ID: 1143002341

View in Genome Browser
Species Human (GRCh38)
Location 17:3802559-3802581
Sequence GAGGTTCAACAGAAGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143002341_1143002346 -5 Left 1143002341 17:3802559-3802581 CCATCCTACTTCTGTTGAACCTC 0: 1
1: 0
2: 0
3: 12
4: 211
Right 1143002346 17:3802577-3802599 ACCTCGTCCCAGGCAGGATCGGG 0: 1
1: 0
2: 0
3: 9
4: 143
1143002341_1143002351 3 Left 1143002341 17:3802559-3802581 CCATCCTACTTCTGTTGAACCTC 0: 1
1: 0
2: 0
3: 12
4: 211
Right 1143002351 17:3802585-3802607 CCAGGCAGGATCGGGGCCTGCGG 0: 1
1: 0
2: 6
3: 43
4: 390
1143002341_1143002348 -4 Left 1143002341 17:3802559-3802581 CCATCCTACTTCTGTTGAACCTC 0: 1
1: 0
2: 0
3: 12
4: 211
Right 1143002348 17:3802578-3802600 CCTCGTCCCAGGCAGGATCGGGG 0: 1
1: 0
2: 1
3: 5
4: 110
1143002341_1143002345 -6 Left 1143002341 17:3802559-3802581 CCATCCTACTTCTGTTGAACCTC 0: 1
1: 0
2: 0
3: 12
4: 211
Right 1143002345 17:3802576-3802598 AACCTCGTCCCAGGCAGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143002341 Original CRISPR GAGGTTCAACAGAAGTAGGA TGG (reversed) Intergenic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
902397484 1:16140249-16140271 GAGGGTCTGCAGAAGCAGGATGG - Intronic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904437348 1:30507435-30507457 GAGGTTGCACAGAGGAAGGAGGG - Intergenic
905756648 1:40515696-40515718 TAGGTACAACAGGAGCAGGAAGG - Exonic
906200260 1:43955672-43955694 GAGGTTATACTGGAGTAGGATGG - Intronic
908621952 1:65991994-65992016 GAGCTTAAACAGAAGAATGAGGG + Intronic
909536699 1:76745171-76745193 GAGATTCAACAGCAGAAGAAAGG - Intergenic
909694421 1:78450056-78450078 CAGGTGCAACAGAAGCAGCATGG - Intronic
910131685 1:83915099-83915121 GCGGTTCAGCTGAAATAGGAAGG + Intronic
910688199 1:89939727-89939749 GGGGTCCCACAGCAGTAGGAGGG - Intergenic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911632570 1:100199742-100199764 GAGGGCCAGCAGAAGCAGGATGG + Intronic
912870868 1:113304237-113304259 GAGGATGAACAGAAGTAGTCAGG + Intergenic
913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG + Intronic
913523309 1:119666847-119666869 AATGTTCAACAGAAGTAGAATGG - Intronic
917872842 1:179257128-179257150 CAGAATCAAGAGAAGTAGGATGG + Intergenic
918091232 1:181296979-181297001 GAGGTTAGACAGGAGTAGCAGGG + Intergenic
918708367 1:187696580-187696602 GAGGTTCAAAATAAGGGGGATGG - Intergenic
921422703 1:214966905-214966927 GAGATTCAACTCAAGTAGCATGG + Intergenic
921811381 1:219518271-219518293 GAGATCCAACAGCAGAAGGAAGG + Intergenic
921962153 1:221047279-221047301 GAGGGTGAACAGAAGTAGGGTGG + Intergenic
924829092 1:247573484-247573506 GAGGGTGAACAGAAGCAGGGTGG - Intronic
1066648575 10:37634932-37634954 GAGGGTCAGCAGAAGAATGAGGG + Intergenic
1067854241 10:49778453-49778475 GAAGTCCAACAGGAGTAGAATGG - Intergenic
1068895719 10:62198201-62198223 GAAGTTTATCAGAAGGAGGAAGG + Exonic
1069120899 10:64567792-64567814 GAGGGTGAGCAGAAGTAGGGAGG - Intergenic
1070662189 10:78315001-78315023 CAGGTTGAACAGTAGAAGGAAGG - Intergenic
1070961951 10:80505523-80505545 GAGGTTCCACTGAAGGAAGAAGG - Intronic
1071457522 10:85862200-85862222 GAGGTTTATAAGAATTAGGAAGG + Intronic
1075204266 10:120433299-120433321 GCTGTTCAACTGAAGGAGGAAGG - Intergenic
