ID: 1143013299

View in Genome Browser
Species Human (GRCh38)
Location 17:3878278-3878300
Sequence GTGGATGAACAGAGGCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 197}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143013299_1143013310 14 Left 1143013299 17:3878278-3878300 CCCTCGTGCCTCTGTTCATCCAC 0: 1
1: 0
2: 2
3: 16
4: 197
Right 1143013310 17:3878315-3878337 GCGCTAACCGTTCTGCCCCAGGG 0: 1
1: 0
2: 0
3: 0
4: 36
1143013299_1143013309 13 Left 1143013299 17:3878278-3878300 CCCTCGTGCCTCTGTTCATCCAC 0: 1
1: 0
2: 2
3: 16
4: 197
Right 1143013309 17:3878314-3878336 GGCGCTAACCGTTCTGCCCCAGG 0: 1
1: 0
2: 0
3: 1
4: 50
1143013299_1143013302 -8 Left 1143013299 17:3878278-3878300 CCCTCGTGCCTCTGTTCATCCAC 0: 1
1: 0
2: 2
3: 16
4: 197
Right 1143013302 17:3878293-3878315 TCATCCACCTGTCCAGCCCCTGG 0: 1
1: 0
2: 5
3: 35
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143013299 Original CRISPR GTGGATGAACAGAGGCACGA GGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900974438 1:6008300-6008322 GAGGATGAACAGAGGAACGAGGG - Intronic
900993545 1:6108637-6108659 GTGGAAGGACAGAGGCATGGAGG + Intronic
901532743 1:9863760-9863782 GTGAAAGAACAGAGGCTGGAAGG + Intronic
901871995 1:12143554-12143576 GTGGATGTCGAGAGGCACCACGG + Exonic
902232910 1:15039401-15039423 GTGCATGTTCAGAGGAACGAAGG + Intronic
902245177 1:15116064-15116086 GTCAATGAACTGAGGCCCGAAGG - Exonic
903238050 1:21963580-21963602 GTGGAAGCACAAAGGCAGGAAGG + Intergenic
903776168 1:25795209-25795231 GGGGATGGACAGAGGAAGGAGGG - Intergenic
906234138 1:44193586-44193608 GTTGATGAACAGAAGCAGAAGGG + Intergenic
906713819 1:47952321-47952343 CTAGATGAGCAGAGGCAGGAGGG - Intronic
909375777 1:74940060-74940082 TTTGAAGAACAGAGGCAAGAAGG + Intergenic
911222044 1:95258615-95258637 GTGGAAGAACAGAGGTGAGAAGG - Intergenic
915477081 1:156159479-156159501 GTGGAGAGACAGAGGCACGAGGG + Intronic
916072886 1:161181712-161181734 ATGGAGGAACAGAGGCTCAAAGG - Intergenic
916525062 1:165601931-165601953 GTGGGAGAAGAAAGGCACGAGGG - Intergenic
917230188 1:172828130-172828152 TTGGATGAGCAAAGGCACGGAGG + Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
919974425 1:202601533-202601555 GTGGGTGAACTGAGGCACAGAGG + Intronic
923555684 1:234998786-234998808 GAGGAAGAACAGAGGCCCAAAGG - Intergenic
1062815276 10:494996-495018 GTGGATGAACAGAGAAATCATGG + Intronic
1065973589 10:30823889-30823911 GTGGGAGAACAGAGGAAAGATGG - Intronic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066523521 10:36249648-36249670 GTGGATGAAGAGAGGAACAGTGG - Intergenic
1069652683 10:70061275-70061297 GTGGATGAATAGATTCAGGAAGG + Intronic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1071805095 10:89110355-89110377 GTGCATGCACAAAGGCACGCAGG - Intergenic
1072152763 10:92696445-92696467 GAGGGGGAACAGAGGAACGAGGG + Intergenic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074533095 10:114310435-114310457 CTGGATGACCTGAGGCAAGAGGG + Exonic
1074712550 10:116189274-116189296 TTGGATGAACAAAGGCACTGTGG - Intronic
1075678333 10:124313409-124313431 GAGGAGGAAAAGAGGCAGGAAGG + Intergenic
1076228037 10:128796647-128796669 GTGGCTGCCCAGAGGCACGATGG - Intergenic
1076316741 10:129547318-129547340 GTGTATGGACAGAGGGACTAGGG - Intronic
1076454441 10:130580006-130580028 GCTGATTAACAGAGGTACGATGG - Intergenic
1076490336 10:130857091-130857113 GTGGAAGAACAGAAACATGAAGG - Intergenic
1077298161 11:1835603-1835625 GTGGGTGAACAGAGGTGAGAAGG + Intronic
1077474995 11:2782165-2782187 GAGGATGAACAGCAGCACGGCGG - Intronic
1078860336 11:15240753-15240775 GTGGTAGAACAGAGGGAAGAGGG - Intronic
1083484935 11:62977279-62977301 GTAGATGAAGAGAGGCATGGAGG + Exonic
1084440059 11:69167677-69167699 GGGGATGAAGAGACGTACGATGG + Intergenic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1089166403 11:116480622-116480644 ATGGATGAACAGTGGGAAGATGG + Intergenic
1089471130 11:118720998-118721020 GTGGAGGAGCAGAGGCTTGAAGG + Intergenic
1089618020 11:119706109-119706131 GTGGAAGAAGAGAGGAGCGAGGG - Intronic
1093816374 12:23553524-23553546 GTGGAAGAAGGGAGGCAGGAGGG + Intronic
1096278405 12:50230492-50230514 GGGGAAAAACAGAGGCAAGAGGG + Intronic
1100284780 12:93154882-93154904 GTGGAGGGACTGAGTCACGAAGG - Intergenic
1101414461 12:104497304-104497326 TTGGATGCACGGAGGCACCACGG + Intronic
1102231630 12:111266526-111266548 GTGTAAAAACAGAGGCACGGTGG + Intronic
1102763186 12:115407474-115407496 GTGGAGGAGAAGAGGCATGAGGG + Intergenic
1106529677 13:30578015-30578037 GTGGATGAGGAGTGACACGAAGG - Intronic
1111099253 13:83559991-83560013 ATTGATCAACAGAGGCACCAGGG + Intergenic
1112790897 13:103001343-103001365 GTGCATGACCAGTGGCCCGAGGG + Intergenic
1114688581 14:24558880-24558902 GTGGATGAATACAGGCAAGAAGG - Intergenic
1119441619 14:74632151-74632173 GTGGATAAACTGAGGCCCCAAGG - Intergenic
1121012941 14:90532756-90532778 GTGGCTGAACACAGGCAGGAAGG + Exonic
1121267458 14:92613690-92613712 GTGGAAGGACAGAGGCACTGAGG + Intronic
1121504760 14:94468366-94468388 GTGGATGAAGGGAGGGAGGAAGG + Intronic
1121726829 14:96158465-96158487 GAGGATGAACAGAGGTAGAAGGG + Intergenic
1124063660 15:26319625-26319647 GGGGATGCAGAGAGGCAAGAGGG + Intergenic
1124897611 15:33791557-33791579 GTGGAAGAATAGATGCACCAGGG + Intronic
1125823417 15:42654174-42654196 GAGGAAGAACAGAGGAACAAAGG + Intronic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130067709 15:80618493-80618515 CTGCATGGTCAGAGGCACGAAGG - Intergenic
1131118433 15:89808500-89808522 GTGGATGCGCACATGCACGAAGG + Intronic
1131856718 15:96605178-96605200 ATGGAAGAGCAGAGGAACGAAGG + Intergenic
1132789133 16:1675371-1675393 GGGGATGAAATGAGGCAGGAAGG - Exonic
1137238720 16:46636793-46636815 GTGAAAGAACAGAGACATGAAGG - Intergenic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138194090 16:55039967-55039989 ATGGCTGGACAGAGGCAAGAGGG - Intergenic
1139410302 16:66753260-66753282 GTGGATGACCTGAAGCAGGAAGG + Intergenic
1140057309 16:71536730-71536752 GTGGAAGAATAGAGCCAAGATGG - Exonic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1145262466 17:21362816-21362838 GTGGATGAACAGAGGATGAATGG + Intergenic
1145398909 17:22515741-22515763 GGGGATGACCAGAGGCAGGGAGG + Intergenic
