ID: 1143013271

View in Genome Browser
Species Human (GRCh38)
Location 17:3878084-3878106
Sequence CACAGACCTTGCTGATGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143013271 Original CRISPR CACAGACCTTGCTGATGAGC AGG (reversed) Intronic
901731135 1:11280677-11280699 AACAGAATTTGCTGATGAACTGG - Intronic
902082190 1:13828817-13828839 CCCAGACCTTACTGAAGTGCTGG - Intergenic
904830863 1:33306138-33306160 TACAAACCATGCTTATGAGCAGG + Intergenic
905248562 1:36631315-36631337 CACATCCCTAGCTGATGGGCAGG + Intergenic
906702381 1:47869267-47869289 GACAGACATTGCTGATTAGCAGG + Intronic
907162637 1:52382470-52382492 CACAGGCCTTGCAGTTCAGCAGG - Intronic
907246369 1:53111582-53111604 CACAGAATTTGCTGAGGAACTGG + Intronic
907785779 1:57611253-57611275 CAGGAACCTTGCTGCTGAGCAGG - Intronic
907873902 1:58467076-58467098 ACCTGACCTTGCTAATGAGCAGG + Intronic
913062444 1:115220585-115220607 CAGAGGCCTGGCTGATGGGCTGG + Intergenic
913264927 1:117034655-117034677 CACAGAACTTGCTCTTGAGTGGG - Intronic
916779376 1:168008422-168008444 AAAAGAACTTGCTGATGAGCTGG - Intronic
916941070 1:169679119-169679141 GACATACCTTCCTAATGAGCTGG + Intronic
917666471 1:177230196-177230218 CACAGGCCCTGCTGGTGTGCTGG + Intronic
918932977 1:190880707-190880729 CACAGAAATTGAAGATGAGCAGG - Intergenic
919224454 1:194677286-194677308 CACAGGACTTGGTGATGAGCTGG - Intergenic
919515960 1:198523435-198523457 CACAGACCATGCTCAAGAGCTGG + Exonic
919973908 1:202598720-202598742 TACAGAACTTGCTGGTGAGAAGG + Intronic
922527618 1:226318003-226318025 CACCGACCTTGCTGCTGACCTGG + Intergenic
922723100 1:227908878-227908900 CACAGACCGTGAGGAGGAGCTGG - Intergenic
924638027 1:245807225-245807247 CAGAGACCATGCTGCTGACCAGG + Intronic
1066425858 10:35307034-35307056 AACATACCTTGCTGCTGGGCTGG + Intronic
1067766270 10:49089889-49089911 CACAGCCCTTGCTGTTGGCCTGG - Intronic
1069621460 10:69840101-69840123 AGCAGGCCTTGCTGATGGGCTGG + Intronic
1070803631 10:79257609-79257631 CACAGACCATGGTGATGTTCAGG + Intronic
1071490541 10:86133563-86133585 CAAAGCCCTTGCTGATGTGCTGG + Intronic
1071517804 10:86310548-86310570 CAGTGCCCTTGCTGAGGAGCAGG + Intronic
1071675404 10:87651163-87651185 TAAAGACCTTGCTGATTAACAGG + Intergenic
1074361988 10:112831063-112831085 CACAGAGCATGCAGATTAGCTGG - Intergenic
1074584817 10:114757564-114757586 TAGAGAACTTGCTGATGAGTTGG - Intergenic
1075717178 10:124563007-124563029 CTCAGACATTGCTGGTGAGAAGG + Intronic
1077151601 11:1075360-1075382 CACAGCCCTTGCTGGGGAGCGGG + Intergenic
1078531190 11:12138108-12138130 CAAAGACTTTGCTGAGGAGTAGG - Intronic
1081430176 11:42968062-42968084 CACAGACTTTGTTGATGAATAGG + Intergenic
1083170391 11:60920908-60920930 CACAGAAATGGCTGATGAGATGG - Exonic
1083302050 11:61744609-61744631 CACAGGCATCGCTGCTGAGCTGG + Exonic
1083349067 11:62014205-62014227 CACAGACCTTGCTGATAAAATGG + Intergenic
1083559081 11:63657477-63657499 CACAGACCTGGCTGTTGTTCTGG - Intronic
1085277560 11:75309786-75309808 CACAGGCCTTGCAGATAAGGTGG + Intronic
1085559570 11:77458655-77458677 TACAGACCTTACTGGTGAGCAGG + Intronic
1088365679 11:109037560-109037582 CAGAGATCTTACAGATGAGCAGG + Intergenic
1088615881 11:111627547-111627569 CACAGCCCCTGCAGATAAGCGGG + Intronic
1088732791 11:112698142-112698164 GACAGAATTAGCTGATGAGCAGG - Intergenic
1090830708 11:130419046-130419068 CACGGACCTGTCTGGTGAGCAGG + Exonic
1095955824 12:47805329-47805351 CAAAGACTTTGAAGATGAGCGGG - Intronic
1096605094 12:52759331-52759353 CAAAGACCCCGCTGATGAGAGGG - Intergenic
1103734422 12:123050183-123050205 CTCAGCCCTTTCTGATGGGCAGG + Intronic
1104685689 12:130782682-130782704 CACTGACCTCGCTGGTGACCTGG - Intergenic
1106239701 13:27901222-27901244 CACAGAGCTTGCAGAAGACCTGG + Intergenic
1106928576 13:34639028-34639050 CAAAGGCCTCCCTGATGAGCTGG + Intergenic
1110518302 13:76443245-76443267 AACACCCCTTGCTCATGAGCTGG + Intergenic
1111489566 13:88954193-88954215 CACAGTCCTTGCTGGTGTGAGGG - Intergenic
1112006798 13:95260446-95260468 CCCAGACCTGGCTGATAACCAGG - Intronic
1112114291 13:96335380-96335402 AACTGACCTTGGTGATGAACAGG + Intronic
1112218690 13:97464283-97464305 CAGAGCCCTTGCTGAAGAGTGGG + Exonic
1112675240 13:101693854-101693876 GTCAGACCTTGGTGATGACCTGG + Intronic
1114181494 14:20371873-20371895 CACAGGCCTTACTGGTGAGTTGG - Intronic
1114562717 14:23604811-23604833 CAAAGACCTTGCTGATAAAACGG - Intergenic
1115367399 14:32573850-32573872 CACAGACCATGTGGATGTGCAGG - Intronic
1116101854 14:40448461-40448483 AATAGACATTGCTGAAGAGCAGG + Intergenic
1117108853 14:52427774-52427796 TATAGACCTTGCTGATGAATTGG - Intergenic
1119109184 14:71955720-71955742 TAAAGACCTTGCTGATAAACAGG - Intronic
1119628564 14:76205754-76205776 CACAGTCATTGCTGATGCGATGG + Exonic
1122032375 14:98921790-98921812 GGCAGAGCTGGCTGATGAGCAGG - Intergenic
1122747764 14:103909590-103909612 CTCAGAGCTGGCTGTTGAGCAGG + Intergenic
1123005202 14:105318052-105318074 CCCAGCCCTTGCTGAAGAGCAGG - Intronic
1125458440 15:39885226-39885248 CTCAGAGGTTGCTGAGGAGCTGG - Intronic
1125680665 15:41528228-41528250 CACTCACCCTGCTGATGACCTGG + Exonic
1126356426 15:47801296-47801318 GACAGGCCTTGCTGATGGACTGG + Intergenic
1126875717 15:53038847-53038869 CAGAGACCCTGCTGTTGAGGCGG + Intergenic
1127942481 15:63713510-63713532 CACAGACCTTCCTGAGGGTCAGG - Exonic
1128708706 15:69856326-69856348 CACAGAGCTTGCTGCTGCTCAGG - Intergenic
1129299612 15:74618077-74618099 GACAGACCCTGCTGGTGAGATGG + Intronic
1129684638 15:77678008-77678030 CACAGAGCTTTCTGAGGAGGTGG - Intronic
1129907831 15:79201982-79202004 CACAGAGAGTGCTGGTGAGCAGG + Intergenic
1130505430 15:84536500-84536522 CACAGACTTTGGAGATTAGCAGG - Intergenic
1131471908 15:92704824-92704846 CACAGACCTGGCTGAGGTGGTGG - Intronic
1131649085 15:94379234-94379256 CACCAACCTTGCTGAAGAGTTGG + Intronic
1133756281 16:8764758-8764780 CGCAGGCCATGGTGATGAGCTGG - Exonic
1135222888 16:20628361-20628383 CAGAGATCTTCCTGATGAGGTGG - Intronic
1136146396 16:28319089-28319111 CAAAGACCTTGATGATGAAGGGG - Exonic
1136579176 16:31141714-31141736 CACAGAGCATGGTGGTGAGCAGG - Exonic
1140206365 16:72936952-72936974 CACAGAACTTGCTGATGGTTTGG + Intronic
1140768076 16:78178384-78178406 CACAGACCTTGTTGTCAAGCAGG + Intronic
1141702697 16:85649849-85649871 GACAGGCCCTGATGATGAGCAGG - Intronic
1143013271 17:3878084-3878106 CACAGACCTTGCTGATGAGCAGG - Intronic
1143297605 17:5883169-5883191 CACAGGACTTGCTGATGAGTTGG - Intronic
1145091338 17:19988493-19988515 AACAGACTTTGCTGATGATCAGG - Intergenic
1145974619 17:28976988-28977010 CACAGACCTTCATGATTAGTAGG - Intronic
1146265897 17:31452538-31452560 CACCACCATTGCTGATGAGCAGG - Intronic
1148434350 17:47670737-47670759 TGCAGACGTTGCTGATGATCAGG + Exonic
1149003649 17:51782373-51782395 AAGAGACCTCACTGATGAGCTGG - Intronic
1150478962 17:65495141-65495163 CACAGACCTGGCAGGTGCGCTGG - Intergenic
1151880113 17:76889597-76889619 AACAGACTTTGCTGCAGAGCTGG + Intronic
1152732504 17:81979251-81979273 CTCAGACCCTGCTGCTGAGCTGG - Intronic
1154034473 18:10786127-10786149 CACGGGCTTTGCTGAGGAGCTGG - Intronic
1155656667 18:28201021-28201043 CACAGAGATGGCTGGTGAGCAGG + Intergenic
1156625584 18:38903673-38903695 CACTGAACTAGCTGAGGAGCAGG - Intergenic
1156997692 18:43486963-43486985 CACAGAGCTGGCTGCTGAGAAGG + Intergenic
1157620835 18:49016746-49016768 CTCAGAACGTGCTGATGGGCTGG + Intergenic
1158598877 18:58840034-58840056 CACAGGCTTTGCTGATGAGATGG - Intergenic
1159031305 18:63235205-63235227 CTCAGACCCTGCTGCTGAGAAGG + Intronic
1159950592 18:74479860-74479882 CCTAGACATTGCTCATGAGCGGG + Intergenic
1163833413 19:19558796-19558818 CACAGTACTTGCTGATGAAGAGG - Intergenic
1163833868 19:19561879-19561901 CACGGGCCTGGCTGAGGAGCAGG + Exonic
1164605015 19:29591647-29591669 TAAAGTCCTTGCTGATCAGCAGG - Intergenic
1165182569 19:33985300-33985322 CACAGAACATGCAGATGAGCAGG + Intergenic
1165212573 19:34247560-34247582 CACAGACCTTTCTGCAGAGCTGG + Intergenic
1166991741 19:46697000-46697022 GGCAGCACTTGCTGATGAGCTGG + Intronic
1168316270 19:55486032-55486054 CACAGAGCTGGCTGTTGTGCTGG - Intronic
926680378 2:15658705-15658727 CACAGAGCTTGGTGATGAGTTGG - Intergenic
926821362 2:16854992-16855014 CCCAGATCTTGCTGATGAGAAGG + Intergenic
927856319 2:26530034-26530056 CAGCGCCCTGGCTGATGAGCTGG - Intronic
929694976 2:44106648-44106670 TAAAGACCTTGCTGATAGGCCGG - Intergenic
930501559 2:52226311-52226333 CACAAAGGGTGCTGATGAGCAGG + Intergenic
935240880 2:101177197-101177219 CAGAGACCTTGCTGATAAAACGG - Intronic
937854077 2:126660218-126660240 CACAGGCCCGGCTGAGGAGCTGG - Intronic
941993410 2:171578478-171578500 CAAAGACCCTGCTGATAAACAGG - Intergenic
943466432 2:188235007-188235029 TAAAGACCTTGCTGATAAGCAGG + Intergenic
943699738 2:190976785-190976807 CACAGTCTTTCCTGATGAGGGGG - Intronic
944241155 2:197486329-197486351 CAAAGGCCATGCTGAGGAGCTGG + Intergenic
944448792 2:199819740-199819762 CACAGGCCTTGCTGAGGATCTGG - Exonic
947533275 2:230925982-230926004 CCCAGACTTTCCTGATGGGCTGG - Intronic
948016405 2:234694407-234694429 GACAGATCTTGCTGATGGGTTGG + Intergenic
1168750719 20:279313-279335 CGCAGACCTCGCTCAGGAGCGGG - Exonic
1168858975 20:1031373-1031395 CACAGACTTACCTGATGACCAGG + Intergenic
1169591054 20:7143030-7143052 CACAGACTTTGTGGATGAGAAGG - Intergenic
1170793807 20:19529436-19529458 GCCAGACCTTGCTGATGGGTGGG - Intronic
1171062148 20:21975854-21975876 CACATACCATGCTCATGAACAGG - Intergenic
1171418316 20:24998810-24998832 CACTGACCTAGCTGATGTGTGGG - Intergenic
1172316437 20:33958702-33958724 CACATACATTGCTGATGGGAAGG + Intergenic
1172445567 20:34991344-34991366 TACAGGCCTCGCTGATAAGCTGG + Intronic
1172811675 20:37652464-37652486 CAGAGACCATGCACATGAGCAGG - Intergenic
1172893745 20:38285113-38285135 CACTCACATGGCTGATGAGCTGG + Intronic
1173220123 20:41125629-41125651 AGAAGACCTTGCTGATGAACAGG + Intergenic
1173643502 20:44619426-44619448 CTCAGGCCCTGCTGCTGAGCAGG + Intronic
1175113363 20:56664600-56664622 GACAGAACTTGCTGATGAGTTGG + Intergenic
1176052780 20:63129293-63129315 CCCAGACCCTCCTGAGGAGCAGG - Intergenic
1176411475 21:6451588-6451610 CACAGACCTCGCTGGTCACCGGG - Intergenic
1178829091 21:36040159-36040181 CAGAAACCTGGCTGAAGAGCTGG - Intronic
1179460844 21:41533903-41533925 CACAGTCCCTGCTACTGAGCTGG - Intergenic
1179686968 21:43059910-43059932 CACAGACCTCGCTGGTCACCGGG - Intronic
1180604218 22:17044169-17044191 CAGAGATCTTCCTGATGTGCTGG + Intergenic
1184010329 22:41743166-41743188 CCCAGACCTTGCTGAGCAGGAGG + Exonic
1184241393 22:43212864-43212886 AAGAGGCCTTGCTGCTGAGCTGG + Intronic
1184271184 22:43385185-43385207 CACAGAGTTTGGTGATGAGTTGG + Intergenic
1203275894 22_KI270734v1_random:85657-85679 TACCCACCTTGCTGATGAGTAGG + Intergenic
950093651 3:10315374-10315396 GACGGACCTGTCTGATGAGCAGG + Exonic
950621577 3:14210009-14210031 CACGGAGCCTGCTGGTGAGCAGG + Intergenic
950748434 3:15108985-15109007 GACAGAACTTGCTGATGGGTTGG - Intergenic
959895451 3:111600420-111600442 AACACACAATGCTGATGAGCTGG + Intronic
962963458 3:140332421-140332443 CAAAGCCCTTGCTGAACAGCTGG - Intronic
966469135 3:180268573-180268595 CACAAAACTTGCTGACCAGCAGG + Intergenic
967089338 3:186121955-186121977 CACAGACCTGGCTGAAGAGATGG + Intronic
968003177 3:195221623-195221645 CACAGCCCATACTGCTGAGCTGG + Intronic
972288731 4:37671393-37671415 CAAAGACCTTGCTGATAAAAGGG + Intronic
972773776 4:42222754-42222776 AACAGACCTACCTGATGTGCAGG - Intergenic
973970802 4:56212069-56212091 CAAAGACCCTGCTGATGAAATGG + Intronic
975043521 4:69773664-69773686 TAAAGACCTTGCTGATAAACAGG + Intronic
977495533 4:97770712-97770734 CACAGCACTTGCTGATGAACTGG + Intronic
978102508 4:104859881-104859903 TACAGCCCTTTCTGCTGAGCGGG - Intergenic
979753545 4:124310077-124310099 TACTGACCTTGCTGATGAACTGG - Intergenic
983296223 4:165872639-165872661 CTGAGACCTTGCCGATGGGCTGG - Intergenic
986000674 5:3628354-3628376 CACAGGACTTGCTGATGGACAGG - Intergenic
986044439 5:4023590-4023612 CTCAGATCTTGCAGAGGAGCAGG + Intergenic
987077156 5:14394568-14394590 CACAGATCTGGCTGATGCCCAGG + Intronic
988735875 5:34020790-34020812 CACAGACTTTGGTGAAGAGCTGG - Intronic
995653287 5:114396181-114396203 GTCAGAACTTGCTGATGGGCTGG - Intronic
997291192 5:132737097-132737119 CGCAGCCCTTCCTGCTGAGCGGG - Intronic
997578848 5:135004794-135004816 CACAGACCCTGCTTTTGGGCAGG - Intronic
997797185 5:136822035-136822057 CACAGACCTTGGTGTGAAGCAGG - Intergenic
999208982 5:149871289-149871311 CAGAGATCTTGCAGATGTGCTGG + Intronic
999230841 5:150060949-150060971 CACGGCCCATGCTGATGAGAAGG - Exonic
999756875 5:154671034-154671056 GACAGCCTTGGCTGATGAGCAGG + Intergenic
1003097570 6:3154732-3154754 CCCGGATCTTGCTGATGAGCAGG + Exonic
1003101156 6:3177451-3177473 CCCGGATCTTGCTGATGAGCAGG + Intergenic
1003107110 6:3225620-3225642 CCCGGATCTTGCTGATGAGCAGG + Exonic
1008884849 6:56421596-56421618 CACAGCCCATGCTCATGAGTGGG - Intergenic
1011222816 6:85074612-85074634 CACACACCTGGCTGCTGGGCTGG + Intergenic
1014028899 6:116679308-116679330 CAAAGACCCTGCTGATAAACAGG + Intergenic
1014097233 6:117473646-117473668 CAAAGACCTTGCTGATAAAATGG - Intronic
1014426595 6:121314272-121314294 CACAGACCCTTGTGATGAGATGG + Intronic
1015399143 6:132768690-132768712 AACAGAACTTGCTGATGTGGAGG - Intergenic
1018662847 6:166104571-166104593 GATAGACCTGGATGATGAGCTGG - Intergenic
1019639189 7:2094125-2094147 CACAGCCCTTGCTGAGCTGCTGG + Intronic
1020942278 7:14555704-14555726 TAAAGACCTTGCTGATAAACAGG + Intronic
1022856771 7:34322499-34322521 TACAGACTTTACTGATGAGTTGG - Intergenic
1024322626 7:48086082-48086104 CAAAGACCTTGTTGAGGAGCAGG + Intergenic
1026562734 7:71463895-71463917 CAAAGACCTTGCTGATAAAACGG - Intronic
1026870748 7:73849791-73849813 CACAGGATTTGCTGATGAACAGG - Intergenic
1030187609 7:106778935-106778957 CACATACCTTGCTCATGAGAGGG - Intergenic
1033837202 7:145329806-145329828 TAAAGACCTTGCTGATAAACAGG - Intergenic
1037304344 8:17489614-17489636 CAAAGACCTTGCTGATAAACAGG - Intergenic