1076475229 10:130746957-130746979 GAGATTCAACGGATGCAGGAAGG + Intergenic
1076643494 10:131935167-131935189 GAGGCTCAACAGAAAGAAGAGGG - Intronic
1078435117 11:11318325-11318347 GAGGTCACACAGAAGTAGAATGG + Intronic
1079645281 11:22856614-22856636 GATGTTGAACAGAAGTGAGAAGG - Intronic
1080181262 11:29429198-29429220 GAGGTACAGCAGAATGAGGAAGG - Intergenic
1081683258 11:45023502-45023524 GAGGTTCAAGGGAAGGGGGAGGG + Intergenic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1084627968 11:70323426-70323448 GAGGCTGGACAGAGGTAGGAAGG + Intronic
1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG + Intronic
1087129711 11:94657803-94657825 AGGGTTCAACAGAAGGATGAGGG + Intergenic
1088885945 11:114006747-114006769 GAGGTCCTATAGAAGTAGGATGG - Intergenic
1091760197 12:3082246-3082268 GCATTTCAACAGAAGGAGGAAGG + Intronic
1093946520 12:25116019-25116041 GAGTTTCAAAAGTTGTAGGAGGG - Intronic
1095547449 12:43388326-43388348 GAGGGTGAACAGAAGCAGGCAGG - Intronic
1097922434 12:65090622-65090644 GAGGTTAAACAGGTGAAGGAGGG + Intronic
1098701321 12:73631222-73631244 GAGGTGGAAGAGAAGGAGGAGGG + Intergenic
1103895112 12:124267957-124267979 GAGGTTGTACTGGAGTAGGATGG + Intronic
1106415647 13:29543775-29543797 GAGGTTCTACAGGAGGAGGGAGG + Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108163429 13:47666740-47666762 GAGGTTGTACTGAAGTGGGAAGG - Intergenic
1108850280 13:54719684-54719706 AAGGTTCAATAGAAATTGGAGGG + Intergenic
1109208345 13:59506195-59506217 GAGGTTCAAAGGAAGAAGGCTGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1112770724 13:102792062-102792084 GAGGAGCAAGAGAAGTATGACGG + Intronic
1114184429 14:20389475-20389497 GAAGTGCAACAGAGGTAAGAAGG + Intronic
1116382446 14:44287809-44287831 GAGATTCAAAAGCAGTTGGAAGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117284657 14:54275438-54275460 GAGGTCCTACTGAATTAGGAGGG - Intergenic
1120052419 14:79882569-79882591 GAGGTGCAACCGCAGTAGGCTGG + Intergenic
1120396331 14:83971439-83971461 TAGGTTGAAAAGAAGGAGGAAGG + Intergenic
1120864010 14:89280110-89280132 GCCAATCAACAGAAGTAGGAGGG + Intronic
1120924871 14:89787907-89787929 CAAGTTCAAAAGAAGTAGAAAGG + Intergenic
1121726829 14:96158465-96158487 GAGGATGAACAGAGGTAGAAGGG + Intergenic
1124072947 15:26412815-26412837 GTGGTTGAACAAAAGTTGGAAGG - Intergenic
1124789494 15:32714238-32714260 GATGTTCACCAGAATGAGGAGGG - Intergenic
1128387563 15:67161650-67161672 GAGGTTGAACAGGAGTAAAAGGG - Intronic
1131168854 15:90162201-90162223 GAGCTACAGCAGAAGTTGGAAGG - Intronic
1132156474 15:99499312-99499334 GAGGCTCAGCAAATGTAGGAGGG - Intergenic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1139732883 16:68962384-68962406 GATGGTTAACAGAAGTGGGAAGG - Intronic
1140557505 16:75938659-75938681 GAGGTAGAACAGAAGCAAGAAGG + Intergenic
1140864729 16:79050167-79050189 GGGGTTCAGCAGAACTAGGCTGG + Intronic
1141452552 16:84115229-84115251 GAGGTTAACAAGAACTAGGAAGG - Intronic
1142428887 16:90015663-90015685 GAGATTCAACCCAAGAAGGACGG + Intronic
1143002341 17:3802559-3802581 GAGGTTCAACAGAAGTAGGATGG - Intergenic
1143969297 17:10783262-10783284 GGTGTTCAGCAGGAGTAGGAAGG - Intergenic
1146616552 17:34361493-34361515 GAGGTTTAACAAAAGCATGAGGG - Intronic
1148363388 17:47032854-47032876 GAGGAACAACAGAAGAAGCAAGG - Intronic
1149154878 17:53616159-53616181 CTGATTCTACAGAAGTAGGATGG + Intergenic
1151012929 17:70522049-70522071 TAGGTTCAACAGAATCATGAGGG + Intergenic
1153755227 18:8275943-8275965 GAGATACAAGAGAGGTAGGATGG - Intronic
1153833133 18:8940675-8940697 GAATTTCCACAGAAGCAGGAAGG + Intergenic
1155162255 18:23205642-23205664 GAGGTTATACTGGAGTAGGACGG + Intronic
1155644464 18:28060802-28060824 GAGGTTCACCAGAAGGAGCCAGG - Intronic
1156079368 18:33315477-33315499 GAAGATCAAGATAAGTAGGATGG - Intronic
1156390646 18:36647695-36647717 AAGGGTCATCAGAAGTAGAATGG + Intronic
1156831996 18:41503085-41503107 GAGGTTCAAGAATAGTATGAGGG - Intergenic
1157910589 18:51614287-51614309 ATGGGTCAACAGGAGTAGGAAGG - Intergenic
1160360302 18:78269522-78269544 GTGGCTCAACAGAAGCAGAATGG - Intergenic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1166317343 19:41996554-41996576 GAGGCTCTGCAGAAGTAGGGGGG + Intronic
1166929370 19:46292587-46292609 GAGGTTCATCATTAGTAGAATGG - Intergenic
1167960018 19:53097915-53097937 GAGCTTCAGCAGCAGGAGGATGG - Intronic
1168368786 19:55813695-55813717 GATGATCAAGAGAAGCAGGAAGG + Intronic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
929022934 2:37572002-37572024 AAGGTTCAACACAAGGAGGTGGG + Intergenic
929151415 2:38751940-38751962 CTGGTTCAAAAGAAGTTGGAGGG - Intronic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
931652849 2:64484110-64484132 GTGGTTTTACAGAAGAAGGAGGG - Intergenic
932838276 2:75057655-75057677 GAGGTTTACCAGGAGTTGGAGGG + Intronic
933002263 2:76940241-76940263 GAGGTCCATCAGTGGTAGGATGG + Intronic
937721465 2:125101757-125101779 GAGGTTACAGAGAAGAAGGATGG - Intergenic
940396920 2:153200180-153200202 GAGGATAAACTGAAGCAGGAAGG + Intergenic
941372864 2:164688793-164688815 TTGGTTCAACAGAAGGTGGAGGG - Intronic
943512237 2:188840464-188840486 GAGGGTGAGCTGAAGTAGGATGG + Intergenic
947594637 2:231403300-231403322 GAGGTTCCAGACAAGGAGGAAGG + Intergenic
948313746 2:237010755-237010777 AAGGTTCCACAGAAGTAGGGGGG - Intergenic
948784637 2:240346043-240346065 GAGGGTCGATAGAAGAAGGAAGG - Intergenic
1169934226 20:10865719-10865741 CAGGTTGAAGAGGAGTAGGAGGG + Intergenic
1169984189 20:11423418-11423440 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1173190305 20:40870890-40870912 GAGGTTATACAGAAGTAGGTTGG - Intergenic
1176959423 21:15142461-15142483 GAGCTTGAACTGTAGTAGGAAGG + Intergenic
1177333606 21:19694704-19694726 CAGGGGCAACAGAAGTAGCATGG + Intergenic
1177506845 21:22030333-22030355 GAGGTTGTAGAGAAATAGGAAGG + Intergenic
1177543947 21:22532711-22532733 GAGGTTATACAGAAGTAGTGTGG + Intergenic
1178864534 21:36316971-36316993 GAGGGTGAACAGAAGCAGGGTGG - Intergenic
1178923147 21:36753002-36753024 TAAGTTCAACAGAGATAGGAGGG + Exonic
1179009215 21:37541644-37541666 AAGGTTGAAGAGAAATAGGAAGG - Intergenic
1179416866 21:41205575-41205597 AAGACACAACAGAAGTAGGAAGG - Intronic
1184208856 22:43023510-43023532 GAGGCTCAGCAGAAGAAGGGGGG - Intergenic
949115748 3:320401-320423 GAGGTTAAACAGTAGTCTGATGG + Intronic
950428896 3:12939642-12939664 GAGGTTCCAAAGAGGTAAGAGGG - Intronic
950786753 3:15443483-15443505 GAGGTTCAGCTGATCTAGGATGG + Intronic
951802776 3:26614832-26614854 CAAGTTCTACAGAAGGAGGAAGG + Intergenic