1146826734 17:36029614-36029636 GTGGATGAACAGATGGACAGAGG - Intergenic
1147358748 17:39918122-39918144 GTTGATGAACAGAGGAACCAGGG + Intronic
1147403108 17:40192670-40192692 TTTGAGGATCAGAGGCACGAAGG - Exonic
1148816088 17:50329205-50329227 GTAGAGGAACAGAGGGACAAGGG + Intergenic
1148866238 17:50630206-50630228 GTGGAGGAAATGGGGCACGATGG + Intergenic
1150803040 17:68296658-68296680 GTGGATGGACGGATGAACGATGG - Intronic
1152741930 17:82022265-82022287 GTGGAGAAACTGAGGCACGGGGG - Intronic
1158429288 18:57369716-57369738 ATGGATGAACAGGTGCACCATGG + Intronic
1161167360 19:2795446-2795468 GAGGATGAACAGCAGCAGGAGGG - Intronic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1162395694 19:10417116-10417138 GGGGGTAAACTGAGGCACGAGGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1167277613 19:48548336-48548358 GTGGATGAATAGAGGATGGATGG + Intergenic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167909353 19:52689566-52689588 CTGGATGTACAGAGACATGAAGG - Intronic
1168482986 19:56737076-56737098 TTGGATGCTCAGAGGCAGGATGG + Intergenic
925028270 2:626688-626710 GTGGAGGGGCAGAGGCACAAGGG - Intergenic
925877955 2:8328344-8328366 GTGGATGAGCAGGGGCATGCAGG - Intergenic
926444102 2:12923005-12923027 TAGTATGAACAGAGGCATGATGG + Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
928312319 2:30221144-30221166 CTGGAAGAACAGAGTCAAGAGGG - Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
931428865 2:62194753-62194775 GCGGATGCACAGAGCCACGTGGG - Intergenic
932476273 2:72008298-72008320 CTGGATGAACACAGGCGAGAGGG + Intergenic
934699054 2:96423908-96423930 GGGGGTGGACAGAGGCAGGAGGG - Intergenic
935322721 2:101904756-101904778 TTGGATGCAAAGAGGCAGGAGGG - Intergenic
936068160 2:109347779-109347801 GTGGATGAACAGTGGTACCACGG + Exonic
937260032 2:120579455-120579477 CTGGGAGAACCGAGGCACGATGG - Intergenic
939163947 2:138620333-138620355 CTGAATGAAAAGAGGCAAGAGGG + Intergenic
939961004 2:148565829-148565851 GTGGATGAACAAATGCACATTGG - Intergenic
940480645 2:154226122-154226144 ATGAATGAACAGAGACAGGAGGG + Intronic
942794738 2:179804816-179804838 GGGTAAGAACAGAGGCACAAAGG - Intronic
943533626 2:189119252-189119274 GAGGATGAAGAGAGGAAGGAGGG + Intronic
944015153 2:195026952-195026974 GTGGATGGATTGAGGCAGGAAGG + Intergenic
944064545 2:195604919-195604941 GTAAATGAACACAGCCACGATGG - Intronic
945940223 2:215941894-215941916 ATGGAAGAACAGAGGCCCAATGG - Intergenic
948822846 2:240558577-240558599 TGGGATGTACAGAGGCACCATGG + Intronic
1169707592 20:8523168-8523190 GTGGATGAATAAAGGCAGCAGGG - Intronic
1169899067 20:10534689-10534711 GTGCATGAACAGAGGCCAGCAGG + Intronic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1170693643 20:18637880-18637902 GTGGATGAGCAGAGACACAAAGG - Intronic
1171238153 20:23544635-23544657 GTGGGTCAACAGAGGCCAGATGG - Intergenic
1172473111 20:35215594-35215616 ATGAATGAACAAAGGCACCAAGG + Intergenic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1174526627 20:51176934-51176956 GTGGAGGAACAGAGGGAAGTGGG + Intergenic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175823651 20:61924989-61925011 GTGGGTGGTCAGAGACACGAGGG - Intronic