1038021632 8:23556038-23556060 CAGAGACTTTTCAGATGAGCAGG + Intronic
1038274506 8:26109329-26109351 CACAGACCTTGAGGGTGAGTGGG - Intergenic
1040393694 8:46974267-46974289 GACAGACCTAGCTAATGTGCTGG - Intergenic
1040562464 8:48536136-48536158 CCCAGGCCTGGCTGATGAGGTGG - Intergenic
1041192473 8:55367759-55367781 CACAGGACTTGCTGATGGACTGG - Intronic
1041201354 8:55453846-55453868 CACGGACCTGTTTGATGAGCTGG - Intronic
1041716277 8:60935239-60935261 CAAAGACCTTGCTGATAAAACGG + Intergenic
1042275959 8:67005662-67005684 CATATAACTTGTTGATGAGCAGG - Intronic
1042379986 8:68102855-68102877 GTCAGACCTTACTGATGACCTGG + Intronic
1042748143 8:72129986-72130008 CTCAGACCATCCTGGTGAGCTGG + Intergenic
1044817428 8:96127349-96127371 TACAGACCTTGCAAATGAGAAGG + Intergenic
1045281007 8:100749758-100749780 AACAGAGCTTGCTGATAAGTTGG + Intergenic
1047704963 8:127488835-127488857 CACAGCCCTGGCTGATAAGATGG + Intergenic
1048217342 8:132508420-132508442 CACTGACCCTGCTTATTAGCCGG + Intergenic
1048336831 8:133508619-133508641 CAGAGACCTTTCTCAAGAGCTGG + Intronic
1049525330 8:143122593-143122615 CACGCACCTTGCTGATGACCGGG + Intergenic
1053509157 9:38672598-38672620 CACAGATCCGGCTGAAGAGCTGG - Intergenic
1055511336 9:76998589-76998611 CACACACCTTGGTGAGGAGCTGG - Intergenic
1057114515 9:92507868-92507890 CACACACCTTGCTGAAGGGCAGG - Intronic
1058837752 9:108874483-108874505 CATAAACCTTGCTTATGAGTGGG - Intronic
1059330425 9:113532072-113532094 CACAGACCTTTCAGATGCACTGG - Intronic
1061570426 9:131474772-131474794 CACAGCCCATGGTGTTGAGCGGG + Exonic
1061910056 9:133717620-133717642 GACAGACCTTGCTGATGGGTTGG - Intronic
1062578370 9:137218873-137218895 CACAGACTTTCCTGCTGGGCTGG - Intergenic
1062584445 9:137242665-137242687 CCCGGATCTTGCTGATGAGGAGG - Exonic
1062741230 9:138176376-138176398 CCCGGATCTTGCTGATGAGGAGG - Intergenic
1191768244 X:64725543-64725565 AGCAGACATTGCTGATCAGCAGG + Intergenic
1192486478 X:71531569-71531591 TTTAGGCCTTGCTGATGAGCGGG - Intronic
1193368333 X:80661299-80661321 CTCATACCTTGCAGATGAGAAGG - Intergenic
1197143474 X:123143005-123143027 GTCAGACCTTGCTTAAGAGCAGG - Intergenic
1197483830 X:127022158-127022180 CTCACACATTGCTGGTGAGCTGG + Intergenic
1201300783 Y:12502853-12502875 CGCAGAACTTGCAGATGGGCAGG - Intergenic
1201794460 Y:17879973-17879995 CACAGAACCTGGTGAAGAGCTGG - Exonic
1201807094 Y:18026012-18026034 CACAGAACCTGGTGAAGAGCTGG + Exonic
1202115152 Y:21465062-21465084 CATAGGCCTGGCTGATGATCTGG + Intergenic
1202355837 Y:24047769-24047791 CACAGAACCTGGTGAAGAGCTGG - Exonic
1202364523 Y:24148122-24148144 CACAGACTTTGGAGATTAGCAGG + Intergenic
1202506258 Y:25522000-25522022 CACAGACTTTGGAGATTAGCAGG - Intergenic
1202514941 Y:25622340-25622362 CACAGAACCTGGTGAAGAGCTGG + Exonic