951832085 3:26942470-26942492 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
952014764 3:28943197-28943219 GAGGTTCCACAGCAGTAGGTAGG - Intergenic
953039247 3:39240207-39240229 GAGGTTGTACAGAAAAAGGAAGG - Intergenic
955946782 3:64202801-64202823 AATGTTCAACAGAAGTAGCAAGG + Intronic
957695650 3:83635644-83635666 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
958684465 3:97375274-97375296 TAGACACAACAGAAGTAGGAGGG - Intronic
960414522 3:117368289-117368311 AGGGCTCCACAGAAGTAGGATGG + Intergenic
961622258 3:128233580-128233602 GATCTTCAACAGAAGCATGAGGG - Intronic
963328731 3:143891001-143891023 GAGTTTCAACAGAGCCAGGACGG - Intergenic
963505150 3:146175728-146175750 TTGGAGCAACAGAAGTAGGAGGG - Intergenic
964389967 3:156186634-156186656 GAGGTTGAACAGAAATGAGAAGG - Intronic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
968227239 3:196980900-196980922 GAGGATGAAAAGAAATAGGAAGG + Intergenic
968975721 4:3821185-3821207 CAGGTCCAACAGAAGCACGAAGG + Intergenic
968982321 4:3856946-3856968 GAGGTGCAGCAGAGGTAGAAGGG + Intergenic
971526391 4:27623936-27623958 GAAGTTATACTGAAGTAGGATGG + Intergenic
973090261 4:46126833-46126855 GTGGTTCAAAAGAAGGAGGAGGG - Intergenic
974421510 4:61682739-61682761 GCAGTTCAACAAAGGTAGGAGGG - Intronic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
976284148 4:83355188-83355210 GAGGTTTTACAGCAGTAGAAAGG + Intergenic
976362981 4:84202471-84202493 GAGGGCCAGCAGAAGCAGGATGG + Intergenic
977215690 4:94280939-94280961 GAGGTTCAACAGAGGAAAGGAGG - Intronic
979012248 4:115387092-115387114 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
980148679 4:129021099-129021121 GAGGATGAACAGAAGTAGGGTGG + Intronic
982825655 4:160001498-160001520 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
983584179 4:169338223-169338245 GAAGTTTAACAGAAGCAGCAGGG - Intergenic
986676802 5:10192993-10193015 CTGGTTCAACAGAAGAAGGGTGG - Intergenic
994073383 5:95625234-95625256 TAGGGTCAACACAAATAGGATGG - Intergenic
995474955 5:112538796-112538818 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
996653958 5:125915917-125915939 GAAGATCAAGAGCAGTAGGAGGG + Intergenic
998729936 5:145063111-145063133 GATGTACCAAAGAAGTAGGAAGG + Intergenic
1001674393 5:173499977-173499999 GAGCTGCAACAGGACTAGGAGGG + Intergenic
1005162987 6:22886498-22886520 GATGTTCAAAACATGTAGGATGG + Intergenic
1005764523 6:28997972-28997994 GAGGTTCATAAGTAGTAGAAAGG - Intronic
1007509381 6:42363678-42363700 GAGGTCCTACTGAAGTAGGATGG + Intronic
1009552032 6:65109812-65109834 GAGGGTGAATAGAAGTAGGCAGG - Intronic
1009718335 6:67428676-67428698 GAGGGCGAACAGAAGCAGGATGG - Intergenic
1011309783 6:85969138-85969160 GAGGTTAAATAGAATAAGGATGG + Intergenic
1012992126 6:105936743-105936765 GTCATTCAACAGAAATAGGAAGG - Intergenic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014523385 6:122472128-122472150 GAGGTTCCTCAGATGAAGGAGGG - Intronic
1016765253 6:147785456-147785478 GAGATTAGACAGAACTAGGAGGG - Intergenic
1017072053 6:150584244-150584266 GAGGTTCAGCAGCAGAAGCACGG - Intergenic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1018968571 6:168508662-168508684 GAGGTTCAGCAGAAGCTGGGGGG - Intronic
1021853342 7:24830081-24830103 GAGGTAGAACTGAGGTAGGACGG + Intronic