1178375892 21:32067323-32067345 CTGGAAGAACAGAGGCAAGTAGG - Intergenic
1179192639 21:39136585-39136607 GTGGATGAGAAGTGGCAGGAAGG - Intergenic
1179623649 21:42634720-42634742 GTGGATGAATAGATGGACAATGG - Intergenic
1179623662 21:42634834-42634856 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623676 21:42634944-42634966 GTGGATGAATAGATGGACAATGG - Intergenic
1179623690 21:42635050-42635072 GTGGATGAATAGATGGACAATGG - Intergenic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179623720 21:42635278-42635300 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623732 21:42635384-42635406 GTGGATGAATAGATGGACAATGG - Intergenic
1179623744 21:42635490-42635512 GTGGATGAAAAGATGGACAATGG - Intergenic
1179623759 21:42635604-42635626 GTGGATGAATAGATGGACAATGG - Intergenic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1182732881 22:32509521-32509543 GTGTATGAACATAGGAACCAAGG - Intergenic
1183467298 22:37986193-37986215 CTGGATGGACAGAGGGACGAGGG + Intronic
1183583004 22:38736719-38736741 GTGGCTAGACAGAGGCCCGATGG - Intronic
1184258520 22:43301255-43301277 GAGGATGGACAGAGGCAGGATGG - Intronic
953789960 3:45939719-45939741 GAGGCTGACCAGAGGGACGATGG - Intronic
954085865 3:48243421-48243443 GTGGATGGAAGGAGGCACAAGGG - Intronic
954092142 3:48293634-48293656 GTGGGAGAACAGAGGAAAGAAGG - Exonic
954718200 3:52537580-52537602 ATGGATGAACAGAAGGACTAAGG - Intronic
959211115 3:103382219-103382241 GTGGATGGACAGAGGCCATAAGG - Intergenic
959564988 3:107825088-107825110 GGGGATGAACTGTGGCAGGATGG + Intergenic
961649629 3:128410909-128410931 GTGGAGGAACTGAGGCACAGAGG + Intergenic
962392152 3:134981660-134981682 GTGGGTGCACAGATGCACGCAGG - Intronic
969303381 4:6310463-6310485 GAGGAAGAACAGAGGCACTGGGG + Intergenic
970372786 4:15424701-15424723 GTGGTTGAAGAGAGGCATCAAGG - Intronic
974947246 4:68542983-68543005 GTGGATCTACAGAGGCAGGCAGG - Intronic
975787974 4:77913961-77913983 GTGGGTGAAGAGGGGCAGGAAGG + Intronic
977764877 4:100785327-100785349 CTGGGTGAACAGGGGCAGGAGGG + Intronic
983339886 4:166447785-166447807 GTGGAAGAACAGTGAAACGAAGG - Intergenic
986860342 5:11920147-11920169 TTGGATGCACAGAGACACCAGGG - Intergenic
992489127 5:77223969-77223991 ATGGATGAACAAAGGGAAGATGG - Intronic
992538515 5:77738058-77738080 TTGGATGAGCAGAGGCATGAAGG + Intronic
997569388 5:134914541-134914563 ATGGAGGAACAGAGGGACAAGGG + Intronic
998923402 5:147095972-147095994 GTGGCTGCAAAGAGGCAGGAGGG + Intergenic
1001704211 5:173730136-173730158 GTGGCTGAGCAGAGCCACGCAGG + Intergenic
1003573184 6:7269238-7269260 GTGGCTGGACAGAGGCAGCAGGG + Intronic
1004566427 6:16802257-16802279 CTGGATGAAGAAAGGGACGATGG + Intergenic
1006391071 6:33759017-33759039 GTGTAAGTACAGAGGCAGGATGG + Intergenic
1010175444 6:73022865-73022887 GTAGATGAACAGAAGCTCAAAGG + Intronic
1011442869 6:87405979-87406001 GTGGATGCTAAGAGGCATGAAGG + Intergenic
1014217394 6:118766047-118766069 GTGGACTATTAGAGGCACGAGGG + Intergenic
1014541192 6:122678300-122678322 CTGAATGAAAAGAGGCAGGAGGG + Intronic
1015458056 6:133451710-133451732 GTGGATGAACAGTGGAGGGAGGG + Intronic
1017414250 6:154203251-154203273 GTGTTTGAACAGACACACGAAGG - Intronic
1017788601 6:157776042-157776064 GTGGATGAACAGAAGGAAAATGG + Intronic
1018281270 6:162188120-162188142 GTGGAAGGTGAGAGGCACGAAGG - Intronic
1018287796 6:162259252-162259274 GTGGGAGAACAGAGGCAGGTCGG - Intronic
1019113410 6:169737380-169737402 GTGGAGGAAAAGAGGCACTCTGG + Intergenic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019979641 7:4612009-4612031 GTGGCTGAAAAGAGACACAAGGG + Intergenic
1021041086 7:15863140-15863162 GTAAATTAACAGAGGCACAATGG + Intergenic
1021930504 7:25576819-25576841 GAGGAAGAAGAGAGGCAGGAAGG + Intergenic
1023834266 7:44059214-44059236 GTGCAGGAACAGAGGCCCCAGGG - Intronic
1024316932 7:48028912-48028934 GTGGAAAAACAAAGGCAAGAAGG - Exonic
1024442916 7:49442483-49442505 GTGGATGAAAAGTGGAATGAAGG + Intergenic
1024571690 7:50728515-50728537 TTGGATGGACAGAGGCTCAAGGG - Intronic
1026411521 7:70127864-70127886 GTGGATGAACAGTGGCACTGTGG - Intronic
1027185120 7:75966481-75966503 GCTGAGGCACAGAGGCACGATGG - Intronic
1031071736 7:117169538-117169560 GAGGATGAAGAGAGGCCCAAAGG - Intronic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1039259691 8:35757788-35757810 ATGGAAGAAAAGAGGCACTATGG - Intronic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1042533334 8:69835476-69835498 CAGGAAGAACAGAGGCACGGGGG + Intergenic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1048296753 8:133220441-133220463 GAGGAGGAACAGAGGCACAAAGG - Intronic
1049201887 8:141344314-141344336 GTGGAAGCACAGAGGCACAGGGG - Intergenic
1049350714 8:142163098-142163120 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350789 8:142163494-142163516 ATGGATGAACAGAGGATGGATGG + Intergenic
1049350903 8:142164107-142164129 ATGGATGAACAGAGGATGGATGG + Intergenic
1056100997 9:83300798-83300820 GTGAATGTACAGATGTACGAAGG + Intronic
1057810499 9:98253518-98253540 GTTGAAGAGCAGAGGCCCGAGGG - Intronic
1058390070 9:104486296-104486318 CTGGAAGAACTGAGGCATGAAGG + Intergenic
1058397336 9:104569500-104569522 GTGCATGATCTTAGGCACGATGG + Exonic
1059862563 9:118481220-118481242 GTGGAAGAAGAGAGGAAGGAAGG + Intergenic
1060053601 9:120394085-120394107 GAGCATGGACAGAGGCACAAAGG - Intronic
1060069563 9:120534277-120534299 GTGGAAGTCCAGAGGCAAGAAGG - Intronic
1060407777 9:123381392-123381414 GGGGATGCACCGAGGCCCGAGGG - Exonic
1060860878 9:126953984-126954006 GTGGATGCACAGGGGAACAAAGG - Intronic
1060889063 9:127176847-127176869 GTGGATGGACAGAGCCACTAGGG - Intronic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1187532430 X:20109197-20109219 GTGGAGGCACAGTGGCACGGGGG + Intronic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1187777103 X:22772890-22772912 GTGGAGGAACAGAGGGATCATGG + Intergenic
1187944464 X:24412693-24412715 GTGGATGACAGGAGGCAGGAGGG - Intergenic
1191177202 X:57516930-57516952 GTGGATGGACTGAGGCATGTTGG + Intergenic
1192017196 X:67344015-67344037 ATGCATGAACAGAGGCATGGAGG - Intergenic
1195001580 X:100647987-100648009 ATGAATGAACAAAGGCATGAAGG - Intronic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic