ID: 1143014019

View in Genome Browser
Species Human (GRCh38)
Location 17:3882287-3882309
Sequence CTTGCTGCTCAGAGGGAAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 296}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143014015_1143014019 -6 Left 1143014015 17:3882270-3882292 CCACGTGGATCCACTGTCTTGCT 0: 1
1: 0
2: 0
3: 7
4: 115
Right 1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG 0: 1
1: 0
2: 3
3: 24
4: 296
1143014013_1143014019 8 Left 1143014013 17:3882256-3882278 CCTGAGCGCGCAGCCCACGTGGA 0: 1
1: 0
2: 1
3: 8
4: 67
Right 1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG 0: 1
1: 0
2: 3
3: 24
4: 296
1143014011_1143014019 18 Left 1143014011 17:3882246-3882268 CCTGCATCTACCTGAGCGCGCAG 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG 0: 1
1: 0
2: 3
3: 24
4: 296
1143014014_1143014019 -5 Left 1143014014 17:3882269-3882291 CCCACGTGGATCCACTGTCTTGC 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG 0: 1
1: 0
2: 3
3: 24
4: 296
1143014010_1143014019 25 Left 1143014010 17:3882239-3882261 CCTGCTTCCTGCATCTACCTGAG 0: 1
1: 0
2: 2
3: 18
4: 249
Right 1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG 0: 1
1: 0
2: 3
3: 24
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143014019 Original CRISPR CTTGCTGCTCAGAGGGAAGC AGG Exonic
900605307 1:3521168-3521190 CGGGCTGCTCAGCGGGAACCTGG - Intronic
901120569 1:6889465-6889487 ATCGCTGCTCAGAGGGATGTGGG + Intronic
901407308 1:9057889-9057911 CTTGCTGTTTAGAGGGAATCCGG - Intronic
901692379 1:10981890-10981912 CTTGCATCTAAGAGGGAAGGGGG - Intronic
902343438 1:15799333-15799355 GTTGCTGGTCAGAGGGGTGCTGG - Intergenic
903996310 1:27307314-27307336 CCTGCTGCTCTGAGGGGAGAGGG + Exonic
904306338 1:29592637-29592659 CTTGATGCTCAGATGCCAGCAGG - Intergenic
904378600 1:30096621-30096643 CATCATGGTCAGAGGGAAGCAGG + Intergenic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904761389 1:32807024-32807046 CCTCCTGCTCAGAGGGAGTCTGG + Intronic
906451623 1:45954219-45954241 GTTGCTTCACAGTGGGAAGCAGG + Intronic
908600021 1:65728452-65728474 CTTGCAGATCAGAGAGAAGAGGG - Intergenic
912801001 1:112719678-112719700 GTTGCAGCTCAGAGGGAAATAGG + Intergenic
913114145 1:115681337-115681359 CTTGGTCCTCAGAGAGCAGCAGG - Intronic
914706036 1:150170624-150170646 CTTGCTGCTCAGCTGCAAGGAGG + Intergenic
917109591 1:171532384-171532406 CTTGCTGCTTGGAGGGAAAGGGG - Exonic
918146392 1:181759647-181759669 CTTGCTGCACACAATGAAGCAGG - Intronic
918387851 1:184028480-184028502 ATTGCTGCCAAGAGGGAAGTAGG - Intronic
919350136 1:196440996-196441018 CATCCTGCTCAGAAAGAAGCTGG + Intronic
919417810 1:197333103-197333125 TTTGCTGCTCAGAGGAACACAGG - Intronic
919751266 1:201039715-201039737 CTAGCTGCTGAGAGGGAGGGAGG + Exonic
920997922 1:211013081-211013103 CTTGCTGTCCAGCTGGAAGCAGG - Intronic
921212199 1:212910450-212910472 CTTGCTGCTAAGGGTGAAGAAGG - Intergenic
921434108 1:215097024-215097046 CTTGCTGTTCATGTGGAAGCAGG - Intronic