1021903798 7:25313747-25313769 GAGGTCCTACTGGAGTAGGATGG + Intergenic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023561100 7:41474148-41474170 GAGGTGGAGCAGATGTAGGAGGG - Intergenic
1026900936 7:74037133-74037155 GAGGATAAAAAGAAATAGGAAGG - Intronic
1028248694 7:88514050-88514072 GAGTTTCAAAAGCAGGAGGAGGG + Intergenic
1028255361 7:88589416-88589438 GAGGTTCAACAGAATTTTAAGGG - Intergenic
1031741700 7:125440521-125440543 GAGGTAAAACAGAAATATGAGGG - Intergenic
1031783860 7:126004062-126004084 GAGCTTCAGCAGAAGTATGTGGG + Intergenic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032884653 7:136124517-136124539 GAGGATCATCACAAGGAGGAGGG + Intergenic
1036082630 8:5574144-5574166 GAGGTTTACCAGAGGTAGGGAGG + Intergenic
1036217987 8:6896798-6896820 GAGGGTTTACAGAGGTAGGAGGG - Intergenic
1038084944 8:24185684-24185706 CAGGTCCAAAAGAAGTAGGCTGG - Intergenic
1038977231 8:32713452-32713474 GAAGTTCAACTCAATTAGGAAGG - Intronic
1039275914 8:35934093-35934115 GAGGCTCATCATTAGTAGGATGG - Intergenic
1039282892 8:36006258-36006280 GAGGGTGAACAGAAGCAGGGTGG + Intergenic
1040488663 8:47899055-47899077 GAAGTACAACAGAGGTAAGATGG + Intronic
1044492087 8:92831123-92831145 CAAGTCCAACAGCAGTAGGATGG + Intergenic
1047152856 8:122284351-122284373 GAGGTTAGACAGGATTAGGATGG - Intergenic
1052366278 9:27615214-27615236 GAGGGTGAGCAGAAGTAGGGTGG - Intergenic
1052506284 9:29358808-29358830 GAGGGTGAGCAGAAGTAGGGTGG + Intergenic
1055835422 9:80434863-80434885 GAATTTCAACAGAATTATGATGG + Intergenic
1057278348 9:93689489-93689511 GAGTTTTAACAAAAGTATGAGGG + Intergenic
1057330505 9:94110174-94110196 TCAGTTCAACAGAAATAGGAAGG + Intergenic
1060537359 9:124400870-124400892 GATGTTCATCAGAAGAAGAATGG + Intronic
1060709170 9:125839443-125839465 GAGGTTCCAAAGAAAGAGGAAGG + Intronic
1186097108 X:6114114-6114136 TTGGTTTAACAGAAGTAGGCCGG - Intronic
1186207698 X:7217223-7217245 GAGGTTGAACAGATGGAGGGGGG + Intergenic
1186902200 X:14068691-14068713 GAGGTTATACTGGAGTAGGATGG - Intergenic
1187649559 X:21387390-21387412 GAGGATCACCAGAACCAGGAAGG + Intronic
1188458886 X:30399319-30399341 GTGGTTAAACTGAATTAGGAGGG - Intergenic
1189081614 X:37978873-37978895 GAGGTTCAGGAGAAGAAGGAAGG + Intronic
1192272981 X:69600990-69601012 TAGTCTCTACAGAAGTAGGAGGG + Intergenic
1192491538 X:71580009-71580031 GAGGTTGGACAGAAGGAAGAAGG + Intronic
1192703246 X:73498409-73498431 GAGGGTGAGCTGAAGTAGGATGG - Intergenic
1192958257 X:76096140-76096162 GAGGGTAAGCAGAAGCAGGATGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193182668 X:78477111-78477133 GAGGTTAAAATGGAGTAGGATGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193645627 X:84065963-84065985 GAGGGTGAGCAGAAGTAGGGTGG + Intronic
1194728666 X:97428656-97428678 GAGGGTTAAGAGAAGAAGGAGGG - Intronic
1194897429 X:99461581-99461603 GGGCATCAAGAGAAGTAGGAAGG + Intergenic
1194947260 X:100083928-100083950 GAGGTTCAGAATGAGTAGGATGG - Intergenic
1196278169 X:113792923-113792945 GAGGTTCAAAATGACTAGGAGGG + Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197702528 X:129610078-129610100 GAATTTCAGCAGGAGTAGGAGGG - Intergenic
1199559214 X:149145577-149145599 CATGTTGACCAGAAGTAGGATGG + Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic