ID: 1143003499

View in Genome Browser
Species Human (GRCh38)
Location 17:3811164-3811186
Sequence TGGGCTGTTACCAGAATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143003499_1143003504 4 Left 1143003499 17:3811164-3811186 CCAGGAATTCTGGTAACAGCCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1143003504 17:3811191-3811213 ACTGCTAGACGGGAAAACTGAGG 0: 1
1: 0
2: 0
3: 13
4: 159
1143003499_1143003509 29 Left 1143003499 17:3811164-3811186 CCAGGAATTCTGGTAACAGCCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1143003509 17:3811216-3811238 CAGGTCCATGGAGCAGAGCCAGG 0: 1
1: 1
2: 5
3: 34
4: 355
1143003499_1143003501 -6 Left 1143003499 17:3811164-3811186 CCAGGAATTCTGGTAACAGCCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1143003501 17:3811181-3811203 AGCCCACTCAACTGCTAGACGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1143003499_1143003505 10 Left 1143003499 17:3811164-3811186 CCAGGAATTCTGGTAACAGCCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1143003505 17:3811197-3811219 AGACGGGAAAACTGAGGCCCAGG 0: 1
1: 11
2: 161
3: 747
4: 2059
1143003499_1143003500 -7 Left 1143003499 17:3811164-3811186 CCAGGAATTCTGGTAACAGCCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1143003500 17:3811180-3811202 CAGCCCACTCAACTGCTAGACGG 0: 1
1: 1
2: 0
3: 6
4: 121
1143003499_1143003510 30 Left 1143003499 17:3811164-3811186 CCAGGAATTCTGGTAACAGCCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1143003510 17:3811217-3811239 AGGTCCATGGAGCAGAGCCAGGG 0: 1
1: 0
2: 1
3: 32
4: 305
1143003499_1143003506 17 Left 1143003499 17:3811164-3811186 CCAGGAATTCTGGTAACAGCCCA 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1143003506 17:3811204-3811226 AAAACTGAGGCCCAGGTCCATGG 0: 1
1: 0
2: 4
3: 39
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143003499 Original CRISPR TGGGCTGTTACCAGAATTCC TGG (reversed) Intergenic
901987060 1:13084211-13084233 TGGGCTAGTCTCAGAATTCCTGG + Intergenic
901994752 1:13142556-13142578 TGGGCTAGTCTCAGAATTCCTGG - Intergenic
902130941 1:14259918-14259940 TGGGCTGTTACCAAAGTGCAAGG + Intergenic
903664725 1:24999279-24999301 TTGGATGTTAGCAGCATTCCTGG - Intergenic
903939094 1:26916503-26916525 TGGCCTGCTTCCATAATTCCTGG + Intronic
905523347 1:38617103-38617125 AGGGCTGTTTCCAGGATCCCTGG + Intergenic
907343515 1:53755042-53755064 TGGGATGTTAACAGAATTAAAGG + Intergenic
907481482 1:54748250-54748272 TGGGCAGGAACCAGAATGCCAGG - Intergenic
912510398 1:110185765-110185787 GGGGCTCTTTCCAGGATTCCTGG - Intronic
914435387 1:147654934-147654956 GCGGCTCTTCCCAGAATTCCTGG + Intronic
914906318 1:151748660-151748682 TGGGGTTTTACCATATTTCCCGG + Intergenic
915078962 1:153338184-153338206 TGGGCTGATGCCTGTATTCCTGG - Intronic
916071387 1:161172056-161172078 TGGTCCGTACCCAGAATTCCTGG - Exonic
918881935 1:190135644-190135666 GGGGCTATTACCAGAAATCAGGG - Intronic
919835565 1:201570780-201570802 AGGCCTGTTCCCAGAAGTCCAGG + Intergenic
922364285 1:224849612-224849634 TGGGCAATTCCCAGAATTCAGGG - Intergenic
922491052 1:226017126-226017148 TGGGCTGTTATCAGAATTAATGG - Intergenic
924220956 1:241874542-241874564 TGGGCTGTTGCCATAGTCCCTGG + Intronic
1063152151 10:3346734-3346756 TGATCTGTTACCAAAATTCTCGG + Intergenic
1068723584 10:60274795-60274817 TGGGGTGTTACTTGAATTACAGG - Intronic
1074967130 10:118501232-118501254 AGGGCTGTGACCACACTTCCAGG - Intergenic
1075065101 10:119283945-119283967 TGTGCAGTTACCACAGTTCCTGG - Intronic
1077866965 11:6230384-6230406 TGGGCTGTTACCCTAAATACTGG + Intronic
1078859454 11:15233845-15233867 TGGGCTGTTAGCAGAAAGCATGG - Intronic
1084547751 11:69822788-69822810 AGGGCTGCTCCCAGAATTTCAGG - Intergenic
1085023313 11:73222306-73222328 TGGGCTGTTGCAGGAAATCCAGG + Intronic
1089708621 11:120299072-120299094 TGGGCTGGTAGGAGAAATCCTGG + Intronic
1090730817 11:129572133-129572155 GGGGCTGTTACCAGAAGCACAGG - Intergenic
1094648989 12:32356781-32356803 TGTGCTATTATCAGAATTCCTGG + Intronic
1096260436 12:50086761-50086783 TGAACTGGTACCAGAATCCCAGG + Exonic
1101185937 12:102279072-102279094 TGGGCTGGTCCCAGAGTTACAGG + Intergenic
1101921841 12:108939310-108939332 GGGGCTGTTTTCAGAGTTCCAGG + Intronic
1101953241 12:109192465-109192487 TAGGATGTTAGCAGCATTCCTGG + Intronic
1103910870 12:124351404-124351426 TGGGCTGTTAACAGCATCCCTGG + Intronic
1111676510 13:91395377-91395399 TGGGCTCTTATCAGGATTTCTGG + Intergenic
1113526513 13:110982632-110982654 TGGGGTTTCACCAGAGTTCCAGG + Intergenic
1120490532 14:85173319-85173341 TGGCCACTTACCAGAAATCCTGG - Intergenic
1123019084 14:105389222-105389244 CGGGCTGTGACCAGACTTCCAGG + Intronic
1123153592 14:106204503-106204525 TGGGTTGTTACCGGAACTCCCGG - Intergenic
1123205211 14:106705856-106705878 TGAGCTGTTCCCACAATTCAAGG - Intergenic
1123210286 14:106753771-106753793 TGAGCTGTTCCCACAATTCAAGG - Intergenic
1135026510 16:19003262-19003284 TGGAGTGTAACCTGAATTCCTGG - Intronic
1138261567 16:55627183-55627205 TGGCCTGTGACTAGAATTCCTGG - Intergenic
1143003499 17:3811164-3811186 TGGGCTGTTACCAGAATTCCTGG - Intergenic
1143446255 17:7011929-7011951 TGGGCGGTTAGGAGAAGTCCAGG - Intronic
1147732395 17:42612153-42612175 TCGGCTCCTACCAGCATTCCTGG - Intronic
1149271018 17:54977134-54977156 GGGGGTGTTACCAAAATGCCAGG - Intronic
1153502975 18:5767736-5767758 TCTGCTTTTACCAGAATCCCTGG + Intergenic
1153753875 18:8260801-8260823 TGGGCTGGTCTCAAAATTCCAGG - Intronic
1162451892 19:10759998-10760020 TCAGCTGTGACCAGAATGCCAGG + Intronic
1163634050 19:18430298-18430320 TGGGCTGCCACCACAATTTCTGG + Intronic
928470714 2:31573090-31573112 TGGCCTGTTCCCAGATTTCTGGG - Intronic
929530911 2:42751915-42751937 TGGGCTGTTAGCAGAACACTGGG + Intronic
939959675 2:148555292-148555314 TGGGCTGTTTCCAGAGTACAGGG + Intergenic
942626710 2:177908767-177908789 TGGGCTGTTCCTAGGCTTCCGGG - Intronic
945810773 2:214547285-214547307 AGGGCTGATTCCAGGATTCCAGG - Intronic
946425965 2:219597104-219597126 AGGTCTTTTAACAGAATTCCTGG - Intergenic
1172035390 20:32007120-32007142 TGGCCTGATACCAGAGTTCTTGG + Intergenic
1172307823 20:33894086-33894108 TGATCTGTGACCAGGATTCCAGG - Intergenic
1174074662 20:47924902-47924924 TGGACTGTTACAAGTATCCCAGG - Intergenic
1174667167 20:52270473-52270495 TGGGTTGTAACCAGAACTGCTGG + Intergenic
1175069648 20:56322429-56322451 TGGGGTGTTAACAGCATCCCTGG + Intergenic
1175648276 20:60694629-60694651 TTGGCTGGAGCCAGAATTCCTGG - Intergenic
1178363773 21:31971370-31971392 TGGCCTGGAACCAGAATTCTAGG + Intronic
1178867159 21:36338475-36338497 TGGGCTGGTCTCAAAATTCCGGG - Intronic
1178973592 21:37202691-37202713 TGGAATGTGACCAGAATTCATGG - Exonic
1179093148 21:38286661-38286683 TGTGATATTACCAGAATTACTGG + Intronic
1179731282 21:43369045-43369067 TGGGCTGATGGCAGAATTTCAGG + Intergenic
1184659161 22:45957957-45957979 TGGGCTGTTGCCCGCATTCAGGG - Intronic
1184669320 22:46004491-46004513 TGGACTGCGACCAGAATCCCAGG - Intergenic
1185076185 22:48684122-48684144 TGAGCCGTTACCTGAATTCCAGG + Intronic
951563749 3:23992311-23992333 AGGGCAGTTGCCAGAATTTCCGG - Intergenic
955276121 3:57549053-57549075 TGGCCTGTGCCCATAATTCCAGG + Intergenic
957622940 3:82619466-82619488 TCTTCTGTTCCCAGAATTCCTGG - Intergenic
958613141 3:96453189-96453211 TGGGCTGATATTAGAATACCTGG - Intergenic
959937786 3:112047583-112047605 TGGGCTGTTACCAGAAGGCAGGG + Intronic
961509061 3:127390177-127390199 TGGGCTGTTTTCAGAACACCTGG - Intergenic
961638636 3:128350536-128350558 TGGGCTGGGACCAGAATACCAGG - Intronic
963261444 3:143195680-143195702 TGGGTTGGTATTAGAATTCCTGG + Intergenic
964380785 3:156097175-156097197 TGGGATTTTACCAGATTTTCGGG - Intronic
966168272 3:177046942-177046964 TGGTCTGTTAGCCGAACTCCTGG - Intronic
968496895 4:923457-923479 TAGGCTGTTCTCAGAACTCCTGG - Intronic
968592689 4:1466698-1466720 GTGGCTGTTTCCAAAATTCCTGG + Intergenic
975765618 4:77664507-77664529 TGGGATGTAACTAGAATGCCAGG + Intergenic
975981976 4:80171577-80171599 TGGGCTGTTAACAGGAATACTGG - Intergenic
976198336 4:82555701-82555723 TGGGCTGTCACCAGATTGCGTGG + Intronic
976852169 4:89560222-89560244 TGGGATCTTATCAGAATTGCTGG - Intergenic
980773864 4:137414351-137414373 TGGCTTTTTTCCAGAATTCCAGG + Intergenic
982767207 4:159362743-159362765 TGGGCTGGTTCTTGAATTCCTGG - Intergenic
984318834 4:178164625-178164647 TTGGCTGATAGCAGCATTCCTGG - Intergenic
984381234 4:178995778-178995800 TGGGGTCTTACATGAATTCCTGG - Intergenic
987942204 5:24553943-24553965 CTGGCTGCTACCAGAATTTCAGG + Intronic
990324281 5:54659740-54659762 TTGGCTGTGACTTGAATTCCAGG - Intergenic
991563196 5:67976861-67976883 TGGGCTGTGACGATAATTCACGG - Intergenic
994404036 5:99320484-99320506 CGGCCTGTTACCAGAAGTTCAGG - Intergenic
994834102 5:104827389-104827411 TGGGCTTTTTCCAGAATCCAGGG + Intergenic
994927704 5:106139740-106139762 TGGGCTGTTTCTAGTTTTCCTGG - Intergenic
996990006 5:129617631-129617653 TGGGCTGTAGCCAGAATCCATGG + Intronic
997987232 5:138511986-138512008 TAGGCTGGTCTCAGAATTCCTGG - Intronic
1000335254 5:160237310-160237332 TGGGCAGTGACCAGAGTTCAGGG + Intronic
1001137630 5:169115603-169115625 GATCCTGTTACCAGAATTCCTGG + Intronic
1003152363 6:3563649-3563671 TGGGCTGTGAGCAGAGATCCAGG + Intergenic
1006735616 6:36270577-36270599 TGGGCTGTTTCCAGCATCCGGGG - Exonic
1008817999 6:55592558-55592580 GGGGATTTTAGCAGAATTCCTGG + Intergenic
1010987126 6:82437575-82437597 TGGGCTGTTTTGAGAATTACAGG + Intergenic
1011925763 6:92643498-92643520 TAGGCTGTTACCACCATGCCTGG - Intergenic
1016322707 6:142864296-142864318 TAGGCTGTTCCTAGAATTCTTGG - Intronic
1019390755 7:785536-785558 CGGGCTGTTCCCAGATCTCCTGG + Exonic
1023713160 7:43016089-43016111 TGGGTGGGTAGCAGAATTCCTGG - Intergenic
1023868054 7:44248224-44248246 AGGGCTGTTGGCAGAAGTCCAGG + Intronic
1024183893 7:46928168-46928190 TGGGCTGTTACAAGGCTTCCAGG - Intergenic
1024670365 7:51588613-51588635 CAGACTGTTACCAGAATGCCAGG - Intergenic
1031560307 7:123230510-123230532 TGGGCTTTCACCAGATTCCCAGG - Intergenic
1033311592 7:140265717-140265739 AGGGCTGTCACCTGAATTGCGGG + Intergenic
1034858154 7:154573246-154573268 GGGGCTGCTATCAGAATTGCAGG + Intronic
1036809657 8:11858811-11858833 TGAGCTGTTAACAGCTTTCCAGG + Intronic
1038574779 8:28695677-28695699 TGACCTGTTCCCACAATTCCAGG + Intronic
1039847286 8:41334519-41334541 TGGGCAGTCACCAGGTTTCCAGG - Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1044857382 8:96490527-96490549 TGGACTGTTACCAGGAGTCCAGG - Intergenic
1044944987 8:97381317-97381339 GGGGCTGTTATCAAAATGCCAGG + Intergenic
1047779768 8:128101603-128101625 GGGGCTGTTACAAAAATTCCAGG - Intergenic
1049440351 8:142606856-142606878 TGGGCTGTTCCCAGCCTCCCAGG - Intergenic
1049464672 8:142745386-142745408 TGGGCTGGCACCAGGAGTCCTGG + Intergenic
1051213784 9:14774758-14774780 TTGACTGTTACAAGGATTCCTGG - Intronic
1052308189 9:27034853-27034875 TGTCCTGTTACTAGAATGCCTGG + Intronic
1052343020 9:27381486-27381508 TAGGCACTTAGCAGAATTCCAGG - Intronic
1053042539 9:34886888-34886910 TGGGCTCTTCCCTGAACTCCAGG + Intergenic
1053307590 9:36995273-36995295 TGGGCTGGTTCCAGAAAGCCAGG + Intronic
1057937993 9:99256871-99256893 AGGGCTATAAACAGAATTCCAGG - Intergenic
1058503955 9:105650027-105650049 TGGGCAGTGAGCACAATTCCTGG + Intergenic
1186440490 X:9581575-9581597 TGGGATGTTAGCAGCATCCCAGG - Intronic
1192594544 X:72392932-72392954 TGGGCAAATACCAGATTTCCTGG + Intronic
1195918211 X:109956577-109956599 TAGACTGTTGCCAGATTTCCTGG - Intergenic
1200426208 Y:3023176-3023198 TGGTCTGGTACCAGGATGCCTGG - Intergenic