ID: 1143012008

View in Genome Browser
Species Human (GRCh38)
Location 17:3871124-3871146
Sequence CAGCGAGACCAGGGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 347}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143011996_1143012008 17 Left 1143011996 17:3871084-3871106 CCGCCTGAATGTGTTGGCTGGAC 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG 0: 1
1: 0
2: 2
3: 32
4: 347
1143011997_1143012008 14 Left 1143011997 17:3871087-3871109 CCTGAATGTGTTGGCTGGACTGG 0: 1
1: 0
2: 1
3: 10
4: 114
Right 1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG 0: 1
1: 0
2: 2
3: 32
4: 347
1143011995_1143012008 18 Left 1143011995 17:3871083-3871105 CCCGCCTGAATGTGTTGGCTGGA 0: 1
1: 0
2: 1
3: 14
4: 185
Right 1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG 0: 1
1: 0
2: 2
3: 32
4: 347
1143011993_1143012008 19 Left 1143011993 17:3871082-3871104 CCCCGCCTGAATGTGTTGGCTGG 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG 0: 1
1: 0
2: 2
3: 32
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143012008 Original CRISPR CAGCGAGACCAGGGGGAAGG TGG Intronic
900357735 1:2272870-2272892 CAGCGAGCCTCGGGGGCAGGAGG - Intronic
900644330 1:3702241-3702263 CAGGCAGGCCAGGGGGCAGGCGG + Intronic
900853620 1:5163211-5163233 CAGCGAGATGAGGGTTAAGGGGG - Intergenic
900970854 1:5991913-5991935 CAGAGAGGCCAGGGGGCAGGGGG + Intronic
901239748 1:7686077-7686099 CAGGCAGCCCAGGTGGAAGGAGG - Intronic
901623283 1:10606306-10606328 CAGCGAGAGCGGGGAGAAAGCGG + Intronic
901964979 1:12859194-12859216 CAGCGATACCAGAGGGAGGCAGG - Exonic
902392645 1:16115392-16115414 CAGGGACACCTGGGAGAAGGAGG + Intergenic
902408181 1:16197949-16197971 AAGGGTGACCAGGGGGCAGGGGG - Intronic
902725756 1:18334952-18334974 CCGCGCCACCAGGGAGAAGGTGG + Exonic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
903460449 1:23516959-23516981 CAGCAACCCCAGTGGGAAGGGGG - Intronic
903688753 1:25153992-25154014 CAGAGAGATGAGGTGGAAGGAGG - Intergenic
904568890 1:31445733-31445755 CATTGAGACCAGAGGGAAAGAGG - Intergenic
904842108 1:33379375-33379397 AGGGGAGACCGGGGGGAAGGGGG - Intronic
905104708 1:35557498-35557520 CCGCGAGACCAAGGGGGAGGAGG + Intronic
905552579 1:38855191-38855213 CAGTCAGTCCAGGGGGGAGGTGG + Intronic
906258557 1:44368788-44368810 CAGGCAGACAAGGGGAAAGGGGG + Intergenic
907328170 1:53654328-53654350 CACAGAGGCCAGGGGGATGGAGG + Intronic
907342666 1:53747991-53748013 CAGGGAGACCAATGGGAAGCTGG - Intergenic
907414272 1:54303370-54303392 CAGTCAGCCCAGGGGGCAGGGGG + Intronic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
912719017 1:112004182-112004204 CTGCGAGGCCAAGGGGAAAGGGG - Intergenic
912815381 1:112824483-112824505 AAGCCAGACCAGGTGTAAGGAGG + Intergenic
912941111 1:114045655-114045677 CACCGAGGCCAGAGGGAAAGCGG + Intergenic
913186345 1:116373502-116373524 CACCGCCACCATGGGGAAGGGGG + Intronic
914377096 1:147080916-147080938 AACCGAGACCAGAGGAAAGGAGG + Intergenic
915358738 1:155273045-155273067 TAGGGAGATGAGGGGGAAGGAGG - Intronic
915511412 1:156388811-156388833 CAGCCAGCCCGGGAGGAAGGCGG + Intergenic
919293638 1:195666273-195666295 CAGAGAGACAAAGAGGAAGGTGG + Intergenic
920255639 1:204652280-204652302 CAGGGAGGCAAGGAGGAAGGCGG - Intronic
921351657 1:214242340-214242362 CAGCAAGAGCAGGAGGAAGAAGG - Intergenic
922574700 1:226654065-226654087 CAGCCGGACCAGGGTGAGGGAGG + Intronic
923907504 1:238401778-238401800 CAGCCGGAGCAGGGGGAAGAGGG + Intergenic
