ID: 1143005797

View in Genome Browser
Species Human (GRCh38)
Location 17:3832739-3832761
Sequence ATATATCTGCAGAAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 572}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143005797 Original CRISPR ATATATCTGCAGAAGAAGGA TGG (reversed) Intronic
901634115 1:10662804-10662826 GTATGTCTGCAGAGGCAGGAAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
902678566 1:18027020-18027042 ATATAAGTGCAGAATTAGGATGG - Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904535058 1:31193980-31194002 AAATATCTCCAAACGAAGGAAGG - Intronic
905163252 1:36056225-36056247 ATATATATGCATATGAAGTATGG - Exonic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
906431238 1:45757355-45757377 AAATACCTGCAGAATCAGGAAGG - Intergenic
906891628 1:49722234-49722256 TTATATCTTCAGAAAAAGAAAGG - Intronic
907010810 1:50960919-50960941 ATATAACTGCAGCAGTAGAAAGG - Intronic
908485401 1:64587176-64587198 GTATATTTGGAGAAGAAGCAAGG - Intronic
908570679 1:65406753-65406775 ATATTTTTGCATAGGAAGGATGG + Intronic
909107660 1:71432812-71432834 ATATATCTGCTCAAGAATGGGGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910154790 1:84203415-84203437 TTATAAGTGCAAAAGAAGGAAGG - Intronic
910314040 1:85861561-85861583 TTTTTTCTGCAGTAGAAGGAAGG + Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911938681 1:104013818-104013840 ACACATATGCAGAAGAATGAAGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912067021 1:105756945-105756967 AGTTATATGCAGAAGAAGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912408618 1:109464393-109464415 ATATTTCTGGGGAGGAAGGAGGG + Intergenic
913012084 1:114693713-114693735 AAATATCTGATGAAGAAAGATGG + Intronic
913969478 1:143403628-143403650 ATACATCTTCAGAAAAAGGAGGG + Intergenic
914063855 1:144229227-144229249 ATACATCTTCAGAAAAAGGAGGG + Intergenic
914115295 1:144737127-144737149 ATACATCTTCAGAAAAAGGAGGG - Intergenic
914255526 1:145959157-145959179 ATATATCTGCTGATGATGGAGGG + Intergenic
915027704 1:152847690-152847712 ATATGTCTAAATAAGAAGGAGGG + Intergenic
915286840 1:154858613-154858635 ATATGTTTCCAGAAGAGGGATGG + Intronic
916076709 1:161204437-161204459 ATAAATCTGAATAAGAATGATGG - Intronic
916497459 1:165357975-165357997 ATATGACTCCAGAAGAAAGAGGG + Intergenic
916930885 1:169576946-169576968 TTAAATCTGAAGAAGCAGGAGGG - Intronic
916963765 1:169914528-169914550 ACATATCTTCAGAATGAGGAAGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917514707 1:175697860-175697882 TTATATCTGCAAAATGAGGATGG - Intronic
918127853 1:181600108-181600130 AGAAATCTGCAGAAGTGGGAGGG + Intronic
918292180 1:183119482-183119504 ATATAGATGGAAAAGAAGGATGG + Intronic
918402731 1:184179959-184179981 AAATATCTGAAGAAAAAGGATGG + Intergenic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920106811 1:203559213-203559235 ATATAGAAGTAGAAGAAGGAGGG + Intergenic
920461889 1:206146874-206146896 ATATATATGCATAAAAAGGCAGG + Intergenic
920805304 1:209228231-209228253 CTATATCTGGATGAGAAGGAGGG + Intergenic
921584366 1:216930204-216930226 GAATATCTGAAGCAGAAGGAAGG - Intronic
921809620 1:219497751-219497773 AAATATGTGAAGAAGAAGAAGGG - Intergenic
923292652 1:232561636-232561658 TTCTATCTGTAGAATAAGGAAGG - Intergenic
923458247 1:234185126-234185148 AAATACTTGCAGAAGGAGGAGGG + Intronic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
924703772 1:246481195-246481217 ACAGATCTGCAGAAGGAAGATGG - Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924900399 1:248392106-248392128 TTATATATGCAGAACAGGGAAGG - Intergenic
1063633524 10:7757793-7757815 ATAAATCTGGAGAATAAGAAGGG + Intronic
1064196703 10:13249519-13249541 ATAGATATACAAAAGAAGGAAGG + Intergenic
1064517644 10:16168258-16168280 AGTTATCTGCAGAAGAGGGCAGG + Intergenic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065978264 10:30863521-30863543 ATATTGATGGAGAAGAAGGATGG - Intronic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067125896 10:43515167-43515189 ATAAATCTGCAGAACAGGCATGG - Intergenic
1067815951 10:49476966-49476988 ATAGGTCTGCAGAAGACTGATGG - Intronic
1068070534 10:52189295-52189317 ATATACCTGCAGGAGAAGTGGGG - Intronic
1068102935 10:52579488-52579510 ACAGATCTGCAGAAGAGGGCTGG + Intergenic