1064096368 10:12427335-12427357 GTGGCTGCCCAGAGGGAAGTGGG + Intronic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1067787417 10:49260684-49260706 CTTGCTGCTCAGAGGCTGGTGGG + Intergenic
1069622347 10:69845669-69845691 GTTACTGCTAAGAGGGATGCAGG - Intronic
1069793989 10:71040857-71040879 CCTGCTGCTGGGAGGGGAGCTGG - Intergenic
1070790986 10:79189231-79189253 GTTGCAGCTGAGAGGGAGGCAGG - Intronic
1072542429 10:96408362-96408384 CTTGCAGCTCTGGGGAAAGCTGG + Intronic
1072967642 10:99988004-99988026 ATTCCTGCTCAGAGGCAGGCGGG + Intronic
1073232798 10:101986708-101986730 CCTGCTGCCCAGCTGGAAGCAGG + Intronic
1073626359 10:105101819-105101841 CTGGCTGGTAAGAAGGAAGCAGG + Intronic
1073846417 10:107560859-107560881 CTAGCTCCTCAGAGGGAGGAAGG + Intergenic
1074974575 10:118569694-118569716 CTTGCTGGTAAGAAGGAGGCTGG + Intergenic
1075352067 10:121733092-121733114 CTTGCTGCTCATTTGGCAGCAGG + Intergenic
1075438044 10:122459776-122459798 CTGGCTGCTCAGGGGGATGGAGG + Intergenic
1075806306 10:125191332-125191354 CTTGCTGTGCAGATGGAAGGAGG + Intergenic
1076600559 10:131654538-131654560 CCAGCCTCTCAGAGGGAAGCAGG - Intergenic
1076692433 10:132230656-132230678 CTTGCTGCTGGGGGGGAAGCTGG + Intronic
1077810570 11:5632441-5632463 CTTGTTGCTCACAGTGATGCAGG - Exonic
1079008609 11:16810375-16810397 CCTGCCCCTCTGAGGGAAGCCGG + Intronic
1079074429 11:17375011-17375033 GTAACTGCTCAGAGGCAAGCTGG - Exonic
1081446141 11:43133283-43133305 CCTACTGCTCACAGGCAAGCAGG + Intergenic
1082004813 11:47413664-47413686 CTTCTTGCTCACAAGGAAGCTGG - Exonic
1082082812 11:48025413-48025435 CCTACTGCTCAGAGGCCAGCAGG - Intronic
1084404053 11:68960836-68960858 CTGACTGCCCACAGGGAAGCAGG + Intergenic
1084753732 11:71221741-71221763 CTTGCTGCTCAGAAAAAAACTGG - Intronic
1085524622 11:77157121-77157143 TTTCCAGCACAGAGGGAAGCAGG - Intronic
1086087023 11:82966037-82966059 TGTGCTGCACAGAGGCAAGCAGG - Intronic
1087832866 11:102838440-102838462 CTTCCTACTAAGAGAGAAGCAGG + Intronic
1089138729 11:116269857-116269879 CCTGCTGCTGGGAGAGAAGCAGG + Intergenic
1089338994 11:117744949-117744971 CGTGCTGCCCAGAGGGTAGGTGG + Intronic
1089750600 11:120648563-120648585 CTGGCTGCCCAGAGAGAAGCTGG - Intronic
1090228672 11:125086528-125086550 GTCGCAGCTCAGAGGGAAACTGG - Intronic
1090489691 11:127147853-127147875 CTTGCTCCACAGAGAGAAGTAGG - Intergenic
1090837851 11:130466346-130466368 CTTGCTTCTCTAAGGGAATCTGG + Intronic
1091647984 12:2288252-2288274 CTCACTCCTCAGAGAGAAGCTGG - Intronic
1092528119 12:9322812-9322834 CTTGCTTCTCCCATGGAAGCAGG + Intergenic
1092539150 12:9408949-9408971 CTTGCTTCTCCCATGGAAGCAGG - Intergenic
1092565689 12:9662843-9662865 TTTGCTTTTCAGAGAGAAGCTGG + Intergenic
1093862747 12:24187313-24187335 CTTGCAGCTCAGAAAGCAGCAGG - Intergenic
1093930641 12:24951999-24952021 CTTTCAGCAGAGAGGGAAGCGGG + Intergenic
1095498588 12:42811863-42811885 CTTGCTGCTCAGGGGTAAGCAGG + Intergenic
1096526173 12:52211680-52211702 CTTTCTGTTCCAAGGGAAGCTGG + Intergenic
1097001701 12:55882490-55882512 CTGGCTGATCTGAGAGAAGCTGG - Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1100924655 12:99531016-99531038 CCTGCTACTCAGAGGGAATAAGG - Intronic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1102925420 12:116822271-116822293 CTTGGTTCCCAGAGGGAAGCAGG + Intronic
1105760594 13:23510614-23510636 TTTGCTGCTCAGAAGGAAATTGG - Intergenic
1108573751 13:51773622-51773644 TGTGCTGCTCAGAGGGAATGAGG - Intronic
1108712623 13:53048779-53048801 CCTGCTGCTCAGAGCAGAGCAGG - Intronic
1111319281 13:86603973-86603995 CTTACAGATCAGAGGGAAGAGGG - Intergenic
1112020035 13:95363600-95363622 ATTGATGTTCAGAAGGAAGCTGG + Intergenic
1114950376 14:27743275-27743297 CTGGCTACACTGAGGGAAGCAGG + Intergenic
1116196029 14:41726245-41726267 CTTGTTGTTCAGAGGGATCCAGG + Intronic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1119438453 14:74612589-74612611 CTTGCAGGTCTGAAGGAAGCCGG + Intergenic
1119657949 14:76430938-76430960 GCTGCTGGTCAGAGGGCAGCAGG - Intronic
1121179915 14:91921278-91921300 CTTGCACCTGAGAGGGAAGAAGG - Intronic
1121343867 14:93120907-93120929 CCCGCTGCTCAGGTGGAAGCAGG + Intergenic
1121638549 14:95470130-95470152 CTCGCTGCTGAGAGGGACTCGGG - Intronic
1122245953 14:100403735-100403757 TTTGTTGCTTAGAGTGAAGCTGG + Intronic
1122600246 14:102917766-102917788 CTTGCTTCTCAGTGGGAAGGAGG - Intergenic
1122767740 14:104083402-104083424 CATGGTGCTCACAGGGATGCAGG + Intergenic
1122779959 14:104139349-104139371 CTTGGGGCTTGGAGGGAAGCAGG + Intronic
1122800279 14:104225870-104225892 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1122800303 14:104225975-104225997 CGGGCTGCTCAGAGTGAAGGTGG + Intergenic
1123037778 14:105478431-105478453 CATGCTGCGCAGAGGGGCGCGGG - Exonic
1124665571 15:31588860-31588882 ATTGCTACTCAGAGGGGAGGAGG + Intronic
1125470513 15:39997905-39997927 CTTACTGAGCAGAGTGAAGCAGG + Intronic
1125486642 15:40115841-40115863 CTTCCTGTTCAGGGGGCAGCCGG - Intergenic
1126773283 15:52078372-52078394 TTTTCTGGTCTGAGGGAAGCTGG - Intergenic
1127367538 15:58305738-58305760 CTTGTTACTGAGAAGGAAGCTGG + Intronic
1127899704 15:63331803-63331825 CTTGCTGGACTGAGGGATGCTGG + Intronic
1128412560 15:67414133-67414155 CTTGCTGCTCAGGAAGCAGCTGG - Intronic
1128801157 15:70497987-70498009 CTTGCTGCCCACAGGGAACTAGG + Intergenic
1128819194 15:70636881-70636903 CTAGCTGGCCAGGGGGAAGCAGG - Intergenic
1129669396 15:77598727-77598749 GCTGCTGGTAAGAGGGAAGCCGG + Intergenic
1130617842 15:85429376-85429398 CTTGCTGCACAGAGGTAGTCAGG - Intronic
1131174944 15:90203555-90203577 CTAGCTGCTCCTCGGGAAGCAGG - Intronic
1132594756 16:743652-743674 CTTGCTGCTCCGGGTGGAGCTGG + Intronic
1133130425 16:3673299-3673321 CTGTGTGCTCAGAGGGCAGCAGG + Intronic
1133805701 16:9124637-9124659 CTTGCAACTACGAGGGAAGCTGG + Intergenic
1135133629 16:19872171-19872193 CTTGCCGCACAGAGTGAAGAGGG + Exonic
1137564503 16:49524782-49524804 CCTGCTGCCCAGATGGCAGCCGG - Intronic
1137718840 16:50615468-50615490 CATGCTGCTCAGAGGAAGGGAGG + Intronic
1138605556 16:58086187-58086209 CAGGCTGCTCAGAGGGACTCAGG - Intergenic
1139277092 16:65738021-65738043 GTTTCTGCTCACAGGGAGGCAGG - Intergenic
1139380831 16:66529652-66529674 CTTGCTTCCCAGAGGAACGCTGG - Intronic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1139962260 16:70724784-70724806 GCTTCTGCTGAGAGGGAAGCAGG + Intronic
1142267316 16:89070639-89070661 CTTGCTGCACCGAGGGACCCTGG - Intergenic
1142613297 17:1121018-1121040 CTTTCTTCTCAGAGTGAAACTGG + Intronic
1143014019 17:3882287-3882309 CTTGCTGCTCAGAGGGAAGCAGG + Exonic
1143184342 17:5001233-5001255 CTTGCTGCTGAGATGCAAACTGG - Exonic
1144119219 17:12133957-12133979 CTTGCTGCTAAGAGAAAGGCAGG - Intronic
1147240050 17:39084898-39084920 CTTGCCGCTCAGAGGTCATCTGG - Intronic
1147458797 17:40555351-40555373 CTTGCTGATGAGAAGGACGCGGG + Exonic
1150428395 17:65095510-65095532 CTTGCTACTCAGATTGAAGTTGG + Intergenic
1150674051 17:67229072-67229094 CTTGCTGCTCAGTGGGGAAAGGG - Intronic
1151690791 17:75683961-75683983 CTAGCAGGTCAGAGTGAAGCAGG - Intronic
1152117156 17:78395451-78395473 GTTCCTTCTCATAGGGAAGCAGG + Intronic
1152623901 17:81379706-81379728 CCTGCTGGTAAGAGGGAGGCAGG - Intergenic
1152795564 17:82304509-82304531 CTTGGTGCTCAGAGGCCAGAGGG - Intergenic
1152906598 17:82973953-82973975 CTTGCTGGTCAGTGGCAGGCGGG - Intronic
1155857472 18:30850895-30850917 TTTACTTCTCAGAGAGAAGCTGG + Intergenic
1156485378 18:37462312-37462334 CTTGCTGCCTAAAGGGAAGCTGG - Intronic
1156850791 18:41723738-41723760 CTTGCTCCTGAGAGACAAGCTGG - Intergenic
1158031290 18:52968153-52968175 CTGACTCCTCAGAGGGTAGCTGG - Intronic
1159349957 18:67259601-67259623 CTTACTGCACAGAAGGCAGCAGG + Intergenic
1159549843 18:69883490-69883512 CTTGGTGCTCAGAGGACACCAGG + Intronic
1160371819 18:78378489-78378511 TGTGCTGCTCAGAAGGTAGCCGG + Intergenic
1160400983 18:78611311-78611333 CTTGCTGTTGTGAGTGAAGCTGG - Intergenic
1160404371 18:78635093-78635115 CTTGCTTCTCGGAGGGACGTCGG - Intergenic
1160787341 19:907166-907188 ATTGCTGCAAAGAGGGCAGCTGG + Intronic
1162810745 19:13163201-13163223 CTTGCGGCCCAGCGGGAAGGCGG + Intergenic
1163119609 19:15209329-15209351 CTGGCTTCTCAGAGGGCAGGAGG + Intergenic
1163233667 19:16019395-16019417 CTTGGTGCTGAGAGGGAGCCTGG + Intergenic
1163702536 19:18793366-18793388 CTTGGGGCTCAGTGAGAAGCAGG + Intergenic
1164686372 19:30169120-30169142 CTTCCTGCTCAGAGGGAGGAGGG + Intergenic
1164929993 19:32168101-32168123 CTTTGGGCTCAGAAGGAAGCAGG - Intergenic
1165143793 19:33718922-33718944 GTTGCTACTGAGAGGGAAGGAGG + Intronic
1165261388 19:34622121-34622143 GTAACTGCTCAGAGGCAAGCTGG + Intronic
1166503379 19:43356643-43356665 TTTGCTTCTAGGAGGGAAGCTGG - Intronic
1166507075 19:43378118-43378140 TTTGCTTCTAGGAGGGAAGCTGG + Intergenic
1166991742 19:46697007-46697029 CTTGCTGATGAGCTGGAAGCAGG + Intronic
1167094828 19:47369609-47369631 ATTGCTGCTCAGGTGGATGCAGG + Intronic
1167172734 19:47843978-47844000 CTGGATGCTGAGAGGGAAGGCGG - Intergenic
1167467715 19:49658860-49658882 CGAGCTGCTCACAGGGAGGCAGG + Intergenic
1168087866 19:54061699-54061721 CTAGCTGCTCAGAAGGCTGCGGG + Intronic
1168580819 19:57554347-57554369 CTGGCTCCTCATAGGGATGCTGG - Intronic
1168595864 19:57676236-57676258 CCTGCTGTTCAGAGAGAAGAAGG + Exonic
925104359 2:1277818-1277840 GTGGCTCCTCAGAGGGCAGCAGG + Intronic
925492053 2:4405830-4405852 ATTGCTGCACAGAATGAAGCTGG + Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
926347116 2:11957563-11957585 CTTGCAGTACAGAGGGAGGCTGG + Intergenic
927851232 2:26500979-26501001 CTGGCTGCTCAGAGGGGACAGGG - Intronic
928113475 2:28528349-28528371 CTTGCTCCTGAGAGGGAAGAGGG - Intronic
929133563 2:38602383-38602405 CTGGCTGCTCCCCGGGAAGCAGG - Intronic
929593650 2:43162419-43162441 CCTGGGGCTCAGAGGGGAGCTGG - Intergenic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
933832857 2:86224655-86224677 GTTGCTGGACAGCGGGAAGCAGG - Intronic
934559692 2:95306760-95306782 CTTGGTGCTGGGAGAGAAGCTGG - Intronic
936153446 2:110033821-110033843 CTTCATGCTCAGAGGGATGTAGG + Intergenic
936191235 2:110337594-110337616 CTTCATGCTCAGAGGGATGTAGG - Intergenic
937128414 2:119489048-119489070 CTGGGTGCCCAGAGGGGAGCAGG + Intronic
937825436 2:126364030-126364052 GTTGCTGCTCACAGGGGACCTGG + Intergenic
937890733 2:126936593-126936615 CTTGCTGCTGTGAGTGAAGTTGG - Intergenic
939252913 2:139706036-139706058 GTTGGTGCACAGAGGGAGGCAGG + Intergenic
939848283 2:147274110-147274132 TCTTCTGCTCTGAGGGAAGCTGG - Intergenic
940849161 2:158672003-158672025 CTTGAGGAACAGAGGGAAGCCGG + Intronic
940882910 2:158964743-158964765 CTTGCTGAAAAGAGGGAAGGTGG + Intergenic
946599477 2:221343830-221343852 TTTCATGCTCTGAGGGAAGCTGG - Intergenic
947991341 2:234489850-234489872 CTTCCTGATCAAAGGGCAGCAGG + Intergenic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
948630333 2:239298389-239298411 CTTGCACCTCAGAGGGAAACAGG + Intronic
948771605 2:240253985-240254007 CTGGCTTCCCAGAGGGAGGCAGG + Intergenic
948828904 2:240587898-240587920 CTTGCTGCTGGGTGGGAAGTGGG + Intronic
948931869 2:241137199-241137221 CTTTAAGCTCAGAGGGAAGGTGG + Exonic
949034155 2:241808911-241808933 CCTGATGCTCAGAGGGTAACTGG - Intronic
1169962303 20:11174832-11174854 CTTCCAGCTCAGAGTCAAGCTGG - Intergenic
1170014708 20:11767625-11767647 ATTCCTGCTCTGAGGGAGGCAGG - Intergenic
1170699951 20:18695110-18695132 CTTGATGCTAACATGGAAGCAGG - Intronic
1171293441 20:23995591-23995613 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1171303005 20:24080100-24080122 CTGGCTGGTCAGAGGGAAAGTGG + Intergenic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1177747488 21:25236695-25236717 TTTGCAGGTCAGAGGGAAGTAGG + Intergenic
1177929068 21:27257511-27257533 CTTGCAGGTCAGCTGGAAGCTGG - Intergenic
1178288646 21:31347321-31347343 CTTGGGCCTCGGAGGGAAGCAGG + Intronic
1179522585 21:41954460-41954482 CGTGCTTCTCAGAGGCAAGGAGG + Intergenic
1180824495 22:18853307-18853329 GCAGCTGCGCAGAGGGAAGCAGG - Intronic
1181124918 22:20696462-20696484 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181188239 22:21121241-21121263 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1181210957 22:21289252-21289274 GCAGCTGCGCAGAGGGAAGCAGG - Intergenic
1181501280 22:23316994-23317016 GCAGCTGCCCAGAGGGAAGCAGG + Exonic
1181650872 22:24258424-24258446 GCAGCTGCCCAGAGGGAAGCAGG - Intergenic
1181706509 22:24652315-24652337 GCAGCTGCCCAGAGGGAAGCAGG + Intergenic
1184155932 22:42667176-42667198 CCAGCTACTCAGGGGGAAGCAGG - Intergenic
1185400133 22:50611303-50611325 CATGGAGCTCAGGGGGAAGCAGG + Exonic
1203215988 22_KI270731v1_random:6178-6200 GCAGCTGCGCAGAGGGAAGCAGG + Intergenic
1203274634 22_KI270734v1_random:79212-79234 GCAGCTGCACAGAGGGAAGCAGG - Intergenic
950433578 3:12965800-12965822 CTTTCAGCTCAGAGGGAGGCGGG + Intronic
950477547 3:13223512-13223534 CCTTCTCATCAGAGGGAAGCTGG + Intergenic
950897843 3:16469612-16469634 CGTGCTCCACAGAGGGAAGGGGG + Intronic
952851963 3:37736970-37736992 GTTACTGCTCAGAGGTAAGGGGG + Exonic
953042522 3:39267798-39267820 ATTCCTGCTCAGAAGGAAACAGG - Intronic
954186125 3:48918503-48918525 CTATCTGGTCAGAGGGGAGCTGG - Exonic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
956075225 3:65497978-65498000 CGGGCTGCTCAGAGGATAGCTGG - Intronic
957572158 3:81960923-81960945 CTAGAAGCTCGGAGGGAAGCAGG - Intergenic
959208651 3:103346450-103346472 CTTGCTCCTCAGCTGGAAGATGG - Intergenic
959817951 3:110698093-110698115 ATTGTTGCTAAGAGGGAGGCGGG - Intergenic
960236748 3:115292122-115292144 CTTTCTCCTCAGAGGGGAACAGG + Intergenic
961385316 3:126520053-126520075 CTTCCCACTCAGAGGGCAGCTGG + Intergenic
964357233 3:155862002-155862024 CTTGATGGTCAGAGGCAAGATGG - Intergenic
967303888 3:188042300-188042322 CTGACTGCTCAGAGACAAGCAGG + Intergenic
968441912 4:628597-628619 CTTGCAGCTCAGGGAGGAGCGGG - Intronic
968507981 4:980769-980791 CTGGCTGATAAGAGGGAAGGAGG - Intronic
968534493 4:1114224-1114246 CTTCCGTTTCAGAGGGAAGCAGG - Intergenic
968647243 4:1747006-1747028 CGTGCTGCCCATAGGGCAGCTGG - Intergenic
968691549 4:1992759-1992781 CTTCCTGCCCTGAGGGAAGTTGG + Intronic
968813443 4:2810211-2810233 CTATCTTCCCAGAGGGAAGCTGG - Intronic
969157685 4:5225881-5225903 TGTGCTGCACAGTGGGAAGCAGG + Intronic
969842394 4:9892065-9892087 CCTGCTCCTTAGAGGGAGGCAGG + Intronic
971613149 4:28752370-28752392 CTTGCTACTAAGAGAGAACCTGG + Intergenic
972591924 4:40496076-40496098 CTTTTTTCTCAGAGGAAAGCAGG - Intronic
974395467 4:61329113-61329135 CTAGCTGCTCAGAAGGAAGAGGG - Intronic
976387208 4:84474828-84474850 CTTTTTCCTAAGAGGGAAGCTGG - Intergenic
977675660 4:99744092-99744114 CTTGCTTCTCTGTTGGAAGCTGG + Intergenic
982274047 4:153621828-153621850 CCTGCTGCCCAGAGAGAGGCAGG + Exonic
982448316 4:155521505-155521527 CTTCCTGTTCAGCGAGAAGCAGG - Intergenic
982765953 4:159348435-159348457 CTTGCTGATCAGATGGAATGAGG - Intronic
983071502 4:163273077-163273099 CTTGCTGCTCAGAGGTCTGAAGG - Intergenic
984700198 4:182814174-182814196 CTAGCTGCCCAGATGGAAGTAGG + Intergenic
985012499 4:185598411-185598433 GTTGCTGTTCATAAGGAAGCTGG + Intronic
985536863 5:469943-469965 CCTGCTGCTAAGTGGGAAGCTGG - Intronic
986555778 5:9008689-9008711 CTTGCTGCTAAGGGTGAAGGAGG + Intergenic
990155317 5:52870615-52870637 CTAGCTGCTGACAGGGAAGTCGG + Intronic
990956890 5:61350284-61350306 CTTGTTTCTCAGAAGGAAGAGGG + Intronic
991559349 5:67933077-67933099 ATCCCTGCTCAGAGTGAAGCTGG + Intergenic
992245759 5:74820712-74820734 CTGGCTGCTCTGTGGGAAACTGG - Intronic
994263692 5:97689379-97689401 CTTGCTCCTCAGAAGAAACCTGG + Intergenic
994989337 5:106979357-106979379 CTTGCTGCTAAGAGTGAAGAAGG - Intergenic
995006632 5:107204533-107204555 CATGCTTCTCACTGGGAAGCTGG + Intergenic
996831269 5:127743160-127743182 CTTGGTGGTTGGAGGGAAGCGGG - Intergenic
997948549 5:138223641-138223663 CTTGCTGCCCTGAAGGAACCAGG + Intergenic
998024598 5:138804475-138804497 CTTGCTGGGCAGTGGGAAGCAGG - Intronic
999023743 5:148201224-148201246 CTTGAAGATCAGAGGAAAGCAGG + Intergenic
999483345 5:151969244-151969266 CTTGCTGCTGAAAGAGATGCTGG + Intergenic
1000095366 5:157966806-157966828 CTGGCTGCTCAGAGGGATTTGGG - Intergenic
1001140108 5:169137362-169137384 TTTGCTTCACAGCGGGAAGCAGG + Intronic
1001868552 5:175129260-175129282 CCTGCTACTCAGAGATAAGCAGG - Intergenic
1001926359 5:175640020-175640042 ATTGCTGCCAGGAGGGAAGCAGG + Intergenic
1002308395 5:178297741-178297763 CTTGCTGCCCAGATTGGAGCTGG + Intronic
1002785889 6:399768-399790 TTTGCTGCTCAGAGGGGAGCTGG + Intronic
1003198767 6:3939609-3939631 CCTGCTGCTCTGAGGGCATCGGG + Intergenic
1003352017 6:5326692-5326714 CCTGCTGCTCTGAGGGCATCAGG - Intronic
1003951332 6:11118548-11118570 CTTGTTTCTCATAGGGAAGGTGG + Intronic
1004186515 6:13426015-13426037 CATGCTGCTCACACAGAAGCAGG + Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006098081 6:31668675-31668697 CTTACTGCTCAGAAGGAGGCAGG - Intronic
1007745780 6:44042289-44042311 CTTGAAGTTCAGAGGGAACCTGG - Intergenic
1010757771 6:79686792-79686814 CCTCCTGCTCAAAGGAAAGCAGG - Intronic
1011261101 6:85470250-85470272 CTTGCTGCACACAGAGAACCTGG + Intronic
1012824885 6:104135086-104135108 CTGGCTGCTCAGGGATAAGCAGG - Intergenic
1012974400 6:105764423-105764445 CTTGCTTCTCTGAGGGAGGAGGG + Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1014395790 6:120925790-120925812 CTTGCTGCTAAGGGTGAAGAAGG - Intergenic
1016853053 6:148640723-148640745 CTTGCTGCTAAGGGTGAAGAAGG - Intergenic
1018902842 6:168059960-168059982 CTTTCTGATGGGAGGGAAGCTGG + Intronic
1019149656 6:169996463-169996485 CTTCCTGCTCACAGGGAACAAGG - Intergenic
1019487894 7:1297594-1297616 CGTGCGGCACTGAGGGAAGCAGG + Intergenic
1029003105 7:97176957-97176979 CTTACTCCTCAGAGGTAATCAGG + Intronic
1030173242 7:106625964-106625986 CTTCCTGCTCAGCGGTCAGCAGG - Intergenic
1030195087 7:106845362-106845384 GTTGCTGCTCAGTAGGCAGCTGG + Intergenic
1031044947 7:116877001-116877023 CTTGCTACTCAGAGATAAGAAGG + Intronic
1031422656 7:121568688-121568710 CTTGCTGCTAAGGGTGAAGAAGG + Intergenic
1032483811 7:132267861-132267883 CCTGCTGCTAAGAAGTAAGCAGG - Intronic
1033346895 7:140532696-140532718 ATTGCTGCTCAGAGGAATGCAGG + Intronic
1034489230 7:151384290-151384312 TTTGCTGCCCAGATGGAATCAGG - Intronic
1035742181 8:1936862-1936884 CTTGCAGCACAGTGGGATGCGGG + Intronic
1036069450 8:5424537-5424559 CTTGTTTCTCATTGGGAAGCTGG - Intergenic
1036421619 8:8601148-8601170 CATACAGCTCAGAGGGAATCAGG - Intergenic
1036748745 8:11429694-11429716 CTGTCTGCTCAGAGGCGAGCTGG + Intronic
1038660156 8:29490207-29490229 CTTGAGGCTGAGAGGGAATCAGG - Intergenic
1039305047 8:36252198-36252220 CATGCTGCTCAGAGGGATTCTGG - Intergenic
1039469257 8:37803374-37803396 CTGGCTGCTCCCAGGGAGGCTGG - Intronic
1040439767 8:47428891-47428913 TTTATTGGTCAGAGGGAAGCTGG - Intronic
1041257804 8:55994565-55994587 CTTGCTGCTGTGTGGGAGGCTGG + Intronic
1041298958 8:56390953-56390975 CTTCCTCCTCAGAGAGAAGTAGG - Intergenic
1043609189 8:82041349-82041371 CTTGCAGCTCCCAGGGACGCAGG + Intergenic
1043784494 8:84380930-84380952 CTGGCAGCTCAGACAGAAGCTGG + Intronic
1046615277 8:116470693-116470715 CTTGCTCTTCAGAGGCAAGCTGG - Intergenic
1048547100 8:135397399-135397421 CTTGCTGCTGAGAGGTACCCAGG - Intergenic
1048978826 8:139692027-139692049 CTTCCTGCTGGGAGGGATGCTGG + Intronic
1049333726 8:142070533-142070555 CTTCGTGCTCAGGGGGAAACTGG + Intergenic
1049807167 8:144546298-144546320 CCTGCTGCTCTGAGAGAACCTGG + Intronic
1050418483 9:5438245-5438267 CCTGCTGCTCAGAGAGATGTCGG + Intergenic
1051392679 9:16582624-16582646 CCTGGACCTCAGAGGGAAGCTGG - Intronic
1051848881 9:21485935-21485957 ATTGCTGCACAGAGGGAAATTGG - Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1053735340 9:41097954-41097976 CCTGTTGCTCACAGGTAAGCAGG + Intergenic
1055991927 9:82115630-82115652 CTTGCAGCTCAGAGAGAAGCTGG + Intergenic
1057312945 9:93953029-93953051 GTTGCAGCTCCGCGGGAAGCTGG - Exonic
1057810662 9:98254600-98254622 CTTGCTGCTGATAGGAAAACAGG + Intronic
1059426376 9:114223334-114223356 AATTCTGCTCAGAGGGAGGCTGG + Intronic
1060186371 9:121566500-121566522 CTTGGAGCTCACAGGAAAGCAGG - Intergenic
1060724545 9:125998259-125998281 CTTGCTGCTCAGAGCAACACTGG - Intergenic
1061914005 9:133739649-133739671 CTGGCTGCCCAGTGGAAAGCTGG + Intronic
1061949943 9:133930548-133930570 CTTGCTAGTCAGAGGGAAGAGGG + Intronic
1061973980 9:134059216-134059238 GAAGCTGCTCAGAGGGAAGAGGG + Intronic
1062161823 9:135084776-135084798 GTGGCTGCTTGGAGGGAAGCAGG - Intronic
1186371165 X:8948930-8948952 CTTTCTTCTCAGAGAGAAGCAGG + Intergenic
1189540726 X:41985091-41985113 CTGGCTTCTCAGAGGGACCCAGG + Intergenic
1189708753 X:43786787-43786809 CTTCCTTCTCAGAGTGAATCTGG + Intronic
1190212967 X:48461921-48461943 CATCCTGCTCAGAGTGGAGCTGG - Intronic
1192223716 X:69214601-69214623 CCTGCCGCTAAGAGGGAAGAGGG - Intergenic
1195330953 X:103799867-103799889 CTTGGTGTTCAGATGGATGCGGG + Intergenic
1196190614 X:112790583-112790605 GTGGCTGCTCAGAGGTAAGTAGG - Exonic
1199044816 X:143156835-143156857 CATGCTGCTGAGAGGGAAAGGGG - Intergenic