46135287-46135309 CTTCCAGGACTGTCCTGGGCGGG - Intergenic
1040305803 8:46211174-46211196 AATCCAGGACTGTCCCGGACGGG + Intergenic
1040392439 8:46961596-46961618 TATCCTGGACTGGCCTGCCCTGG - Intergenic
1041606405 8:59786976-59786998 AAGCCTGGACTGACTTGGCCAGG + Intergenic
1042571210 8:70167060-70167082 AATCCAGGACTGGACTTGAAGGG - Intronic
1043139955 8:76575688-76575710 AATCAACCACTGGCATGGCCAGG + Intergenic
1044162709 8:88940064-88940086 AATCCAGGGATGGCATTGCCTGG + Intergenic
1044992050 8:97804789-97804811 ACTACTGGCCTGGCCTGGCCTGG + Intronic
1045569320 8:103353189-103353211 TAACTAGGACTGGCCTGGTCAGG - Intergenic
1049523186 8:143105437-143105459 AATCCTGGCCTGGCCAGGCATGG - Intergenic
1049688892 8:143950199-143950221 GCTCCGGGCCTGGCCTGGCCAGG + Exonic
1052892858 9:33720066-33720088 AAGCCGGGGCTGGCCCGGCCGGG + Intergenic
1053253529 9:36595429-36595451 AAGACCAGACTGGCCTGGCCGGG - Intronic
1057088507 9:92234491-92234513 ACTCCAGGACTGGCCATTCCTGG - Intronic
1057229234 9:93308807-93308829 AGCCCTGGCCTGGCCTGGCCTGG - Intronic
1057471523 9:95361111-95361133 ACTCCAGATGTGGCCTGGCCAGG + Intergenic
1057847921 9:98539626-98539648 AAAGCAGGTCTGGCCGGGCCCGG + Intronic
1058378438 9:104352357-104352379 AATCCAGGGCTGGCTTAGCTAGG + Intergenic
1058563185 9:106251132-106251154 AATCCAAGACTGGCCGGGCGCGG - Intergenic
1060279464 9:122206247-122206269 AGACCAGCACTGGCCTGGCCAGG - Intronic
1060723973 9:125995382-125995404 CATCCTGGCCTGGCCAGGCCAGG + Intergenic
1060920984 9:127420172-127420194 TAGCCAGGTCTGGCCTGGCGTGG + Intergenic
1061060130 9:128246104-128246126 TATCCAGGACTTGCCTGGGGAGG + Intronic
1061097326 9:128466173-128466195 AAAAGAGGACTGGCCGGGCCTGG + Intronic
1061259254 9:129470657-129470679 AATCCAGGCATGGCCAGGACAGG + Intergenic
1062329630 9:136032604-136032626 TATCCAGAACAGGCCAGGCCTGG + Intronic
1062333544 9:136055107-136055129 GATCCAGGCCTGCCCTGCCCTGG + Intronic
1187429249 X:19206614-19206636 CATCCAGGCTGGGCCTGGCCTGG + Intergenic
1190278457 X:48914110-48914132 AAGCCTGGCCTGGCCTGGCCTGG - Exonic
1190329807 X:49228855-49228877 AATCTAGGACTGGCCGGGCACGG - Intronic
1192057103 X:67784250-67784272 AATCCAGGACAAGCCCAGCCTGG + Intergenic
1192224163 X:69217028-69217050 GATACAGAACTGGTCTGGCCAGG + Intergenic
1192321307 X:70092684-70092706 ACTACATGACTCGCCTGGCCTGG - Intergenic
1192496310 X:71618402-71618424 AATTCTGGCCTGGCCTGGCTGGG + Intronic
1199858999 X:151782787-151782809 CATCCAGGACTGGATTAGCCTGG + Intergenic
1201416805 Y:13755164-13755186 AATCCAGCACTGCTCTGACCTGG + Intergenic