924045960 1:240030826-240030848 GATTGAGCCCAGGGGGAAGGAGG + Intronic
924577399 1:245292792-245292814 CAGCGAGAACCGAGGGAAGGTGG - Intronic
924583733 1:245344061-245344083 CAGCGAGGCAGGGAGGAAGGAGG - Intronic
924931193 1:248733696-248733718 AAGCGAGACCAGAAGGTAGGAGG - Intronic
1062955880 10:1540349-1540371 CAGCCAGACCAGGAGGGCGGGGG - Intronic
1062973302 10:1665021-1665043 CACCTTGACCAGGGGCAAGGGGG + Intronic
1063876479 10:10484193-10484215 CAGAGAGAGGAGGGGGAGGGAGG - Intergenic
1063949449 10:11208528-11208550 CAGAGAGGCCAGGGAGAATGCGG - Intronic
1063985911 10:11501682-11501704 CTGAGAGACCAGTGAGAAGGTGG - Intronic
1065318001 10:24483363-24483385 CAATGAGAACAGGCGGAAGGTGG - Intronic
1067082417 10:43219174-43219196 GAGCGAGGCCAAGGGGAGGGGGG - Intronic
1067229004 10:44394049-44394071 CAGCCAGACCAGGGAGCATGAGG - Intergenic
1068360714 10:55972948-55972970 CAGCCAGACCAGGTGTGAGGAGG - Intergenic
1069562716 10:69442030-69442052 CAGGGAGAGCAGGGGACAGGAGG + Intergenic
1071055445 10:81503784-81503806 CAGCGAGACCAGGAGCCAAGTGG + Intergenic
1071470658 10:85981876-85981898 GAGAGGGACCAGGGAGAAGGAGG + Intronic
1071524053 10:86347963-86347985 CACTGGGACCATGGGGAAGGTGG - Intronic
1072288889 10:93943938-93943960 TAGAGAGACCAAGGGGGAGGTGG - Intronic
1072929868 10:99652741-99652763 CAGAGAGACCAGGGTGAGGTAGG - Intergenic
1073148287 10:101294639-101294661 CAGAGAGACCAGGTAGAAGGTGG + Intergenic
1074855055 10:117467267-117467289 CAGCGAGGCCAGGGAGAAAGTGG - Intergenic
1076064589 10:127439409-127439431 CAGAGAGACCTGGAGGAAGGTGG + Intronic
1077021869 11:420560-420582 CAGCGGCGCCAGCGGGAAGGCGG + Exonic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077405302 11:2379898-2379920 CTGCGACACCAGGGTGGAGGGGG - Intronic
1077974621 11:7234933-7234955 CAGCAAGTGCTGGGGGAAGGTGG + Intergenic
1078461015 11:11515443-11515465 CAGAGAGAGCAGGGGGAATCGGG - Intronic
1078707411 11:13758543-13758565 CAGCTAGATCAGAGGGAAGATGG - Intergenic
1079339176 11:19597982-19598004 CAGAGAGACCACGGGGCAGCTGG + Intronic
1079604088 11:22343586-22343608 CAGCCACAGCAGAGGGAAGGAGG - Intronic
1081679245 11:44990174-44990196 CAGCGATCCCATGGGGAAGGCGG + Intergenic
1082160320 11:48882676-48882698 CAGAGAGACCAGGGGGAGTCTGG - Intergenic
1082162046 11:48897730-48897752 CAGAGAGACCAGGGGGAGTCTGG + Intergenic
1082988067 11:59184971-59184993 CAGAGAGAGGAGGGGGAAAGGGG - Intronic
1083171304 11:60925194-60925216 CAGGGAGCCCTGGGGGAAGGGGG - Intronic
1083619546 11:64042101-64042123 CAGTGGGACCAGGCGGGAGGGGG + Intronic
1084605793 11:70170920-70170942 CAGTGGGGCCAGGGGGAAGGAGG - Exonic
1085024626 11:73229366-73229388 CAGCCAGACCAGGGCGCAGCGGG + Intronic
1085295626 11:75430120-75430142 CAGCGGGGCCAGCGAGAAGGCGG + Exonic
1085323891 11:75592168-75592190 CAGGAAGACCAGGGAGGAGGTGG - Intronic
1087487160 11:98770763-98770785 AAGGGAGACCATGGGGAAGAGGG + Intergenic
1087963988 11:104389788-104389810 GAGGGAGACAAGGGGGAGGGAGG - Intergenic
1089398813 11:118152820-118152842 GAGCGAGAGGAGGGGGAGGGAGG + Exonic
1090349802 11:126100787-126100809 CAGAGACACCAGGAGGGAGGGGG + Intergenic
1091889886 12:4045041-4045063 CTGGAAGACCAGGAGGAAGGGGG + Intergenic
1091891116 12:4055368-4055390 AAGGGAGAGCAGGGGGAAGCTGG - Intergenic
1091941352 12:4486049-4486071 CAGCTAAAGCAGGGGAAAGGAGG - Intergenic
1092285676 12:7128131-7128153 CAGCCAGAGCAGCGGGGAGGAGG - Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1095402474 12:41830811-41830833 AAGCAAGACCAGAGGGAGGGAGG + Intergenic
1096743860 12:53713066-53713088 CAGCAAGGCCAGGAGGGAGGTGG - Intronic
1097592319 12:61588618-61588640 AAGCCAGACCAGGTGTAAGGAGG - Intergenic
1098522391 12:71448050-71448072 GAGGGAGACGAGGAGGAAGGGGG - Intronic
1098891230 12:76012265-76012287 CAGGCAGACCAAGGAGAAGGTGG + Intergenic
1102461665 12:113103865-113103887 CAGCCAGCCCAGGCGGAAGTGGG + Intronic
1102759786 12:115375263-115375285 CAGGGAGATCAGGGCGAATGGGG + Intergenic
1103451660 12:121033503-121033525 CATCCAGACCAGGGGGACTGCGG - Exonic
1104473403 12:129049950-129049972 CAGCCAGATCAGGGTGAAGTTGG - Intergenic
1104538088 12:129637544-129637566 TGGCCAGACCAGGAGGAAGGGGG - Intronic
1105775367 13:23654453-23654475 CACCAAGACCAATGGGAAGGCGG + Intronic
1107123509 13:36819795-36819817 CAGCGAGACCACGAGCCAGGTGG + Exonic
1109744760 13:66610219-66610241 GAGAGAGAACAGGGGTAAGGGGG + Intronic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1113453275 13:110428464-110428486 CAGGGACACCCGGGGCAAGGTGG + Exonic
1113488795 13:110676310-110676332 CAAGGGGACCAGGGAGAAGGCGG + Intronic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115017406 14:28633831-28633853 CAGCTGGACCAGGGGAAAGTGGG - Intergenic
1118708392 14:68500762-68500784 CAGAGAGACCATGTGGCAGGGGG - Intronic
1118780529 14:69004842-69004864 CAGGGAGAGCTGGGGGAAGAGGG - Intergenic
1120832380 14:89008822-89008844 CAACCAGAGCTGGGGGAAGGAGG - Intergenic
1120864187 14:89281506-89281528 AAACGAGAAGAGGGGGAAGGAGG - Intronic
1121521069 14:94586650-94586672 CAGCCAGAACAGGAGGACGGTGG + Intronic
1122203745 14:100137994-100138016 GAGAGAGACCAAGGGCAAGGAGG + Intronic
1122412135 14:101531040-101531062 CAGAGGGACCAGGGGCAGGGCGG - Intergenic
1122853286 14:104548119-104548141 GAGCCAGAACAGGGGCAAGGTGG + Intronic
1122969820 14:105147975-105147997 CAGACAGACCCGGGGGCAGGGGG + Intronic
1202853412 14_GL000225v1_random:36044-36066 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1202854517 14_GL000225v1_random:42486-42508 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1202855962 14_GL000225v1_random:52511-52533 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1202865677 14_GL000225v1_random:115293-115315 CAGAGAGACGAAGAGGAAGGGGG + Intergenic
1125741208 15:41966156-41966178 CAGCTAGGCCTGGGGGAAGGAGG - Intronic
1127819199 15:62640370-62640392 CAGAGAGAAGAGGGGGACGGTGG + Intronic
1127892691 15:63269262-63269284 CTGTGAGACCAAGAGGAAGGAGG - Intergenic
1128354918 15:66919354-66919376 CAGCCTGAGCAGGGGCAAGGAGG + Intergenic
1129252782 15:74318130-74318152 CAGAGAGACTAAGGGGGAGGGGG + Intronic
1129786722 15:78314590-78314612 CAGCAAGACCTGCGGGGAGGTGG + Intergenic
1130146530 15:81278516-81278538 CAGGGAGACAAGGAGGAAGGAGG + Intronic
1130665572 15:85866619-85866641 CAGCGAGTCAAGGGAGGAGGTGG - Intergenic
1132093038 15:98960926-98960948 CAGCAGGACCAGGGAGACGGAGG - Exonic
1132739756 16:1405832-1405854 CACCGAGACCAGAGGATAGGAGG + Intronic
1133610850 16:7432036-7432058 CACCCAGCCCAGTGGGAAGGAGG + Intronic
1135186504 16:20320414-20320436 CAGGGAGATCAAGGTGAAGGTGG - Exonic
1135621793 16:23962261-23962283 GAGCGAAACCAGGTGGGAGGTGG - Intronic
1137906870 16:52332316-52332338 GAGCTAGAGCAGGGGGAGGGAGG - Intergenic
1138352145 16:56351822-56351844 GAGGGTGACCAGGAGGAAGGGGG - Intronic
1138356357 16:56384116-56384138 GAGCTGGATCAGGGGGAAGGAGG - Intronic
1138507730 16:57486502-57486524 CGGCGAGACCTGGCGGAGGGGGG - Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1140954437 16:79849198-79849220 CTGCAGGACCAGCGGGAAGGTGG - Intergenic
1141186263 16:81789772-81789794 GAGGGAGAGGAGGGGGAAGGTGG - Intronic
1141427141 16:83951884-83951906 CAGGGAGAGAAGGAGGAAGGAGG - Intronic
1141578543 16:84981615-84981637 CAGCGAGTCCCTCGGGAAGGAGG + Intronic
1141815157 16:86404708-86404730 CAGGAAGACCTGAGGGAAGGCGG - Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142707864 17:1708022-1708044 CAGCGGGACCAGGCGGAAGAGGG + Exonic
1142712258 17:1730067-1730089 AAGAGAGGCCAGAGGGAAGGTGG + Intronic
1143012008 17:3871124-3871146 CAGCGAGACCAGGGGGAAGGTGG + Intronic
1143771676 17:9173132-9173154 CAGAGAGACCAGGGGAGGGGAGG - Intronic
1143851790 17:9818281-9818303 AAGAGAGAGAAGGGGGAAGGTGG + Intronic
1144266417 17:13573859-13573881 CAGAGAGAGCAGAGAGAAGGAGG - Intronic
1144465735 17:15495663-15495685 GAGAGAGAGCAGGGGGCAGGAGG + Intronic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1144852507 17:18251158-18251180 CAGGGAGGCCAGGTGGGAGGTGG - Intronic
1145813857 17:27781542-27781564 CTGGGAGAGCAGGGGGAAGATGG - Intronic
1146943087 17:36857337-36857359 CAGGGAGACAAGGCGGAGGGAGG - Intergenic
1147193442 17:38749811-38749833 CAGCCACACCAGCGGGACGGGGG + Exonic
1147544865 17:41393529-41393551 CAGGCAGGCCAGTGGGAAGGAGG - Intronic
1148678057 17:49456533-49456555 CAGCGTGACCAGAGTGGAGGGGG - Intronic
1149342236 17:55698985-55699007 CAGGGAGGCCAGGGGAAGGGAGG + Intergenic
1151340924 17:73470481-73470503 CTGAGAGTCCAGGGGGCAGGGGG - Intronic
1151508273 17:74543275-74543297 CAGGGTGACCTGGGGGAATGGGG + Intronic
1152322939 17:79618483-79618505 CAGGCAGTCCTGGGGGAAGGAGG + Intergenic
1152723436 17:81933957-81933979 CAGCGAGGGCAGGAGGAAGGTGG + Intronic
1155298114 18:24403887-24403909 AATAGAGACCAGGGGGAAGGAGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156597483 18:38564195-38564217 GAGAGAGAGCGGGGGGAAGGGGG - Intergenic
1157118239 18:44882638-44882660 CAGCAACAGCTGGGGGAAGGAGG - Intronic
1157401270 18:47390514-47390536 CAGCCACAGCAGGGAGAAGGAGG + Intergenic
1157804090 18:50645092-50645114 CAGGGAGAACTGGTGGAAGGCGG + Intronic
1157885204 18:51359972-51359994 CAGAGAGGCCAGTGGGAAGCTGG - Intergenic
1158575036 18:58629518-58629540 CAGACAGACAAGGGGTAAGGGGG - Intergenic
1160509857 18:79447290-79447312 CAGCGAGGCGAGGGAGAAGGCGG - Intronic
1161083701 19:2324076-2324098 CAGCGGGACGAGGGGGATAGTGG - Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1162018518 19:7858161-7858183 CAGCGAGGACAGGGGGCAGGGGG - Intronic
1162718872 19:12649995-12650017 CAGCGACACCTGGGGGAAGGAGG - Exonic
1162801379 19:13112658-13112680 CAGGGAGACCGGGGGACAGGTGG - Intronic
1163442175 19:17327797-17327819 CAGCGCCGCCAGGGGGAAGGCGG + Exonic
1163678576 19:18667915-18667937 CAGCGAGGCCAGGCTGAAGGTGG - Exonic
1163770695 19:19189335-19189357 CAGAGAGGCCAGGGAGAAGGTGG - Intronic
1164156656 19:22601461-22601483 GAGGGAGCCCAGGAGGAAGGGGG + Intergenic
1165675414 19:37718717-37718739 GAGAGAGACCTGGGGGACGGTGG - Intronic
1166566234 19:43767214-43767236 CCCCGAGGCCAGGGGGCAGGAGG + Intronic
1167128450 19:47568213-47568235 CAGGGAGAGAAGGGAGAAGGTGG - Intergenic
1202706379 1_KI270713v1_random:27293-27315 CAGCTAGACCAGGTGGCAGCTGG - Intergenic
925036993 2:695255-695277 CATGGAGCCCAGTGGGAAGGTGG - Intergenic
925278269 2:2665710-2665732 CAGTGAGGCCTTGGGGAAGGAGG - Intergenic
925902983 2:8521753-8521775 CAGGGAGACAAGGGGCCAGGTGG + Intergenic
926118700 2:10229305-10229327 AAGCGTGAACAGGGGGAGGGTGG + Intergenic
926953643 2:18271430-18271452 CAGCGGGAGCAGGGTGGAGGAGG - Intronic
928089946 2:28367892-28367914 CAGGGAGAGCAGGGGTGAGGGGG + Intergenic
928280072 2:29938150-29938172 AAGGGAGGGCAGGGGGAAGGGGG + Intergenic
929604155 2:43224445-43224467 CAGCGAGTCCGGGGGGCTGGGGG + Exonic
930911845 2:56638316-56638338 CATTGAGACCAGGAGGAAGAAGG + Intergenic
931892264 2:66686425-66686447 CAGTGAGACCTGGAAGAAGGGGG - Intergenic
932122318 2:69113180-69113202 CAGCAGGACTAGGGGGAAGGTGG - Intronic
932307676 2:70715540-70715562 CACCAAGAGCAGGGGGCAGGTGG - Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934773232 2:96921301-96921323 TGGCGAGAGCAAGGGGAAGGCGG - Intronic
934974017 2:98787718-98787740 CAGAGAGACCCAGGGGAGGGAGG - Intergenic
935504132 2:103878690-103878712 CAGCGAGACCAGAGCTGAGGTGG + Intergenic
938386525 2:130870777-130870799 CAGCGAGACATGGGGGTTGGCGG + Intronic
940864483 2:158804472-158804494 CAGCCAGAGAAGGGGGCAGGAGG + Intronic
941683884 2:168428119-168428141 CAGGGAGACCTGGGGGAGAGGGG + Intergenic
948091883 2:235302043-235302065 AAGAGAGAGAAGGGGGAAGGAGG - Intergenic
948191408 2:236062106-236062128 GAGCGAGAGCAGGTGGAAGGTGG + Intronic
948204401 2:236155525-236155547 CAGGGAGACCAGTGGGCACGGGG - Intergenic
948856769 2:240733941-240733963 CGGCGAGACCTTGGGGATGGAGG - Intronic
948936367 2:241167544-241167566 CAGGGAGGCCAGGGTGCAGGAGG - Intronic
1170130277 20:13011575-13011597 ACGCTGGACCAGGGGGAAGGAGG - Intronic
1170822667 20:19767521-19767543 CTGAGAGACCAGAGGGCAGGAGG + Intergenic
1172271939 20:33659814-33659836 GAGCGGGCCCTGGGGGAAGGGGG + Intronic
1172801007 20:37576202-37576224 CAGTGAGACCAAGAGCAAGGAGG - Intergenic
1173310824 20:41894724-41894746 GAGCGAGGCCATGGGCAAGGGGG + Intergenic
1173574266 20:44100535-44100557 CAGGTAGACCAGGGGAAGGGAGG + Intergenic
1174656693 20:52177611-52177633 CACCGAGAACAGGAGGAAGACGG + Intronic
1175840042 20:62020931-62020953 CAGCGTGAACATGAGGAAGGAGG + Intronic
1179566325 21:42251333-42251355 CAGCAGCACCAGGTGGAAGGAGG + Intronic
1179572239 21:42284577-42284599 CAGCGAGACCACCTGGAAGCAGG - Exonic
1180010073 21:45043657-45043679 CTTCGAGACCTGGGGGAACGGGG + Intergenic
1180010088 21:45043701-45043723 CTTCGAGACCTGGGGGAACGGGG + Intergenic
1180156621 21:45981491-45981513 CTCCGAGCCCAGGGAGAAGGCGG - Intergenic
1180201968 21:46229475-46229497 GTGCGAGACCAGGGGGAGGGCGG + Intergenic
1180853343 22:19032313-19032335 CATCGACGCCAGCGGGAAGGTGG + Intergenic
1181106910 22:20581119-20581141 CTGGGAGACCAGGGGGTGGGGGG - Intronic
1181494309 22:23279406-23279428 CAGTGGGACCAGGAGCAAGGAGG - Intronic
1181580899 22:23827556-23827578 AAGAGAGAGCAGGGGGCAGGGGG - Intronic
1181933879 22:26426246-26426268 CAGCGAGAGCAGGAGGATGCAGG + Intergenic
1182358821 22:29734936-29734958 CCGCGGGAGCAGAGGGAAGGTGG + Intronic
1182522351 22:30891640-30891662 TGGCCAGACCTGGGGGAAGGGGG + Intronic
1183398281 22:37585749-37585771 CAGTGTGGCCAGGGGGCAGGTGG - Intergenic
1183465999 22:37980716-37980738 CTGGGAGACCAGGGAGAAAGAGG - Intronic
1183621013 22:38972640-38972662 CTGCGAGACCAGGTGGAGAGAGG - Intronic
1183685805 22:39360803-39360825 CAGGCAGAGAAGGGGGAAGGAGG + Intronic
1183784830 22:40023310-40023332 CAGGGAGCCCAGGAGGAATGGGG - Intronic
1185173616 22:49307112-49307134 CAGTGAGGCCAGGGCCAAGGGGG + Intergenic
1185268601 22:49918198-49918220 CGGCGAGACCAGGGAGGAGGCGG - Intronic
1185281754 22:49972645-49972667 CAGTGGGACCAGGGAGGAGGAGG - Intergenic
953748684 3:45593989-45594011 CAGCCAGGCCTGGGGGCAGGAGG + Intronic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
953957742 3:47244693-47244715 CTGAGACACCAGGGGGAAAGTGG + Intronic
954452745 3:50580452-50580474 CAGCCTGACCAGAGGGGAGGTGG + Exonic
954493159 3:50926850-50926872 CAGGGAGACCAGTTAGAAGGTGG - Intronic
955153091 3:56388358-56388380 TAGCAAGAGCAGGAGGAAGGGGG - Intronic
955552726 3:60101325-60101347 CAGTGAGCCCAGGGTGCAGGAGG - Intronic
960551955 3:118985828-118985850 CAGGAAGACAAGGGAGAAGGAGG - Intronic
960811518 3:121631680-121631702 CAGAGACAGCATGGGGAAGGAGG - Exonic
961514836 3:127426027-127426049 CAGTGAGTCCTGGGGGAAGCTGG + Intergenic
961532444 3:127547733-127547755 CAGCGAGAGGAGGGGAGAGGAGG - Intergenic
961603102 3:128075923-128075945 GAGCGAGACGAGGGGAAGGGGGG - Intronic
968184190 3:196620434-196620456 TAGCAATACCAGGGGGAAAGAGG - Intergenic
968654667 4:1773323-1773345 CAGCGAGATCTGGGTGAGGGTGG + Intergenic
968871514 4:3245081-3245103 CACCTGGACCAGGGAGAAGGGGG - Intronic
969365196 4:6690125-6690147 CAGAGAGGCCAGGAGGAGGGCGG - Intergenic
971850459 4:31979211-31979233 CAGTGAGATAAGTGGGAAGGAGG + Intergenic
974159509 4:58119657-58119679 CAGCGACACCAGGAACAAGGGGG - Intergenic
974774582 4:66463054-66463076 CAGCGAGGCTGGGGGGAGGGGGG - Intergenic
977348817 4:95853441-95853463 CTGAGAGACAAGAGGGAAGGAGG + Intergenic
977578240 4:98697515-98697537 TAGCAAGAGCAGGGAGAAGGAGG - Intergenic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
979742988 4:124174652-124174674 CAGCCACACCAGTGGGAAAGAGG + Intergenic
980140468 4:128909997-128910019 CAGAGAAACCAGAGTGAAGGCGG + Intronic
983555143 4:169053198-169053220 CACCCAGACAAGGGGTAAGGAGG - Intergenic
1202764094 4_GL000008v2_random:136283-136305 AAGCGGGACCAGGGAGAAGAGGG + Intergenic
986280094 5:6315700-6315722 CAGCAGGAGCAGGAGGAAGGTGG - Intergenic
986704160 5:10441640-10441662 CAGCCAGAGCAAGGGGAAGAGGG + Exonic
989167573 5:38446245-38446267 CAGAAAGGCCAGGGAGAAGGAGG - Intronic
989236724 5:39156426-39156448 CAGCAAAACCAGAGGGAAGCAGG + Intronic
990523176 5:56599510-56599532 CAGGGAGACCTGAGGGGAGGAGG + Intronic
990986966 5:61649582-61649604 CAGAGTGCACAGGGGGAAGGTGG - Intronic
991030960 5:62081898-62081920 CAGCGAGGCCAGAAGGAATGTGG + Intergenic
992023410 5:72647646-72647668 CAGTGAGATGAGGGGGAGGGAGG + Intergenic
993742262 5:91555795-91555817 CAGCGAGGCTTGGGGGAGGGGGG + Intergenic
994768585 5:103953858-103953880 CCGGGAGCCCACGGGGAAGGGGG + Intergenic
995012623 5:107274750-107274772 CAGGGAGAAAAGGGAGAAGGGGG + Intergenic
996019917 5:118579631-118579653 CTGCGAGACAAGGAAGAAGGGGG - Intergenic
997642771 5:135460373-135460395 CAGCGTGGCAAGGGGGAAGGAGG - Intergenic
997665319 5:135625718-135625740 CAGGTAGAACAGGGGGAAGAAGG + Intergenic
998193082 5:140043205-140043227 CAGCTAGGGCAGGGGGCAGGCGG + Exonic
999248534 5:150167922-150167944 AAGCGGGAGCAGTGGGAAGGGGG + Intronic
999326911 5:150649497-150649519 CAGAGGGACCAGGGGGAGGTAGG + Exonic
999740038 5:154542933-154542955 TAGGGATACCAGGTGGAAGGTGG - Intergenic
1001079997 5:168660696-168660718 CAGGGAGACCTGGGGGAAGAAGG + Intergenic
1001462091 5:171924929-171924951 CATCTAGACAAGGGGGAATGCGG - Intronic
1002135512 5:177105396-177105418 CAGTGAGAGCAGGGGGTGGGGGG - Intergenic
1002440624 5:179262563-179262585 CAGCGTGACCAAGGGGCAGAAGG - Intronic
1002601145 5:180354419-180354441 CTGCAAGCCCTGGGGGAAGGAGG + Intergenic
1003276340 6:4656380-4656402 AAGAGAGGCCAGGGGTAAGGAGG + Intergenic
1003679227 6:8235606-8235628 CAGACAGAGCAGGGGGAATGTGG + Intergenic
1004171869 6:13301515-13301537 CTGCCACACCAGGGAGAAGGTGG - Intronic
1004291547 6:14372140-14372162 CAGCGAGGGCAGAGGCAAGGAGG + Intergenic
1004346135 6:14850852-14850874 CAGCGACACCAAGGGAAAGTGGG - Intergenic
1005089178 6:22038443-22038465 CAGTGAGAGGAAGGGGAAGGAGG - Intergenic
1005200432 6:23338423-23338445 CAGGGAGACCAGGTAGAATGTGG - Intergenic
1006094350 6:31646603-31646625 CTGGGAGACCAGGGAGAAAGAGG - Intronic
1006457492 6:34140298-34140320 CAACGTGACCAGGGGGCAGTGGG + Intronic
1007825660 6:44598886-44598908 CAGGGAGGCCTGTGGGAAGGAGG + Intergenic
1008501929 6:52191700-52191722 GAGGGATAGCAGGGGGAAGGTGG - Intergenic
1017764021 6:157592680-157592702 CAGGGAGGGGAGGGGGAAGGAGG + Intronic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1021084813 7:16409455-16409477 CAGAGAGACCAGGTAGGAGGTGG + Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022089150 7:27096480-27096502 CAGCGCGCCCAGCCGGAAGGCGG + Intergenic
1023822177 7:43986424-43986446 CACCCAGGCCTGGGGGAAGGGGG + Intergenic
1023832875 7:44050304-44050326 CAGGGACACCAGGAGGTAGGAGG + Intronic
1025230969 7:57203201-57203223 CAGGGAGACCAGGGGGAACCAGG - Intergenic
1026015831 7:66669909-66669931 CAACGAGAACAGAGGGAAGTGGG - Intronic
1026148431 7:67768325-67768347 CAGCAAGACCAGGGTAAAGGAGG + Intergenic
1027858135 7:83539199-83539221 CTGGGAGCCCAGGGGGAAGCTGG + Intronic
1029607750 7:101609307-101609329 CTGAGAGGCCAGGAGGAAGGAGG - Intergenic
1029750443 7:102539838-102539860 CACCCAGGCCTGGGGGAAGGGGG + Intronic
1029768395 7:102638946-102638968 CACCCAGGCCTGGGGGAAGGGGG + Intronic
1030221495 7:107103748-107103770 CAGCTAGACCAGGTGGCAGCTGG - Intronic
1030638275 7:111974644-111974666 GGGAGAGACCAGGGGGAAGTAGG + Intronic
1030735533 7:113043495-113043517 CAGGGAGCCCAAGGGGAGGGAGG + Intergenic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032688160 7:134256681-134256703 TAGCTAGAAAAGGGGGAAGGTGG - Intronic
1033460316 7:141541612-141541634 AAGGGAGCCCAGGGAGAAGGAGG - Intergenic
1034267095 7:149786319-149786341 GAGGGAGACCAGGAGGAGGGAGG - Intergenic
1035161495 7:156953530-156953552 AAGCAATACAAGGGGGAAGGGGG - Intronic
1035392956 7:158517521-158517543 CAGCGAGGCCAGTGAGGAGGTGG - Intronic
1035587157 8:785533-785555 CAGAGAGACCTGAGGGGAGGAGG - Intergenic
1035912258 8:3580385-3580407 CAGGGATACCTGGGGGGAGGCGG + Intronic
1038313727 8:26465426-26465448 CAGAGGGACCAGGGGGTGGGAGG - Intronic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039886892 8:41659893-41659915 AAGCCAGGCTAGGGGGAAGGAGG - Intronic
1040672124 8:49704424-49704446 CAGGGTGACCTGGGGGATGGTGG - Intergenic
1041875051 8:62677886-62677908 TAGCTAGACCAGGGGATAGGGGG - Intronic
1042325739 8:67526023-67526045 GAGCGAGGCGAGGGGGAAGGGGG - Intronic
1043973540 8:86560048-86560070 CAGCTAGCCAAGTGGGAAGGTGG - Exonic
1045498966 8:102730562-102730584 CAGTGAGTCCAGGTGGGAGGTGG - Intergenic
1045743224 8:105386823-105386845 GAGCTAGAACAAGGGGAAGGTGG + Intronic
1045886891 8:107108703-107108725 CAGGGAGACCCAGCGGAAGGTGG - Intergenic
1047421222 8:124709910-124709932 CAGCTAAACCAGAGGGTAGGTGG - Intronic
1048728494 8:137412260-137412282 AAGCGAGACCAGGTGTGAGGAGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049706213 8:144044051-144044073 GAGTGAGTGCAGGGGGAAGGTGG - Intronic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1053063017 9:35045912-35045934 AAGCCAAACCAGGGGGAAGGTGG + Exonic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1055146127 9:72936986-72937008 CAGTGAAACCTAGGGGAAGGTGG + Intronic
1055300046 9:74873272-74873294 CTGAGAGAGCATGGGGAAGGAGG - Intronic
1055750665 9:79501176-79501198 CAGAGAGAAAAGGGGGAGGGTGG + Intergenic
1056112383 9:83408566-83408588 CAGCTACCCCAGGGGGAAAGGGG + Intronic
1056477506 9:86967255-86967277 CGGCCAGAGCAGGAGGAAGGGGG - Intergenic
1058161858 9:101578790-101578812 CAGAGAGAACAGGGGCAAGTGGG + Intronic
1058860458 9:109113075-109113097 CAGCGGGGCCAGGGGCAGGGCGG + Intronic
1059751242 9:117249613-117249635 CCTCAAGACCAGGGGGAAGGTGG - Intronic
1060106087 9:120874468-120874490 CTGTCAGACCAGGGGGCAGGGGG - Intronic
1060546536 9:124465173-124465195 GAGAGAGACCAGGAGGATGGAGG - Intronic
1060956175 9:127641955-127641977 CCGCAAGAGTAGGGGGAAGGAGG + Intronic
1061247321 9:129407259-129407281 AAGCCAGGCCAGGGGGAAGCAGG + Intergenic
1061814954 9:133188970-133188992 CAGCCAGACCCTGGGGAGGGCGG + Intergenic
1062032517 9:134368108-134368130 CAGGGAGTCCCGGGGGGAGGGGG - Intronic
1062295814 9:135825936-135825958 CAGGGAGCCCGGGGGGAAGCTGG + Intronic
1062415656 9:136448317-136448339 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415665 9:136448355-136448377 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415676 9:136448392-136448414 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415687 9:136448429-136448451 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415695 9:136448466-136448488 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415706 9:136448504-136448526 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415740 9:136448650-136448672 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415758 9:136448724-136448746 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415769 9:136448762-136448784 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415778 9:136448800-136448822 CAGAGACACCAGGAGGATGGAGG + Intronic
1062415786 9:136448836-136448858 CAGAGACACCAGGAGGATGGAGG + Intronic
1062542547 9:137048030-137048052 CGGCTAGAACAGCGGGAAGGTGG + Intergenic
1062588735 9:137263507-137263529 CAGGAGGGCCAGGGGGAAGGAGG - Intronic
1203738660 Un_GL000216v2:160865-160887 CAGAGAGACGAAGAGGAAGGGGG - Intergenic
1189332793 X:40153611-40153633 CAGCGAGCCCAGGGGAAAGGGGG - Intronic
1190949334 X:55127497-55127519 CAAGGATACCAGGGGAAAGGAGG - Intronic
1190958419 X:55220580-55220602 CATCAGGACCTGGGGGAAGGCGG - Exonic
1192019885 X:67377041-67377063 GAGTGAGACCTGGGGGAGGGTGG - Intergenic
1196017343 X:110954047-110954069 CAGTGAGATCAAGGGGAAGTGGG - Intronic
1196585042 X:117419384-117419406 AAGCCAGACCAGGTGTAAGGAGG - Intergenic
1196708261 X:118736411-118736433 CAGCAAATCCTGGGGGAAGGGGG - Intronic
1197230556 X:123999432-123999454 CAGGGAGAGAAGGGGGAGGGAGG - Intronic
1197980814 X:132217330-132217352 CGGCTAGACGAGGCGGAAGGTGG + Exonic
1200091342 X:153637528-153637550 CAGCGAGAACCCGGGGATGGGGG + Intergenic
1200412842 Y:2878285-2878307 GGGGGAGACGAGGGGGAAGGAGG - Intronic