1068145090 10:53059172-53059194 ATGTTTATGCAAAAGAAGGAAGG - Intergenic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069170360 10:65220391-65220413 ATATTTCTCCAGAAGAATGTTGG - Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070772654 10:79091390-79091412 ATATTTCTCCATTAGAAGGATGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1072190230 10:93072242-93072264 AAATATCTGCAGAGGTCGGAGGG - Intergenic
1072271903 10:93784758-93784780 AGATCTTTGCAGAGGAAGGAGGG + Intronic
1072434510 10:95403075-95403097 ACTTCTCTGCAGAAGAACGATGG + Intronic
1073349163 10:102807362-102807384 ATATATGGACAGAAAAAGGAGGG - Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1075438988 10:122464437-122464459 AAATATTTGCAAAAGAAGGAGGG - Intronic
1076548435 10:131261448-131261470 AAATATCAGCAAAAGCAGGACGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078534991 11:12165761-12165783 ATCTATTTGGAGAAGAAGGACGG + Intronic
1078818888 11:14855919-14855941 GTATTTCAGCAGAAGAAGGGTGG + Intronic
1079289051 11:19169869-19169891 CTAAATCTGCAGAGGAAGAAAGG - Intronic
1079649851 11:22913997-22914019 AACTATCTGTAGAAGAAAGAAGG - Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081072774 11:38631093-38631115 AGATGTCTGCAGAAGATGGCAGG - Intergenic
1081317933 11:41653344-41653366 ATCTAGATGAAGAAGAAGGAGGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083311216 11:61784716-61784738 AGGTGTCTGCAGAAGCAGGAAGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1085834502 11:79937897-79937919 CTATATATGCAAAAGATGGATGG - Intergenic
1088432515 11:109774398-109774420 AAATATCTGTTGAAGAAGGTGGG - Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089346284 11:117793803-117793825 ATATTTCTGCAGTAGAATGGGGG - Intronic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090423944 11:126594176-126594198 ATCTACCTGGAGAAGAAGGCAGG + Intronic
1090956909 11:131521353-131521375 AAATAAATGCAGAAGAAGCAAGG + Intronic
1091905102 12:4179369-4179391 ATTTAGATGAAGAAGAAGGAGGG + Intergenic
1091915070 12:4266265-4266287 ATATATATTCAGAAGAAAGTAGG + Intergenic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092440755 12:8499845-8499867 ATTTAACTGCAGAGGAAGAAGGG - Intergenic
1092935502 12:13358994-13359016 ATATAACTACAGAAAAATGAAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093152663 12:15641447-15641469 AAATATCAGAAGAAGAAAGAGGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1093918664 12:24834673-24834695 ATATATCTGCAATAGAAATATGG + Intronic
1093964536 12:25310929-25310951 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094383977 12:29873560-29873582 ATAGAACAGCAGAAGAACGATGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1096809164 12:54158765-54158787 AAATAGCTGCAGAAGTAGGCTGG - Intergenic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097512125 12:60556612-60556634 AAATATCTGTGGAAGAAAGAAGG + Intergenic
1097538023 12:60898524-60898546 ATATATATGAATAAGTAGGATGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097821385 12:64132191-64132213 AGTTATCTGCAGAAGAAGGCAGG + Intronic
1097933347 12:65215308-65215330 CTATATTTACAGAAGAAGGAGGG + Intronic
1098142061 12:67459891-67459913 ATACATATGCAGAAAAGGGAAGG - Intergenic
1098313025 12:69166241-69166263 AAATATTTGAAGAAGTAGGAGGG - Intergenic
1098341254 12:69453696-69453718 ATGTATCTGGAAAGGAAGGAGGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099472101 12:83063276-83063298 ACAAAACTGCAGAAGAAGGAGGG - Intronic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099622393 12:85020548-85020570 AGAAAACTGCAGAAGCAGGAAGG + Intronic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100686762 12:96995029-96995051 ATATCTCTGCAGAGGGAGGAGGG - Intergenic
1100717724 12:97323465-97323487 AGAGAACTGCAGAAGCAGGAAGG - Intergenic
1100895109 12:99173092-99173114 ATACATCTGCTGAAGAGTGATGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1102194495 12:111015028-111015050 ATATTTCTGCAGCAAATGGATGG - Intergenic
1102879534 12:116473987-116474009 AAATATCTGAAGAATCAGGATGG + Intergenic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103262070 12:119596105-119596127 ATATATGGGGAGAGGAAGGAAGG - Intronic
1104157472 12:126147730-126147752 ATATCTCTGCAGATGTATGAGGG - Intergenic
1104255031 12:127128608-127128630 ATAAGACTGCAGAAAAAGGAAGG - Intergenic
1107384632 13:39894613-39894635 AGAAAACTGCAGAAGCAGGAAGG - Intergenic
1110028218 13:70570496-70570518 ATAAATCTGCATAAGTAGCAAGG + Intergenic
1110961928 13:81637634-81637656 ATAGATTTGGAGAATAAGGATGG - Intergenic
1111041737 13:82757583-82757605 AGATCTCTGCATAGGAAGGAAGG - Intergenic
1111143992 13:84157047-84157069 AGATCTCTGCACAGGAAGGATGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111522354 13:89422969-89422991 ATATATATAGAGAAGAACGAGGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112471794 13:99695901-99695923 AGAAAACTGCAGAAGTAGGAAGG - Intronic
1112840306 13:103567791-103567813 ATATTTCTGCTGAAGAAGTTGGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114412153 14:22511233-22511255 ATATCTCTCTAGAAGAAAGAGGG - Intergenic
1116195806 14:41723464-41723486 AGATTTCTGCACAGGAAGGATGG + Intronic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116419539 14:44716836-44716858 TTATATTTTCAGAAGAAGTATGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118122436 14:62860197-62860219 AGTTATCTGCAGAAGACGGCAGG + Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119081159 14:71695327-71695349 ATATAAATGCAAAAGAGGGATGG + Intronic
1119118502 14:72050605-72050627 ATATATCTGAAGAGGACAGAGGG + Intronic
1119723792 14:76909504-76909526 ATGCCTCTGCAGAAGAAAGAAGG + Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120436615 14:84490300-84490322 ATTTAACTGCAAAAGAAGCAAGG - Intergenic
1120455059 14:84719486-84719508 GGATATCTGCACAGGAAGGATGG - Intergenic
1202830769 14_GL000009v2_random:26913-26935 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1125130496 15:36278980-36279002 AGATCTCTGCACAAGAAGGGTGG + Intergenic
1125218099 15:37302018-37302040 AAATCACTGCAGAAGAAGGTCGG + Intergenic
1125237005 15:37526455-37526477 ATATATGGGGAGAAGAAGGGAGG + Intergenic
1125323582 15:38513954-38513976 AGATCTCTGCAGCAGTAGGAAGG - Intronic
1126112277 15:45182346-45182368 TTTTATCTGTAGAAAAAGGATGG + Intronic
1126835253 15:52656876-52656898 ATATATCTTTAAAAGAAGTATGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127877468 15:63122973-63122995 ATATATCCCCAGGATAAGGAGGG - Intronic
1128030175 15:64473029-64473051 ATATATCTGAAGGGTAAGGAAGG + Intronic
1128825108 15:70707906-70707928 ATATATACCCAGAAGTAGGATGG - Intronic
1130423842 15:83775525-83775547 ATATATCTCCAGAAGGCTGAAGG + Intronic
1130603138 15:85291642-85291664 ATATAACTGGAGAAGGAGGAGGG + Intergenic
1130632794 15:85585939-85585961 ATATAACAGCACAAGAGGGAAGG - Intronic
1131285625 15:91054552-91054574 ATATAACTGGAGAAGGAAGAGGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1131772193 15:95750518-95750540 ATGGTTCTGCACAAGAAGGATGG + Intergenic
1131933100 15:97467975-97467997 ATGTATCTGCAGGAGGGGGATGG + Intergenic
1132204538 15:99977335-99977357 ATATATATGAAGAGGAGGGACGG - Intronic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1136741454 16:32533357-32533379 ATATATGTTCAGAAAAAAGAAGG - Intergenic
1137311841 16:47269834-47269856 ATAACTCTGGAAAAGAAGGAGGG + Intronic
1138000019 16:53268529-53268551 ATTTATATGCACAAGGAGGAGGG - Intronic
1138107590 16:54297539-54297561 AAATATCAGCAGAAGTAGCATGG - Intergenic
1138853140 16:60654755-60654777 TTATAGCTACAAAAGAAGGATGG + Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1140641735 16:76981887-76981909 ATATATATGGAGAAGACAGAGGG + Intergenic
1140689901 16:77471910-77471932 ATATATGCACAGAAGAAAGAGGG + Intergenic
1140858767 16:79001065-79001087 ATTAATCTGCAGGAGAAAGAAGG + Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1141734988 16:85846392-85846414 AAATATTTGTAGAAGAAAGAGGG - Intergenic
1203028149 16_KI270728v1_random:541877-541899 ATATATGTTCAGAAAAAAGAAGG + Intergenic
1203043572 16_KI270728v1_random:792554-792576 ATATATGTTCAGAAAAAAGAAGG - Intergenic
1142760150 17:2037229-2037251 ATATAATTGGAGAAGATGGATGG + Intronic
1142840283 17:2623195-2623217 AGAAATCTGCATAAGAAGCAAGG - Intronic
1143005797 17:3832739-3832761 ATATATCTGCAGAAGAAGGATGG - Intronic
1143346885 17:6256271-6256293 ATGTATGTGGAGAAGAGGGAGGG + Intergenic
1143751787 17:9033409-9033431 AGATGTCTGCAGAAGAAGTGAGG + Intronic
1143767906 17:9149692-9149714 ATCTATCAGCAAAAGAAGGAAGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1146601782 17:34223551-34223573 ATACATTTCCAGAAGAATGATGG - Intergenic
1147664516 17:42138183-42138205 GTATATCTGCAGAGGAAAGGGGG + Intronic
1148704166 17:49613659-49613681 ATATATCTACAGAACAAGCCTGG - Intronic
1148722236 17:49762591-49762613 ATAGCCCTGCAGAAGCAGGAAGG + Intronic
1149374274 17:56028469-56028491 ATGTATCTGAACAAGAAGAAAGG + Intergenic
1149587474 17:57802087-57802109 ATATTTCTGAAGAATATGGAAGG - Intergenic
1149939478 17:60848007-60848029 ATTTCTCTGCAAAAGAATGAAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155138943 18:23025317-23025339 ATTTAGCTGCACAACAAGGAGGG + Intronic
1155236596 18:23826053-23826075 ACATATCTGCAGAGGGAAGAGGG - Intronic
1155354575 18:24939957-24939979 ATTTATCTGGAAAAGAATGAGGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156990307 18:43400806-43400828 AGTTATCTGCAGAAGACGGCAGG + Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158043941 18:53132498-53132520 ATATATCTGAAAAAGAACAATGG - Intronic
1159402790 18:67959223-67959245 AAATATCTTTAGAAGAAGTAAGG + Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1160062093 18:75540103-75540125 TTGAATCTGCAGAAGGAGGAAGG + Intergenic
1161820467 19:6527784-6527806 ATAAATTTGCAGAAGAAGGCCGG - Intergenic
1166958503 19:46482693-46482715 ATATATGTGCAGCAGAATGATGG - Intronic
1167713638 19:51126973-51126995 ATAGATCTGGAGAAAAAGGAAGG - Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
1202641924 1_KI270706v1_random:100863-100885 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
926655666 2:15402816-15402838 ATATTTCTGATGAAGAAAGATGG + Intronic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
927583026 2:24272291-24272313 AAATATCTGGAGAGAAAGGAAGG - Intronic
927760717 2:25751331-25751353 CTCTATCTGCTTAAGAAGGAGGG + Intronic
928012072 2:27618508-27618530 ATATATCTGCCTAAGAACAAGGG - Intronic
928157849 2:28893275-28893297 ATAAATCTGGAGAAACAGGAGGG + Intergenic
928910926 2:36420105-36420127 AGATATCAGAAGAAGAAAGAGGG - Intronic
929365109 2:41144923-41144945 TTATTTCTGCAGAAGAAAGAAGG - Intergenic
929365159 2:41145673-41145695 TTATCTCTGCAGAAGAAAGAAGG + Intergenic
929986868 2:46743134-46743156 ACATATATGCAGTGGAAGGAGGG - Intronic
930052526 2:47227815-47227837 AAATGGCTGCAGAAGGAGGAGGG - Intergenic
931035089 2:58231545-58231567 ATATTTCTGGAGAAGAATGGAGG - Intronic
931070843 2:58647866-58647888 ATATTTCTGCACAACAAGGCAGG - Intergenic
931821359 2:65955377-65955399 ATATATCTCCAGAGGAGGGAGGG - Intergenic
931978661 2:67670637-67670659 ATAAATTTTCAGAAGGAGGATGG + Intergenic
932137287 2:69242405-69242427 AGATATTGGCAGAAGAAGGCTGG + Intronic
932834664 2:75025195-75025217 AAAGATCTGCATAGGAAGGAGGG - Intergenic
933284533 2:80371168-80371190 AGAAATCTGCAGAAGCAGAAAGG - Intronic
933332046 2:80905053-80905075 ATGTACCTGTAGAAGAAGTATGG + Intergenic
933909182 2:86924044-86924066 ATCTACCAGCAGAAGAAGGATGG - Intronic
933928772 2:87126624-87126646 ATCTACCAGCAGAAGAAGGATGG - Intergenic
934000105 2:87702409-87702431 ATCTACCAGCAGAAGAAGGATGG - Intergenic
934023542 2:87979341-87979363 ATCTACCAGCAGAAGAAGGATGG + Intergenic
934174169 2:89564531-89564553 ATACATCTTCAGAAAAAGGAGGG + Intergenic
934284485 2:91638880-91638902 ATACATCTTCAGAAAAAGGAGGG + Intergenic
934939160 2:98487703-98487725 ATATGTCTGAAGAACAAAGAAGG + Intronic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935965863 2:108474815-108474837 TTATTGCTGCAGAAGAAGGAGGG + Intronic
937401802 2:121590541-121590563 TTATATCTGTAGAAAAAAGATGG - Intronic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937729592 2:125212384-125212406 AGATATCTGAATAAGATGGATGG - Intergenic
938180027 2:129172844-129172866 ATATATTTCCAAAAGAAGCATGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939684667 2:145184401-145184423 ATATATTGGCAGCAGGAGGAAGG + Intergenic
939716980 2:145596120-145596142 AAATATCAGCAGAAGTGGGAGGG - Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939887516 2:147697270-147697292 ATCTAACTGCAGAAGGAGGTTGG - Intergenic
940218818 2:151329190-151329212 AGCCTTCTGCAGAAGAAGGAGGG - Intergenic
941025306 2:160450015-160450037 AGGAATCTGCAAAAGAAGGAGGG - Intronic
941388382 2:164881188-164881210 ATAAATTTCAAGAAGAAGGAAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
942428084 2:175880317-175880339 ATATATGTGCTGAATAAGGAAGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943249057 2:185494272-185494294 ATATATGTCCAGAAAAAGCAGGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
944637645 2:201690274-201690296 ATAAATCTGCAGAAGGACAAGGG + Exonic
945408585 2:209481643-209481665 ATTTGACTGCAGATGAAGGAAGG + Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946723661 2:222639432-222639454 AAAAATCTGCAGAGGAAGAAAGG + Intronic
946814039 2:223557690-223557712 ATATATATGCAAAAGTGGGATGG - Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948667328 2:239544964-239544986 CTAGCTCTGCAGGAGAAGGAGGG - Intergenic
1169048602 20:2558248-2558270 AGAAAACTGCAGAAGCAGGAAGG - Intronic
1170219840 20:13930182-13930204 AAATCTCTTCAGAAGCAGGAAGG - Intronic
1171002847 20:21432180-21432202 ATTCATTTGCAAAAGAAGGAAGG - Intergenic
1171491606 20:25523203-25523225 ATATATATTCAGAAAAAGAAAGG - Intronic
1171889039 20:30691053-30691075 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1172574473 20:35997119-35997141 AAAGATCTGCAGAGGATGGAAGG - Intronic
1174876844 20:54235781-54235803 ATATAACTGCAAAAAAAGAATGG + Intergenic
1174957757 20:55118939-55118961 ATATTTCTGCAGTACAATGAGGG + Intergenic
1175049665 20:56143023-56143045 AAATACCTGCAGGAAAAGGAGGG - Intergenic
1176609956 21:8871751-8871773 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1176686311 21:9851327-9851349 GAATATTTTCAGAAGAAGGAAGG - Intergenic
1176705328 21:10112931-10112953 ATATATTTGGAGGAGAAAGAAGG + Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1176968287 21:15236425-15236447 AGAAAACTGCAGAAGCAGGAAGG - Intergenic
1176998157 21:15580155-15580177 AGTTATCTGCAGAAGACGGCAGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178085235 21:29105556-29105578 ATTTATCTGGAGAAGTGGGATGG + Intronic
1179778710 21:43685687-43685709 ATATGTCTACAGAAGACAGAAGG + Intronic
1180360021 22:11881002-11881024 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181454084 22:23045804-23045826 ATAGATCTGAAAAAGAAGCAAGG + Intergenic
1182440561 22:30361491-30361513 AAAAAACTGCAGAAGCAGGAAGG - Intronic
1182768160 22:32773834-32773856 TTCTATCTGAAGAGGAAGGAGGG + Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
1184673151 22:46026188-46026210 GTATATCTGGAGAAGCTGGAAGG + Intergenic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
949965677 3:9354108-9354130 CTATAATGGCAGAAGAAGGAAGG + Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951292222 3:20885563-20885585 ATATATCTAAAGAAGATGAATGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
952814239 3:37433053-37433075 AATTATATACAGAAGAAGGATGG + Intronic
953794729 3:45975874-45975896 AAACATGTGCAGAAGGAGGAAGG + Intronic
953857801 3:46514545-46514567 AGAAAACTGCAGAAGCAGGAAGG + Intergenic
954951718 3:54480662-54480684 AAATATCTCTAGAAGGAGGAAGG - Intronic
955819923 3:62886006-62886028 ATATATTTCCTGAAGAAGGACGG + Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957311431 3:78524350-78524372 ATTTATTGGCAGAAGATGGAAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957907324 3:86574371-86574393 GTATATACCCAGAAGAAGGATGG - Intergenic
957994315 3:87669485-87669507 ATAAATGTTAAGAAGAAGGAAGG - Intergenic
958076138 3:88681115-88681137 ATATATCTAGAGATGAAGCAAGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958915185 3:100041973-100041995 ATATAGCTGAAGAAAGAGGAAGG - Intronic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959439506 3:106359152-106359174 AGTTATCTGCAGAAGACGGCAGG - Intergenic
959576778 3:107942937-107942959 ACATATCTGCAGAAGAAAAAAGG - Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959858585 3:111190595-111190617 CTATAACTTCATAAGAAGGAAGG + Intronic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960245517 3:115395900-115395922 AAATGTCTGAAGTAGAAGGATGG - Intergenic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961466189 3:127083084-127083106 AGATGCCTGCAGAAGAAGGGGGG - Intergenic
961848186 3:129786597-129786619 ATATATATTTAGAAGAGGGAAGG - Intronic
962622532 3:137194023-137194045 ATAGATCTGATGAAGAAAGATGG - Intergenic
962815696 3:138996143-138996165 ATAAAGCTGAAGAGGAAGGAGGG - Intergenic
963431069 3:145204394-145204416 ATATATCTGCTGAAAAAGCTAGG + Intergenic
963860040 3:150299825-150299847 ACATAACTGAAGTAGAAGGAAGG + Intergenic
964038409 3:152227434-152227456 CTATATATGCTGAAGAACGAGGG + Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964698330 3:159535292-159535314 ATATACCTGTAGAAGAATGATGG - Intronic
964777803 3:160297780-160297802 ATATATAGTCAGAAAAAGGATGG - Intronic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965935424 3:174104157-174104179 AAATAACTGCAGAAGAAATAAGG - Intronic
966008374 3:175045782-175045804 TTATCTCTGGAGTAGAAGGAAGG - Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
1202736642 3_GL000221v1_random:6541-6563 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
968377899 4:59267-59289 ATAATTCTGAAGAAAAAGGAGGG - Intronic
968400876 4:296299-296321 ATAGCTCTGCAGAAAAAGGATGG + Intronic
968406394 4:343296-343318 ATAGCTCTGCAGAAAAAGGATGG - Intronic
968419574 4:472845-472867 ATAGCTCTGCGGAAAAAGGAAGG + Intronic
969828026 4:9773477-9773499 ATACATCTTCAGAAGAAGGAGGG + Intronic
970050566 4:11909822-11909844 ATATATCTGCAAAAAAAGTAAGG - Intergenic
971531343 4:27692954-27692976 TGATCTCTGCACAAGAAGGACGG + Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972308202 4:37852665-37852687 AACTATCTGCTGAAAAAGGAAGG - Intronic
972588618 4:40462415-40462437 ATATATTTGCAGCAGAGGGAAGG - Intronic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975035670 4:69677275-69677297 ATAGACATACAGAAGAAGGATGG + Intergenic
975745650 4:77472051-77472073 AGATCTCTGTAGAGGAAGGATGG - Intergenic
975962148 4:79923793-79923815 AAATATTTGTAGAAGAAGCATGG + Intronic
976231184 4:82844990-82845012 TTAAAACTGCAAAAGAAGGAGGG + Intronic
976520793 4:86023140-86023162 ATATACATGCAAAAGAATGAAGG - Intronic
977430763 4:96928182-96928204 AGGTATCTGCAGAAGATGGCAGG - Intergenic
977459513 4:97307828-97307850 AGAAAACTGCAGAAGCAGGAAGG - Intronic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
979644582 4:123053403-123053425 ATATTTCTGCACAGGCAGGATGG + Intronic
980377591 4:131969615-131969637 ATATATTTGGAGGAGAAAGAAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980917550 4:139048075-139048097 ATAAATCTGGATAAGAATGAAGG + Intronic
982465358 4:155723613-155723635 AAATAAATGCAGAAGAAGAAGGG - Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983879761 4:172919563-172919585 ATATTTTTGTAAAAGAAGGAAGG + Intronic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984075366 4:175170945-175170967 CTGTATCTGCAGTGGAAGGAAGG - Intergenic
984315299 4:178122065-178122087 CTATATCTCCAGAAGGAAGAGGG + Intergenic
984423686 4:179556421-179556443 ATATATCTGCGTGAGAAGAAAGG - Intergenic
985135842 4:186785338-186785360 ACATATCTCCAGAAGTGGGATGG + Intergenic
1202769292 4_GL000008v2_random:186728-186750 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987380070 5:17276495-17276517 AAATATCTGGAGAGGAAGAATGG - Exonic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
989563904 5:42881958-42881980 TTCTATTAGCAGAAGAAGGAGGG - Intronic
991232220 5:64347405-64347427 AACTATCTGGAGAAGAGGGAAGG + Intronic
991491618 5:67189198-67189220 TTATATATTCAGGAGAAGGAGGG - Intronic
991516170 5:67438006-67438028 GTACATCTGCAGAAGTAGGCTGG + Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992271502 5:75068883-75068905 AAACATCAGCAGAAAAAGGATGG + Intronic
992589953 5:78284646-78284668 ATATATATGCAAAAGAAAAAAGG + Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993457778 5:88144864-88144886 CTAAATCTGCAAAAGAATGAAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
993949455 5:94155588-94155610 ATATATGAGAGGAAGAAGGAGGG + Intronic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
996218578 5:120899269-120899291 ATTTATATGCACAAGAAGGCAGG + Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997608594 5:135194235-135194257 ATTTATCTGGAGAGGAAAGAAGG + Intronic
997783676 5:136685925-136685947 AGATATCTGCACAAGAAAAATGG - Intergenic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
999602106 5:153278447-153278469 AAATATCTGAAGCAGAAAGAAGG - Intergenic
1000043957 5:157506108-157506130 ATATATGTTCAGAAGAAGAATGG - Intronic
1000223249 5:159234277-159234299 AGGTATCTGCAGAAGATGGCAGG + Intergenic
1000628515 5:163566125-163566147 ACGTATCTGCAGAACAAGAATGG - Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001897172 5:175392573-175392595 ATCTATCTGAACAAGAGGGATGG - Intergenic
1002505997 5:179679476-179679498 ATACATATGCAGATGAAGGACGG + Intronic
1002667567 5:180836975-180836997 ATGTATCTGCAGAAAAATGTGGG - Intergenic
1002923861 6:1593670-1593692 TTAAAACTCCAGAAGAAGGAAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003336162 6:5174976-5174998 ATTCATGTGCAGATGAAGGAAGG + Intronic
1003476014 6:6483661-6483683 ATATATGTTCAGAAGTGGGATGG - Intergenic
1003577232 6:7308665-7308687 ATATATCTGGTGAAGAATAAGGG - Intronic
1004871464 6:19908762-19908784 ATAATTGTGGAGAAGAAGGAAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006462098 6:34166053-34166075 ATCCATATGCAGAAGAATGAAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008820395 6:55625124-55625146 AGTTATCTGCAGAAGACGGCTGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1009862342 6:69350379-69350401 AAATATCTGCAGGAGTAGCAAGG - Intronic
1010475064 6:76276552-76276574 AGATCTCTGTACAAGAAGGATGG + Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011474614 6:87739097-87739119 CTATCTCAGCAGAAGAAAGAGGG - Intergenic
1011487592 6:87858795-87858817 ATATTTCTGCACAAGAAAGAGGG - Intergenic
1011979381 6:93353535-93353557 CTTTATCTGCAGAAGCATGAGGG - Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012595716 6:101036235-101036257 AAATATTTGTAGAGGAAGGAAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013141429 6:107339737-107339759 GTATATTTGCAGCACAAGGAGGG + Intronic
1013479091 6:110537628-110537650 GAATGTCTGCATAAGAAGGAGGG - Intergenic
1013923992 6:115446154-115446176 ATAGAACTGCAGAGGAAGGGAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015306582 6:131715588-131715610 ATATCCCTGCACAGGAAGGATGG - Intronic
1015407929 6:132857964-132857986 ACATATCTGCTAAAGAATGAGGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016832429 6:148447082-148447104 ATTTATCTGTAGAGGCAGGAAGG + Intronic
1017016032 6:150100192-150100214 ACTTATCAGCAGAAGAAGGTGGG + Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018777090 6:167027581-167027603 ATGTCTCTCCAGAAGAGGGAAGG - Intronic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1019416325 7:928357-928379 CTATCTCTGCAAAAAAAGGAAGG + Intronic
1020062631 7:5164034-5164056 ATATAGCTGATAAAGAAGGACGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1021284992 7:18770007-18770029 ATATACCTACAGAATACGGATGG + Intronic
1022709601 7:32838351-32838373 ATATAACTGCAGAGAAAGCAGGG - Intergenic
1022903693 7:34835182-34835204 ATAGGTCTGCAGAAGAAGACTGG + Intronic
1023590476 7:41776194-41776216 ACATATATTCAGAAGTAGGATGG + Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1025531287 7:61887946-61887968 ATATATGTTCAGAAAAAAGAAGG - Intergenic
1027856984 7:83524286-83524308 ATTTATCTGCTGAAGAAGACTGG - Intronic
1027858619 7:83545832-83545854 ATATATCTCCAGTAGTATGACGG + Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029057114 7:97758304-97758326 AGAAAACTGCAGAAGCAGGAAGG - Intergenic
1030220130 7:107089712-107089734 ATAAATCTGCAAAACAAGTAAGG - Intronic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030902317 7:115139928-115139950 CTATCTGTGCAGAAAAAGGAGGG + Intergenic
1030977392 7:116143752-116143774 ATATGTTTGCAGAAGGAGTAGGG - Intronic
1031254191 7:119427721-119427743 AAAGATCTGCAGGAGAAGCATGG - Intergenic
1031437190 7:121747255-121747277 AGATATCAGCAGCAGAAGGTTGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033325826 7:140377383-140377405 AATTATCTCCAGGAGAAGGAAGG - Intronic
1033399461 7:141008064-141008086 AGAGATCTGCAAAAGAGGGAGGG - Intronic
1033730967 7:144178912-144178934 ATATCCCTGCACAGGAAGGATGG + Intergenic
1034943799 7:155249205-155249227 ATCTACCAGCTGAAGAAGGAGGG - Intergenic
1037140289 8:15511227-15511249 ATTTCTCTCCAGTAGAAGGAGGG + Intronic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037893052 8:22634102-22634124 AGCTGTCTGCAGAAGCAGGAAGG + Intronic
1039118523 8:34119282-34119304 ACATCTCATCAGAAGAAGGAAGG - Intergenic
1041600977 8:59717105-59717127 ATATATCTGCATATGTAAGAGGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1043014171 8:74917843-74917865 ATATTTCTGGAGAAGAAAGAAGG + Intergenic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045623335 8:104009665-104009687 ATATCTCTGAAGAACAAGTATGG - Intronic
1046720242 8:117611003-117611025 ATATATGGACAGAAAAAGGAAGG + Intergenic
1046874837 8:119242601-119242623 AAAAATCAGCAGAAGAAGGGTGG + Intronic
1047422507 8:124718680-124718702 AGATATTTGCAGAAGGAGGCTGG - Intronic
1047451676 8:124970614-124970636 ATATTTCAGCAGAAGTATGAAGG - Intergenic
1047504793 8:125470505-125470527 TTATAACTGCAGGGGAAGGAAGG + Intergenic
1048857855 8:138699236-138699258 AAATCACTGCAGGAGAAGGAAGG - Intronic
1049696180 8:143985361-143985383 AGATTTCTGCAGGAGAGGGACGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050720948 9:8588810-8588832 ATTTCTCTGAAGAAGAATGAGGG - Intronic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051511524 9:17883972-17883994 ATATATCAGCAGAAGTTGAATGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051925088 9:22315925-22315947 ACATTGCTGAAGAAGAAGGAAGG - Intergenic
1052371901 9:27675121-27675143 ATATAACTGTAGAAGAATCAGGG - Intergenic
1052404971 9:28047821-28047843 ATAAATCTTCAGAAGAATAAAGG + Intronic
1052602604 9:30655110-30655132 ATATCTCAGTAGAAGAAAGAAGG - Intergenic
1052884838 9:33634780-33634802 ATATATCTGAGGAAGTAGAAAGG + Intergenic
1053412442 9:37924471-37924493 ATATTTATGCAGGAGAAGGATGG + Intronic
1054323465 9:63697301-63697323 ATATATTTGGAGGAGAAAGAAGG + Intergenic
1054360421 9:64108911-64108933 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1055122011 9:72671369-72671391 AGAAAACTGCAGAAGCAGGACGG - Intronic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056032577 9:82568260-82568282 ATTTATCTGCATAAAAAGGTGGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1057681145 9:97186735-97186757 ATTTATCTACATGAGAAGGATGG + Intergenic
1057981597 9:99669418-99669440 TAATATCTGCACCAGAAGGAAGG - Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058133326 9:101278304-101278326 ATATTTGTGAAGAAGAGGGATGG + Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058371099 9:104268737-104268759 AAATATCTGTTGAAGAAAGAAGG - Intergenic
1058544169 9:106042782-106042804 TTATATCTGCAGAAGATGGCAGG + Intergenic
1058570190 9:106333425-106333447 AAATATCTGCAGAATCATGATGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059196508 9:112375898-112375920 AGTTATCTGCAGAAGAAGGCAGG + Intergenic
1059294250 9:113255688-113255710 ACAATTCTGCAGAATAAGGAAGG + Intronic
1059631772 9:116132213-116132235 ATATATATCCAGAAGTGGGATGG - Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1202790361 9_KI270719v1_random:83028-83050 ATATATTTGGAGGAGAAAGAAGG + Intergenic
1203694180 Un_GL000214v1:80444-80466 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203705374 Un_KI270742v1:36981-37003 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1203558635 Un_KI270744v1:28824-28846 ATTTCTCTGCAGAAGAGGAATGG + Intergenic
1203571339 Un_KI270744v1:134980-135002 ATAATTCTGAAGAAAAAGGAGGG + Intergenic
1203642093 Un_KI270751v1:23619-23641 ATTTCTCTGCAGAAGAGGAATGG - Intergenic
1185764555 X:2715111-2715133 GAAGAGCTGCAGAAGAAGGAAGG - Intronic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186826823 X:13348819-13348841 ATTTATCTGCAAAATAAGGATGG - Intergenic
1187365016 X:18659704-18659726 AGAAAACTGCAGAAGCAGGAAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1187951737 X:24477525-24477547 ATATATGGGCAAAAGCAGGAAGG - Intronic
1188565542 X:31522383-31522405 ATATAGCTGCACAGGAAGGAGGG + Intronic
1190801680 X:53795071-53795093 ATATACATGCAGACAAAGGAGGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191769500 X:64740129-64740151 AGTTATTTGCAGAAGAAGGCAGG + Intergenic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194353300 X:92849657-92849679 ATACAGCTGCAGAAGCAGTAGGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195892412 X:109710194-109710216 ATATTTTTGCAAAAGAAAGAGGG - Intronic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196969057 X:121088740-121088762 AAATAACTGCAGAAAAAAGAAGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197285749 X:124593248-124593270 AGATCTCTGCACAGGAAGGATGG + Intronic
1197686665 X:129446281-129446303 CTATGTATGCAGAAGAAGGGGGG - Intergenic
1198147736 X:133874402-133874424 ATATATGTGCATAAAATGGAAGG - Intronic
1198279290 X:135126126-135126148 AGATGACTGCACAAGAAGGATGG + Intergenic
1198291667 X:135246394-135246416 AGATGACTGCACAAGAAGGATGG - Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1199734408 X:150671040-150671062 ACAAATCTGCACAAAAAGGAAGG + Intronic
1200559074 Y:4677376-4677398 ATATAGAGACAGAAGAAGGAGGG + Intergenic
1200661658 Y:5966730-5966752 ATACAGCTGCAGAAGCAGTAGGG - Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic