ID: 1143017095

View in Genome Browser
Species Human (GRCh38)
Location 17:3896674-3896696
Sequence GCTGGGGCTGAGCCACAGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 0, 2: 4, 3: 87, 4: 659}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143017084_1143017095 12 Left 1143017084 17:3896639-3896661 CCTTCTGTTCAGACAGAGCCAGG 0: 1
1: 0
2: 1
3: 23
4: 245
Right 1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG 0: 1
1: 0
2: 4
3: 87
4: 659
1143017090_1143017095 -6 Left 1143017090 17:3896657-3896679 CCAGGCAGGCCTTGGGAGCTGGG 0: 1
1: 0
2: 4
3: 51
4: 509
Right 1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG 0: 1
1: 0
2: 4
3: 87
4: 659
1143017082_1143017095 18 Left 1143017082 17:3896633-3896655 CCCAGACCTTCTGTTCAGACAGA 0: 1
1: 0
2: 3
3: 15
4: 172
Right 1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG 0: 1
1: 0
2: 4
3: 87
4: 659
1143017079_1143017095 29 Left 1143017079 17:3896622-3896644 CCGTCGCTTCCCCCAGACCTTCT 0: 1
1: 0
2: 0
3: 35
4: 368
Right 1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG 0: 1
1: 0
2: 4
3: 87
4: 659
1143017080_1143017095 20 Left 1143017080 17:3896631-3896653 CCCCCAGACCTTCTGTTCAGACA 0: 1
1: 0
2: 1
3: 8
4: 180
Right 1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG 0: 1
1: 0
2: 4
3: 87
4: 659
1143017083_1143017095 17 Left 1143017083 17:3896634-3896656 CCAGACCTTCTGTTCAGACAGAG 0: 1
1: 0
2: 2
3: 12
4: 147
Right 1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG 0: 1
1: 0
2: 4
3: 87
4: 659
1143017078_1143017095 30 Left 1143017078 17:3896621-3896643 CCCGTCGCTTCCCCCAGACCTTC 0: 1
1: 0
2: 1
3: 17
4: 216
Right 1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG 0: 1
1: 0
2: 4
3: 87
4: 659
1143017081_1143017095 19 Left 1143017081 17:3896632-3896654 CCCCAGACCTTCTGTTCAGACAG 0: 1
1: 0
2: 1
3: 18
4: 218
Right 1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG 0: 1
1: 0
2: 4
3: 87
4: 659

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143017095 Original CRISPR GCTGGGGCTGAGCCACAGGC AGG Exonic
900103021 1:970894-970916 GCTGGGGCAGAGCACCAGGAGGG - Exonic
900117193 1:1033798-1033820 GCTGGGGCTGGGCCCGGGGCCGG - Intronic
900185425 1:1331054-1331076 CAAGGGGCTCAGCCACAGGCAGG + Intergenic
900573140 1:3369597-3369619 CCTGGAGCTCAGCCACAGTCCGG - Intronic
900629212 1:3624923-3624945 GAAGGGGCGGAGCCAGAGGCGGG + Intergenic
900873791 1:5326656-5326678 GCTGTATCTGAGCCACAGGAGGG - Intergenic
900911321 1:5598920-5598942 GCTGGGGCAGAGCCAGAGCGTGG - Intergenic
900924252 1:5693044-5693066 GGTAGGGCTGAGCCACTGGCTGG + Intergenic
900990370 1:6095823-6095845 CTTGGGCCTGTGCCACAGGCTGG - Intronic
901057890 1:6457268-6457290 GCTGGGGGTCAGGCAGAGGCTGG + Intronic
901060729 1:6470833-6470855 GCTGAAGCTGAGCGACATGCTGG - Exonic
901730094 1:11273124-11273146 GGCGGGGCCGAGCCAGAGGCGGG - Intergenic
901801233 1:11709259-11709281 GCTCGGCCTGAGACACAGGGTGG - Exonic
901807916 1:11749573-11749595 GCTGGGGCTGGGTCCAAGGCAGG - Intronic
901808954 1:11755074-11755096 GCTGGGGCTGGGTCCAAGGCAGG - Intergenic
902386536 1:16079130-16079152 GCTGGGGCTGAGTTACCAGCAGG - Intergenic
902404170 1:16174038-16174060 GCTGATGCTGAGCCCCAGACGGG - Intergenic
902511943 1:16971479-16971501 GCTGGAGCAGAGCCACAGCCCGG + Exonic
902631163 1:17705526-17705548 GCTGGGGCTGGGCCATGAGCTGG + Intergenic
902813221 1:18901442-18901464 GGGGGGGCTGATCCACAGGTGGG + Intronic
903145884 1:21371797-21371819 GCTGGGGCAGAGAACCAGGCTGG + Intergenic
903187139 1:21635104-21635126 GCTGGGGCTGAGCTTCGGGGTGG - Intronic
903454149 1:23475349-23475371 ACTGGGGCTGGGCAGCAGGCAGG - Intronic
903492847 1:23743086-23743108 GGTGTGGCTAAGCCCCAGGCGGG + Intergenic
903961234 1:27059070-27059092 GCTGAGGCTGAGCCCCAGCCTGG - Intergenic
904002218 1:27345310-27345332 GCTGGGGCTGTGCCCCAGCTGGG - Exonic
904044619 1:27602299-27602321 GCTGGGGCTGTCCCTGAGGCGGG - Intronic
904737171 1:32643523-32643545 GCTGGGACTGTGGCCCAGGCTGG + Intronic
904837224 1:33347126-33347148 TCTGGGGCTGAGCCAGAGCAAGG + Intronic
905544984 1:38790533-38790555 GCTGGGGCTGAGGGACAAGTTGG - Intergenic
905653588 1:39672094-39672116 GCTGGGGCTGGGCTGCAGGAGGG + Intergenic
905791388 1:40791530-40791552 CCTGGGGATGAGGCACAGGAGGG + Intronic
906223589 1:44103188-44103210 GCTAGGGCTGAGCCTCAGGTGGG + Intergenic
906611757 1:47208713-47208735 GTTGGGGCTCAGCCAGAGCCCGG - Intergenic
906676080 1:47694477-47694499 GCAGGGGCTGGGGCCCAGGCAGG + Intergenic
906933262 1:50189882-50189904 ACTGGAGCTGACCCACAGTCAGG + Intronic
907309938 1:53533511-53533533 TCCAGAGCTGAGCCACAGGCTGG + Intronic
911218485 1:95221406-95221428 GCTGGGGCTGACACTCAGCCAGG + Intronic
912322675 1:108728826-108728848 GCTGTGGCCGAAACACAGGCAGG + Exonic
912326410 1:108767563-108767585 TATGGGGCTGAGCCACGTGCAGG - Intronic
912763525 1:112388882-112388904 GCTGAAGCTGACCCAAAGGCTGG - Intergenic
913565337 1:120068508-120068530 GCTGGGGGTGGGGCACGGGCGGG - Intronic
913632794 1:120725054-120725076 GCTGGGGGTGGGGCACGGGCGGG + Intergenic
913644750 1:120845178-120845200 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914081977 1:144418405-144418427 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914095476 1:144540700-144540722 GCTCGTGCAGAGGCACAGGCTGG + Intergenic
914099127 1:144568424-144568446 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914176884 1:145286905-145286927 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914285926 1:146227863-146227885 GCTGGGGGTGGGGCACGGGCGGG - Intronic
914299860 1:146369240-146369262 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914303049 1:146393193-146393215 GCTCGTGCAGAGGCACAGGCTGG - Intergenic
914516681 1:148380012-148380034 GCTGGTGCAGAGGCACAGGCTGG + Intergenic
914531612 1:148528397-148528419 GCTGGCGGGGAGGCACAGGCGGG - Intergenic
914546958 1:148678616-148678638 GCTGGGGGTGGGGCACGGGCGGG - Intronic
914619550 1:149391746-149391768 GCTGGGGGTGGGGCACGGGCGGG + Intergenic
914636779 1:149559332-149559354 GCTGGCGGGGAGGCACAGGCGGG + Intergenic
914918703 1:151833440-151833462 GCTGGAGAAGAGCCACAGACAGG - Intergenic
914932723 1:151949396-151949418 GCTAGGGCTGAGCCTCAGGTGGG + Intergenic
915471569 1:156128871-156128893 CCTTGGGCTGACCCCCAGGCTGG - Intronic
915580381 1:156809559-156809581 GCGGGGGCAGAGGCTCAGGCTGG - Intronic
915616716 1:157045230-157045252 GCTGGGTCTGAGAATCAGGCTGG - Exonic
915619909 1:157074798-157074820 GCCAGGGCTGAGCCTCAGGTGGG - Intergenic
916701678 1:167302181-167302203 GCTGAGGCTGAGGCTGAGGCAGG - Intronic
916717618 1:167458377-167458399 GCTAGGCCTGAGTCACATGCAGG - Intronic
917111979 1:171557834-171557856 GCTGGGGCTGAAGCTGAGGCAGG - Exonic
917135478 1:171784561-171784583 GCTGGGGCTGGGGCTGAGGCTGG + Intronic
918194206 1:182206653-182206675 GCTGGGCCTGATGCACAGACTGG + Intergenic
918405756 1:184210304-184210326 CTTGGAGCTGAGCCACAGTCTGG + Intergenic
922092927 1:222414704-222414726 GCTGAGGATGGGCCACAAGCAGG - Intergenic
922576616 1:226665164-226665186 GCTGCTGCTCAGCCCCAGGCAGG - Intronic
922586184 1:226736644-226736666 GCTGTGGGTGAGCCACAGCGGGG + Exonic
922648734 1:227318556-227318578 GCTGGGGCTGAGGCTCGGGCAGG - Intergenic
922810228 1:228411206-228411228 CCTGGAGCTGAGCCACCTGCTGG - Intronic
922866376 1:228864619-228864641 GCTGTGGCTGATCCACTGGGTGG + Intergenic
922908688 1:229197378-229197400 GAGGGGGCTGAGCCACACTCAGG + Intergenic
924111398 1:240703182-240703204 GCAGGGACTGAGCCACTGGATGG + Intergenic
924625527 1:245694146-245694168 GCTGGGGATGAGAAAGAGGCAGG - Intronic
924775955 1:247114597-247114619 GATGAGGCTAAGACACAGGCTGG + Intergenic
1062899573 10:1132723-1132745 GCTGGGGCTGAGGCTGAGGCTGG + Intergenic
1062976056 10:1683838-1683860 GGTGGGGCTGAGTCCGAGGCCGG + Intronic
1063204348 10:3816381-3816403 ACTGTGGCTCAGACACAGGCTGG + Intergenic
1063320262 10:5045736-5045758 GCAGGGCCTGAGCTCCAGGCTGG + Intronic
1063618816 10:7626126-7626148 GCTGTGGCTGAACCAGAGGTGGG - Intronic
1063949500 10:11208793-11208815 GCTGGGACTGAGAGACAGGAGGG + Intronic
1064175631 10:13072554-13072576 AATGGGGTGGAGCCACAGGCAGG + Intronic
1066431615 10:35357179-35357201 GCTGGGGCTGGGGCAGGGGCAGG - Intronic
1066450088 10:35521000-35521022 AGTGGGGCTGAGCCATAGACAGG - Intronic
1066759517 10:38739094-38739116 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1067102324 10:43342497-43342519 GCTGGGCCGGAGCCAGAGGCAGG + Intergenic
1067130538 10:43560495-43560517 GCTAGGGCTGAGCCTCAGGTGGG - Intronic
1067430031 10:46236758-46236780 GCTGAGGCTGAGGCACATGATGG - Intergenic
1067545071 10:47187080-47187102 GCTGGGGCTGGGAAGCAGGCAGG + Intergenic
1068928092 10:62560585-62560607 GATGGGGCTGAGAGACAGGCAGG - Intronic
1069362875 10:67663473-67663495 GCTAGGGCTGAGCCTCAGGTGGG + Intronic
1069617461 10:69815252-69815274 CCTGAGGCTGAGACACAGGGAGG + Intronic
1069722003 10:70555664-70555686 TCTGGCTCTGAGCCCCAGGCAGG + Intronic
1069846629 10:71376873-71376895 GCTGAGGCAGAGGCAGAGGCAGG - Intergenic
1069881996 10:71598933-71598955 TCTGGGGCTGAGCCTCCAGCTGG + Intronic
1069914222 10:71777532-71777554 GCAGGGGGTGGGTCACAGGCTGG - Intronic
1070287487 10:75094548-75094570 GTGGGGGCTGAGGCAGAGGCAGG - Intronic
1071471790 10:85988663-85988685 GGGGTGGCTGAGCCACAGGTTGG + Intronic
1071984517 10:91037004-91037026 GCTGTGTCTGAGTCACAGCCTGG + Intergenic
1072140485 10:92585067-92585089 AATTGGGCTGAGCCACAGTCTGG - Intergenic
1072298786 10:94038885-94038907 GCTGGGGGAGAGGCACAGGATGG - Intronic
1072895742 10:99365094-99365116 GCTGGGGCTAAGACAAATGCTGG + Intronic
1073210314 10:101795857-101795879 ACTTGTGTTGAGCCACAGGCTGG + Intronic
1073426804 10:103459865-103459887 TCTGGGGCTGAGACAGAGCCTGG + Intergenic
1073468722 10:103709550-103709572 GAAGGGGCTGTGCCAGAGGCTGG - Intronic
1073524799 10:104170329-104170351 TCTGGGGCAGAGGCACAGGGTGG + Intronic
1074445359 10:113517260-113517282 GCAGGGGCTGGGCCAAAGCCTGG - Intergenic
1074760699 10:116665291-116665313 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1074884309 10:117682922-117682944 TCTGGGGGTGGGCCCCAGGCAGG - Intergenic
1075072042 10:119326127-119326149 TGTGGGGCAGAGGCACAGGCAGG - Intronic
1075671380 10:124265988-124266010 GCTGGGGCTGGGAGTCAGGCAGG - Intergenic
1076138812 10:128063841-128063863 GGTGGGGTTGAGTGACAGGCAGG + Intronic
1076611212 10:131727001-131727023 GCTGGAGCCCAGCCACAGACGGG - Intergenic
1076776422 10:132700360-132700382 GCTGGCCCTGACCCACAGGGAGG - Intronic
1077043547 11:534950-534972 GCAGGGACTGAGCGACAGGAAGG + Intronic
1077076858 11:706007-706029 GCTGGGGCTGGAGCCCAGGCGGG + Intronic
1077141339 11:1026235-1026257 GGTGGGGCTGTCCCAGAGGCGGG - Intronic
1077730228 11:4722617-4722639 GCTAGGGCTGAGCCTCAGGTGGG + Intronic
1077919509 11:6632157-6632179 GCTGGTTCTCAGCCACAGCCAGG + Exonic
1078063425 11:8062385-8062407 GCTTGGGCTGAGGCGGAGGCTGG + Intronic
1078225209 11:9385153-9385175 GCTGGGAATGAGCCAGAGGTCGG - Intronic
1078577613 11:12515326-12515348 GGTGGAGCTCAGCGACAGGCTGG - Intronic
1079078180 11:17396507-17396529 GCTGGGCCAGGGCCATAGGCAGG + Intronic
1079456717 11:20642786-20642808 GCTGGGAGTGAGGCAGAGGCTGG + Intronic
1080660924 11:34295318-34295340 GTTGGGGGTTGGCCACAGGCAGG + Intronic
1080911152 11:36600342-36600364 GCAGGAGGTGAGCCGCAGGCCGG + Intronic
1081639089 11:44740491-44740513 GCTGGGACTGGGCCACAGGTGGG + Intronic
1082159959 11:48880123-48880145 GCTGGGACCCAGCCACAGGGTGG + Intergenic
1082162821 11:48902147-48902169 GCTGGGACCCAGCCACAGGGTGG - Intergenic
1082998656 11:59272523-59272545 GCTGGGGCTGAACCACATGTTGG + Intergenic
1083815435 11:65130070-65130092 TCTGGGGCAGAGCCAGAGCCTGG + Exonic
1083924356 11:65796916-65796938 GCTGGGCCTGAGCCTGAGCCCGG - Exonic
1084086196 11:66856479-66856501 GCTGGGGCGGCGCCCCTGGCAGG - Intronic
1084169968 11:67396371-67396393 CCTGGAGCTGAGGCACTGGCTGG - Exonic
1084335673 11:68456181-68456203 GCTGGCGCTGATCCACGGGCTGG - Intergenic
1084422269 11:69066317-69066339 GCTTGGGCTGAGGCCCAGGAGGG + Intronic
1084430026 11:69105889-69105911 GCAGGCGCTGAGCCCCGGGCTGG - Intergenic
1084564567 11:69921715-69921737 GCAGGCCCAGAGCCACAGGCTGG - Intergenic
1084758060 11:71251722-71251744 GGTCGCGCTGAGCCACAGCCGGG - Intronic
1084776434 11:71380014-71380036 GCTGGGTCTCAACCCCAGGCAGG - Intergenic
1084891711 11:72239980-72240002 GCTGGGGCTCAGGCGCGGGCTGG + Exonic
1085122634 11:73976949-73976971 GCTGGGCCACAGCCACAGCCAGG + Exonic
1085203073 11:74713407-74713429 GCTGTGGCTCCGTCACAGGCTGG + Exonic
1085252153 11:75150997-75151019 GCTGAGGCTGAGCCTCAGGGAGG + Exonic
1085266962 11:75242783-75242805 GAAGGGCCTGAGCCAGAGGCGGG - Exonic
1085338542 11:75716444-75716466 GATGGTGCTGAGCTACAGGGAGG + Intergenic
1085419389 11:76342627-76342649 GCAGGAGCTGAGACACAAGCAGG + Intergenic
1085439165 11:76542268-76542290 TCTGTGACTGAGCCACATGCTGG - Exonic
1088485015 11:110332332-110332354 GCAGGAGGTGAGCAACAGGCAGG - Intergenic
1088619821 11:111670834-111670856 GCTAGGGCTGAGCCTCAGGTGGG + Intronic
1089313178 11:117573508-117573530 GCTGGGGCTGAAGCAGAGGGTGG - Intronic
1089535982 11:119161116-119161138 GCAGGGGCTGGGGTACAGGCTGG - Exonic
1089599120 11:119602742-119602764 GCTAGGGCTGAGCCTCAGGTGGG + Intergenic
1089638532 11:119832106-119832128 GCCTGGGCTGAGCCTCTGGCAGG + Intergenic
1089782398 11:120882840-120882862 GCTGGGGCAGAGCCTCAGAAGGG - Intronic
1089905649 11:122035505-122035527 GATGTGGCTCAGCCACATGCTGG - Intergenic
1090074658 11:123572788-123572810 GCTGGGGCAGAGGCGCAGGTAGG + Intronic
1090074682 11:123572850-123572872 GCTGGGGCAGGGGCACAGGTAGG + Intronic
1090074726 11:123573005-123573027 GCTGGGGCAGAGGCCCAGGTAGG + Intronic
1090074738 11:123573036-123573058 GCTGGGGCAGAGGCGCAGGTAGG + Intronic
1090832043 11:130426944-130426966 GCCGGGGCTGAGCGCCAGGTTGG + Intronic
1090884367 11:130862678-130862700 GCTGAGGCTGAGCCCCAGCCAGG - Intergenic
1091189660 11:133680509-133680531 GCTGGTGATGAGACAGAGGCAGG - Intergenic
1091194654 11:133720544-133720566 GTTGGGGATGAGCTTCAGGCAGG + Intergenic
1091220795 11:133928896-133928918 GCAGGGGCTGACCCCAAGGCTGG + Intronic
1091400033 12:175952-175974 GATGGGGCTCAGCCCGAGGCAGG + Exonic
1091702668 12:2674266-2674288 GGCTGGCCTGAGCCACAGGCAGG + Intronic
1091853599 12:3720968-3720990 CAAGTGGCTGAGCCACAGGCGGG - Intronic
1092029879 12:5275283-5275305 GGTGGGTCTGTGCCACAGGCTGG - Intergenic
1092209846 12:6639111-6639133 GCTAGGGCAGAGCCAGGGGCAGG + Intronic
1092229724 12:6769806-6769828 GCTTGGGATGGGCCACAGGGTGG - Intronic
1092582454 12:9858323-9858345 GCTGGGGCTGTGCTACAAGCTGG - Intronic
1093548014 12:20369893-20369915 GCTGGTGCTGAGGCTGAGGCTGG + Exonic
1093641095 12:21527690-21527712 CCTGGGGCTCAGCGACAGCCTGG - Intronic
1094674642 12:32607619-32607641 GCGGAGGCTGAGCCTGAGGCAGG - Intronic
1095983242 12:47984407-47984429 TCTGTGGCTGAGCCCCATGCTGG - Intronic
1096045961 12:48562804-48562826 TCTAGGGCTGAGCCAGATGCTGG - Intergenic
1096073792 12:48789569-48789591 GCTGGGGCTGGGGCAGGGGCAGG - Intergenic
1096618817 12:52849639-52849661 GAAGGAGCAGAGCCACAGGCTGG - Intergenic
1096626146 12:52897311-52897333 GCTAGGGCTGAGCCTCAGGTGGG + Exonic
1097192028 12:57224038-57224060 GTTGGGGCTGAGGCCCAGGTGGG + Intronic
1097615661 12:61880869-61880891 GCTAGGGCTGAGTCTCAGGTGGG - Intronic
1098264786 12:68707157-68707179 GCTAGGGCTGAGCCTCAGGTGGG - Intronic
1099452363 12:82822918-82822940 CCTGGGACTGAGCCACAGTCTGG + Intronic
1099849001 12:88067472-88067494 GCTGAGGGTGATGCACAGGCAGG - Intronic
1100181235 12:92088394-92088416 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1100208643 12:92378318-92378340 GGTTGGGCTGAGCCACAGGCAGG + Intergenic
1101567404 12:105921124-105921146 ACTTGGGCTGAGCCTCAGGTTGG + Intergenic
1101865114 12:108515048-108515070 GCGGGGCCTAGGCCACAGGCAGG - Intergenic
1102132932 12:110547288-110547310 GCTGGGATTCAGACACAGGCAGG - Intronic
1102514602 12:113437909-113437931 GCTAAGGCTGCCCCACAGGCAGG - Exonic
1103568097 12:121827131-121827153 GCTGGGGCAGAGGCCCAGGGAGG + Intronic
1103698524 12:122835577-122835599 GCGGGTGCTGAGCCGCAGGCCGG + Exonic
1103706484 12:122876872-122876894 GCAGGGGCAGAGGCAGAGGCAGG + Intronic
1103741689 12:123095674-123095696 GCTGGGGCTGAGCTGCAGGGAGG - Intronic
1104738465 12:131154579-131154601 CATGGGGCTGAGCCACAGCCAGG - Intergenic
1104884328 12:132096559-132096581 CCTGGGGCTGGGCCTGAGGCGGG - Intronic
1104962431 12:132494549-132494571 GCTGCGCCTGGGCCACAGGGAGG + Intronic
1105023561 12:132834084-132834106 GTTGGGCCTGAGCTACAGGGAGG + Intronic
1105432615 13:20350965-20350987 GCTGGGGCTGGGCCTCGGGGAGG + Intergenic
1106312536 13:28566472-28566494 TGTGGGGCACAGCCACAGGCAGG + Intergenic
1106340091 13:28819748-28819770 GCTGGGGCTGGGGCTGAGGCGGG + Intergenic
1107828171 13:44349894-44349916 GCTGAGGATGAGCCCAAGGCTGG + Intergenic
1108454132 13:50596408-50596430 GCTGGAGCTGAGCCCCTGGGAGG + Intronic
1109217219 13:59603500-59603522 GCTGGGACTTAGTCACAAGCTGG + Intergenic
1111731318 13:92080339-92080361 TCTGGAGCTGAGCAAAAGGCGGG - Intronic
1111991940 13:95125154-95125176 GCTGGGTATGAGTCACAGCCTGG - Intronic
1113508213 13:110831596-110831618 GCAGGGGCTGGGCCACAGGCTGG - Intergenic
1113811342 13:113144298-113144320 GCCGGGGCTGAGGGAGAGGCTGG + Intronic
1113815604 13:113168420-113168442 TCTGGCGCAGAGCCCCAGGCTGG + Intronic
1113837310 13:113336776-113336798 TCTAGGGCTGAGCGCCAGGCGGG - Intronic
1113853551 13:113431487-113431509 GCGGGGGCAGAGCCGTAGGCAGG - Intronic
1113919390 13:113898563-113898585 GCTGGGGCTGCACGCCAGGCCGG - Intergenic
1113968176 13:114166557-114166579 TCCGGGGCTGGGGCACAGGCTGG - Intergenic
1114424643 14:22611753-22611775 GCCGGGGATGAGACACAGGCAGG - Exonic
1114549143 14:23523230-23523252 GCGGGGGCTGAGCCAGAGCTGGG + Exonic
1115503562 14:34071713-34071735 CCTCAGGCTGAGTCACAGGCAGG - Intronic
1115951713 14:38728579-38728601 GCTAGGGCTGAGCCTCAGGTGGG - Intergenic
1116817909 14:49599921-49599943 GCTGAGGCTGAGCCCGGGGCCGG + Intronic
1116958246 14:50944960-50944982 GCTGGGGCGGTGCCAAGGGCTGG - Intergenic
1117684768 14:58241627-58241649 GCTGAGGCTGAGGCTGAGGCAGG - Intronic
1119207835 14:72808019-72808041 GCTGGGGGTGACCCTCAGGGAGG - Intronic
1121310981 14:92934874-92934896 GGCGGGGCTGAGACACCGGCTGG + Exonic
1121498145 14:94411795-94411817 GCTGGGGCTGAGCAAGCTGCTGG + Intergenic
1121522952 14:94598960-94598982 GCTGGGCGTGCCCCACAGGCGGG + Intronic
1122229502 14:100298655-100298677 GCTGGGGCTGATCCACATGCTGG - Intronic
1122370355 14:101225973-101225995 CCTGGGGCTGACGCCCAGGCTGG + Intergenic
1122420402 14:101572795-101572817 GTTGGGGTGCAGCCACAGGCAGG - Intergenic
1122447519 14:101780875-101780897 TCTGGGGTTGAGCCAAATGCTGG - Intronic
1122609754 14:102973828-102973850 GCGGGGGCTGTGCAGCAGGCAGG + Intronic
1122633883 14:103121414-103121436 GCTGGGGAGGAGCCGTAGGCTGG + Intergenic
1122692706 14:103538767-103538789 GCTGGGGCAGGGCAGCAGGCTGG - Intergenic
1122805585 14:104254889-104254911 ACTGAGGCAGAGCCAGAGGCTGG + Intergenic
1122910532 14:104825821-104825843 GCTGGGGCGGAGGGACTGGCAGG + Intergenic
1122918068 14:104867912-104867934 TCTGAGACTGAGCCCCAGGCAGG - Intronic
1122948000 14:105021989-105022011 GCTGGGGCAAAGCCCGAGGCAGG + Intergenic
1202930250 14_KI270725v1_random:28681-28703 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1124848055 15:33310894-33310916 GCTGAGGCTGAGCCAGGAGCTGG + Intergenic
1125840934 15:42800856-42800878 GCTAGGGCTGAGCCTCGGGTGGG + Intronic
1126467421 15:48973460-48973482 GCCAGGGCTGAGCCTCAGGTGGG - Intergenic
1127287792 15:57546024-57546046 GCTGGGGCTGGGCCATCAGCCGG + Intronic
1127420401 15:58799465-58799487 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1128842345 15:70860257-70860279 GCTTGGGCTGAGCCTCAGGTGGG - Intronic
1129296919 15:74604726-74604748 GCTGTGGCTGTGGCACAGCCCGG + Intronic
1129329855 15:74821413-74821435 GCTGGGGCTGAGGCTGGGGCTGG + Intronic
1129524381 15:76204579-76204601 GCTGAAGCTGGGCCACAGGCTGG - Exonic
1129526072 15:76215418-76215440 GCTGGGGAAGGGCCCCAGGCTGG + Exonic
1130151260 15:81313449-81313471 GCTGGGGACGAGCGCCAGGCAGG + Intronic
1130664128 15:85854891-85854913 CCTGGGGCTGGGCTGCAGGCTGG + Intergenic
1130705801 15:86232017-86232039 CCTGAGGCCGAGCCTCAGGCCGG + Intronic
1131266357 15:90917747-90917769 GCTGGGCCTGAGAGCCAGGCTGG + Intronic
1131453110 15:92562656-92562678 GCCAGGGCTGGACCACAGGCAGG + Intergenic
1132110419 15:99098696-99098718 GTGGAGGCTGAGCCACAGGGTGG - Intronic
1132232143 15:100192305-100192327 ACTGGGGATGAGGCCCAGGCAGG + Intronic
1132317722 15:100901965-100901987 GCTGGGTTTGGGGCACAGGCTGG - Intronic
1132747350 16:1442583-1442605 GGTGAGGCTGACCCACAGGCTGG + Intronic
1132827256 16:1911578-1911600 GCTGGGGCTGAGCGGCACCCTGG - Exonic
1132907503 16:2290436-2290458 CCTGGAGCTGAGTCACAGGTGGG + Intronic
1132933681 16:2470973-2470995 CCTGGGGCTGTGCCACGTGCTGG - Intergenic
1132938955 16:2497483-2497505 CCTGGGGCTGTGCTCCAGGCGGG - Intronic
1132942456 16:2514719-2514741 GGTGGGTCTCACCCACAGGCAGG + Intronic
1133104748 16:3500204-3500226 GCTCGGGCTGCACAACAGGCCGG - Intergenic
1134099304 16:11440430-11440452 GCTGGGGCACAGCCACAAGGTGG + Intronic
1136126834 16:28189436-28189458 GCTGGGGCTGAGATTCTGGCTGG - Intronic
1136239691 16:28936619-28936641 TCTGGGGCGGAGCTATAGGCTGG - Intronic
1136544459 16:30947758-30947780 GCTGGGGCTGAGCTGGAGGTGGG + Exonic
1136862712 16:33712856-33712878 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1137571028 16:49566421-49566443 GCTGGGGCTGGGCTGCAGGTGGG - Intronic
1137693424 16:50445732-50445754 GCTGGGGCCCAGGCAGAGGCCGG + Intergenic
1137724284 16:50646580-50646602 CCAGGGCCTGAGCCACAGCCAGG - Intergenic
1137832225 16:51554890-51554912 GGTGGCTCTGAGGCACAGGCTGG + Intergenic
1138004773 16:53322478-53322500 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1138219508 16:55238922-55238944 GCTGGGGCTGTGCTGTAGGCTGG - Intergenic
1138299053 16:55911152-55911174 GCTGGGGCAGAGCAACAAGATGG - Intronic
1139346547 16:66307528-66307550 GCAGGGGCAGAGGCAGAGGCAGG - Intergenic
1139439890 16:66961152-66961174 GCTCAGGCTGAGCCAGAGGCAGG - Intergenic
1139691166 16:68642951-68642973 GCTGGGGCTGGGACTGAGGCTGG - Intronic
1139954838 16:70688165-70688187 TCAGAGGCAGAGCCACAGGCTGG + Intronic
1140125346 16:72113432-72113454 GTTGGGGTTGAGTCACAGACAGG + Intronic
1140753630 16:78048365-78048387 GCTAGGGCTGAGCCTCAGGTGGG + Intronic
1141205165 16:81927892-81927914 GCTTGGGCTGAGGCAGAGACTGG + Intronic
1141480714 16:84304856-84304878 GCTGGGGCTGGGCCACAGGAGGG + Intronic
1141505024 16:84471345-84471367 GGTGCTGCTGAGCCCCAGGCTGG - Intergenic
1141524635 16:84603795-84603817 GCTGGGAATGAGCCACAGAAAGG + Intronic
1141901627 16:86994935-86994957 GCTGGGGCGGAGCAGCAGGCTGG - Intergenic
1141958922 16:87391973-87391995 GGGGAGGCTGAGCCACAGGCGGG - Exonic
1142029167 16:87829862-87829884 GGTGGGGGTGAGCCATGGGCGGG - Intergenic
1142121391 16:88388247-88388269 GGTGGGCCAGAGCCAGAGGCAGG + Intergenic
1142304349 16:89277275-89277297 CCTGGGGCTGAGCCAGAGGAAGG - Intronic
1203124188 16_KI270728v1_random:1560998-1561020 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1142807439 17:2378921-2378943 GCTGAGGCTGAGGCTGAGGCTGG - Intronic
1142865891 17:2791276-2791298 GCTGGGACTTTGCCCCAGGCTGG + Intronic
1142973686 17:3630371-3630393 GCAGGGGCAGACACACAGGCAGG + Intronic
1142991446 17:3733871-3733893 CCTGGGTCTGATTCACAGGCTGG - Intronic
1143017095 17:3896674-3896696 GCTGGGGCTGAGCCACAGGCAGG + Exonic
1143411626 17:6712915-6712937 CCAGGGGCTGAGCCTAAGGCTGG + Intronic
1143732583 17:8889353-8889375 GCTGAGGCTGAGTTACAGCCAGG + Intronic
1143776242 17:9200896-9200918 GGTGGGCCTGAGCCAGTGGCAGG + Intronic
1143781550 17:9232035-9232057 ACTGGGGCTGAGCCAGAGGTGGG + Intronic
1144341817 17:14316323-14316345 GCTGAGGCTGAGGCCGAGGCCGG + Intronic
1144783790 17:17820809-17820831 GCTGGGGCTGAGCCCAGGGTCGG + Intronic
1145773642 17:27511233-27511255 GCTGGGGCTGGAACACTGGCAGG + Intronic
1145974550 17:28976679-28976701 TCTTGGGCTGAGCCTCTGGCAGG + Intronic
1146287695 17:31585369-31585391 GCTGGGCCTTGGCCACAGCCAGG + Intergenic
1146667195 17:34713037-34713059 GCTGGGGCCAACCCACAGGAAGG + Intergenic
1146922141 17:36720846-36720868 GCTTAGGCAGAGCCACAGGAAGG - Intergenic
1147156699 17:38547772-38547794 CCTGGGGCTGAGCCCCCGGGGGG + Intronic
1147187402 17:38720168-38720190 CCTGGGGCGGAGCCTGAGGCTGG - Intronic
1147349959 17:39834844-39834866 GTTAGGGCTGAGCCTCAGGTGGG + Intronic
1147746611 17:42698812-42698834 GCTGGGGCTGGGGCTGAGGCTGG - Exonic
1147977737 17:44257712-44257734 GCAGGGGCTGAGCCCCCAGCAGG + Exonic
1148215634 17:45832789-45832811 GCTGGGCCTCAGCCACTGCCAGG + Intronic
1149301979 17:55313739-55313761 GCTGGAGCTGAGCTACAGCTTGG + Intronic
1150282717 17:63938663-63938685 GCAGGGGAGGGGCCACAGGCAGG + Exonic
1150440736 17:65189490-65189512 GCTGGGGCTGGGGCTGAGGCTGG + Intronic
1150645191 17:66973515-66973537 GCTGGGACAGAGCCCCAGCCAGG - Intronic
1151303951 17:73250969-73250991 GCAGGGCCTGTGCCACAGGGTGG - Intronic
1151425915 17:74030972-74030994 TTTGGGGCTGAGCCTCAGGCTGG + Intergenic
1151431487 17:74066477-74066499 GGTGTGGCTGAGCCCCAGGTGGG - Intergenic
1151481975 17:74374947-74374969 GCTGGGTCTAGGCCAGAGGCAGG + Intergenic
1151674400 17:75590136-75590158 CCTGGAGCTGAGCCTCCGGCCGG + Intergenic
1151678093 17:75610214-75610236 GCAGGGGCTGGGCCACCAGCAGG - Intergenic
1151759797 17:76094128-76094150 GCAGGGGCTCTGCCTCAGGCGGG + Intronic
1151982665 17:77523012-77523034 CCTGAGGCTGTGTCACAGGCAGG + Intergenic
1152031654 17:77846733-77846755 GCAGGGCCTGAGCCACAAGTGGG - Intergenic
1152115781 17:78386158-78386180 GCTGGAGCCGGGCCACGGGCTGG + Intronic
1152395557 17:80030757-80030779 GCAGGGGCAGAGGCAGAGGCAGG + Intronic
1152458836 17:80430942-80430964 GCTGGGGCTGGGCTGCAGGTGGG - Intronic
1154001038 18:10482555-10482577 GGTGGTGCTGAGCCAGGGGCCGG + Intronic
1154344530 18:13531114-13531136 GCTGGTCCTGAGCCCAAGGCAGG - Intronic
1155063386 18:22247965-22247987 GGAGGGGCTGAGCCGCAGCCAGG + Intergenic
1155259005 18:24023365-24023387 GCCGCTGCTGAGCCACATGCAGG + Intronic
1155320871 18:24617683-24617705 GCTGTGGCTGAGACCCAGCCAGG - Intergenic
1157662840 18:49460566-49460588 GCCGGGGCCGAGCTGCAGGCCGG - Exonic
1158231815 18:55265032-55265054 GCTGAGGCTGAGACAGAGGGTGG - Intronic
1158536111 18:58309537-58309559 GGCAGGGCTCAGCCACAGGCAGG - Intronic
1160135211 18:76265932-76265954 GCTGAAGCTGGGCCACTGGCTGG + Intergenic
1160293434 18:77616526-77616548 CCTGGGGCAGTGGCACAGGCTGG + Intergenic
1160505879 18:79426669-79426691 GCTGCAGCTGAGTCACAGGGGGG - Intronic
1160543945 18:79640575-79640597 GCAGCGTCTGAGGCACAGGCTGG + Intergenic
1160591219 18:79945647-79945669 TCTGGGCCTGAGGCACAGGCCGG + Intronic
1160948728 19:1655608-1655630 CCTGGGGCTGAGTCACTGGGTGG + Intergenic
1161031535 19:2059976-2059998 GCAGGGGCTGAACCCCAGGGAGG - Intergenic
1161310790 19:3592976-3592998 CATGGGGCTGAGGCAGAGGCTGG - Exonic
1161394280 19:4037171-4037193 GCAGGTGCTGAGCCCCAGGCAGG - Intronic
1161577006 19:5059910-5059932 GGTGGGAGTGAGCCACACGCAGG - Intronic
1161679975 19:5675152-5675174 GCTGAGGCTGAGGCTGAGGCTGG - Intronic
1162402983 19:10457392-10457414 CCTGGGGCTGTCCCCCAGGCAGG + Intronic
1162722873 19:12672924-12672946 GCTGGGGATGTGGGACAGGCAGG + Intronic
1162752061 19:12834964-12834986 CCTGGGGCTGAGCCCCAAGGAGG - Intronic
1163273396 19:16267604-16267626 GCTGGGGAGAAGCCACAAGCAGG + Intergenic
1163632936 19:18426327-18426349 TCTAGGGCTCAGCCTCAGGCTGG + Intronic
1163799739 19:19357144-19357166 GGTGTGCCTTAGCCACAGGCAGG + Exonic
1163819340 19:19487262-19487284 GCTGAGGCTGTGCCACAGAGTGG + Intronic
1164145292 19:22509246-22509268 GCTGGGACTAGGCCAGAGGCAGG + Intronic
1164590626 19:29505022-29505044 GCTGAGGCTGAGGCTGAGGCCGG - Intergenic
1164832967 19:31336744-31336766 GCTGGTGAGGAGGCACAGGCTGG - Intronic
1164903018 19:31944237-31944259 TCTAGGGCTGAGGCACAAGCTGG - Intergenic
1164919597 19:32078983-32079005 GCTGGAGCTGAGCCTGAGGATGG - Intergenic
1164937162 19:32223868-32223890 CCTAGGGCTGAGCTTCAGGCAGG + Intergenic
1165010870 19:32845381-32845403 GCTGAGGCTGAGGCTGAGGCAGG + Intronic
1165126530 19:33601871-33601893 GCTGAGGCTGAGGCACTGTCAGG - Intergenic
1165324893 19:35108847-35108869 GCTGGAGCTGAGCGAGGGGCTGG + Intergenic
1165451658 19:35887392-35887414 TCTGGGGCTGACACCCAGGCTGG + Intergenic
1165495731 19:36151235-36151257 GGTGGGGCTGAGGCCCAGGGAGG - Intronic
1165591304 19:36972521-36972543 GCTCGGGCCGGGCCACAGGCTGG - Intronic
1166042624 19:40212999-40213021 GCTGGGGCTTGGGCACAGGGTGG - Intronic
1166230916 19:41425514-41425536 GGAGGGGCTGAGCCAGGGGCCGG + Exonic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1166518353 19:43463552-43463574 GCGGGGGCGGAGCCACATTCGGG - Intronic
1166694764 19:44846319-44846341 GCCGGAGCTGAGCGAGAGGCCGG + Intronic
1166816939 19:45551996-45552018 GCTGAGGCTGAAGGACAGGCTGG + Intronic
1167166175 19:47802055-47802077 GCTGGGACTGAGCCTGAGCCTGG + Exonic
1167258069 19:48442905-48442927 GCGGGGGCTGAGCGGCCGGCGGG - Exonic
1167532386 19:50026133-50026155 GCTGGGGCTGAGGGACTTGCGGG + Intronic
1167703753 19:51066125-51066147 ACTGGGGTTGAGGAACAGGCTGG - Intergenic
1168132929 19:54332378-54332400 GCTGAGGCAGAGCCAGAGGAGGG - Intergenic
1168176784 19:54632607-54632629 GCTGGCGCACAGCCCCAGGCTGG + Exonic
1168317318 19:55489952-55489974 GCTGGAGCTGAGCCCCAGCACGG + Exonic
926687658 2:15710439-15710461 CCTGGGGCTGAGCAGCTGGCAGG + Intronic
926809367 2:16742651-16742673 GCAGGGGCTGAGGGAGAGGCTGG + Intergenic
926862461 2:17323091-17323113 CCTGGGCCTGAGGCACAGGGAGG + Intergenic
926975682 2:18514694-18514716 TCTGGTGCTGAGCCCCAGGCTGG - Intergenic
927089484 2:19699694-19699716 CTGGGGGCTGAGCCACAGGTGGG - Intergenic
927195440 2:20543254-20543276 GCTGGCTCTGAGCCCCAGGGTGG - Intergenic
927894929 2:26775558-26775580 GCTGGTGCTGAGCCAGTGGCTGG + Exonic
927963482 2:27255151-27255173 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
927963507 2:27255263-27255285 TCTGGGGCTGAGCCTCGGCCTGG + Exonic
927964189 2:27258958-27258980 CCTGGGCCTGGCCCACAGGCTGG + Intronic
928180431 2:29064886-29064908 GCTGGGGCTGCGCCTCTGGCTGG + Exonic
928236373 2:29545107-29545129 GCTGGGCCTGATCCACAGAGTGG - Intronic
928827757 2:35441219-35441241 GTTGGGACTGAGGGACAGGCGGG + Intergenic
929370941 2:41223123-41223145 CCTGGGCCTGAGCCACTAGCGGG + Intergenic
929545087 2:42850534-42850556 GCAGGGGCTGGGCCAGGGGCTGG - Intergenic
929928326 2:46233083-46233105 GCTGGAGCTGAGTCAGAGGATGG - Intergenic
929966902 2:46542977-46542999 GCTGGGGCTGAGCCCGGGGCCGG + Exonic
931505783 2:62924060-62924082 GCTGGGGGCGATCCACAGGATGG - Intronic
932757877 2:74421505-74421527 GCTGGGGATGCGCCAGAGCCAGG - Intronic
934159556 2:89235265-89235287 GCTGTGGCTGTGCCACATACAGG - Intergenic
934176399 2:89582896-89582918 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
934207722 2:89947166-89947188 GCTGTGGCTGTGCCACATACAGG + Intergenic
934286709 2:91657257-91657279 GCTGAGCCGGGGCCACAGGCAGG - Intergenic
934322670 2:91982858-91982880 GCTGGGGCTAAGCCAGTGACAGG - Intergenic
934710288 2:96509783-96509805 GCTGGTACTGTGCTACAGGCTGG - Intergenic
935192998 2:100793357-100793379 GCTGGTGCGGAGCCAGAGCCGGG - Intergenic
935358485 2:102226888-102226910 GCGGGGCCTGGGCCACAGGGCGG + Intronic
936067270 2:109342148-109342170 GCATGGGCTGAGCCCCTGGCTGG + Intronic
936427668 2:112434538-112434560 GCAGGGGCTGTGTCCCAGGCCGG + Intergenic
937296437 2:120812455-120812477 GCTGAAGCTGAGACGCAGGCCGG + Intronic
937908702 2:127065015-127065037 GCCGGGGCTGGGGCCCAGGCTGG + Intronic
937931132 2:127205865-127205887 GCCCGGGCTGAGCCACGGGCTGG - Intronic
938101275 2:128499632-128499654 GCATGGCCTGTGCCACAGGCAGG + Intergenic
938112849 2:128580807-128580829 GCAGGGGCTGAGGCTGAGGCAGG - Intergenic
938455658 2:131460929-131460951 GCCGGGGCTGAGCCCGGGGCCGG + Intergenic
938936982 2:136135828-136135850 GTTAGGGCAGTGCCACAGGCTGG + Intergenic
942558747 2:177198649-177198671 GTTGGGGCTGAGCCTCGGGTGGG - Intergenic
943023344 2:182601073-182601095 GCTGGGCCTGAGCAAAAGGTGGG - Intergenic
943064342 2:183070922-183070944 GCTAGGGCTGAGGCTCAGGTGGG + Intergenic
944763354 2:202840213-202840235 GCTAGGGCTGAGCCTCAGGTGGG + Intronic
946310805 2:218881446-218881468 CCTGGGGCTGAGCTGCAGGAAGG - Intronic
946320773 2:218953283-218953305 GCTAGGGCTGAGCCTCAGGTGGG + Intergenic
946361925 2:219224084-219224106 GGTGGGCCAGGGCCACAGGCGGG - Exonic
946394549 2:219436542-219436564 GCTGGGGAGGAGGCACAGGGAGG + Intronic
947257229 2:228180605-228180627 GGTGGGGCTGCGCCGCAGCCAGG + Intronic
947591773 2:231389976-231389998 GGTGGGGAGGAGCCGCAGGCTGG - Intergenic
947745830 2:232506825-232506847 GCTGGGGCTCACCCTCTGGCTGG - Intergenic
948071457 2:235131143-235131165 GCTGGGGCTGGGCCACCTGAAGG + Intergenic
948323499 2:237091800-237091822 ACTGGGGCTGCCCCACAGGATGG + Intronic
948372191 2:237496402-237496424 GAAGGGGGTGAGCCACAGACAGG - Intronic
948563246 2:238867654-238867676 GCCGAGGCTGGGGCACAGGCTGG + Intronic
948825258 2:240570826-240570848 GCTGGGGCAGACCCCCAGACAGG - Intronic
948896910 2:240931873-240931895 CCAGGGCCTGAGCCACAGGAAGG + Intronic
948989147 2:241543031-241543053 GCTGGGCGGGAGCCAGAGGCTGG - Intergenic
1168773921 20:433044-433066 GCTGGGGCTGAGACCCAGCCTGG - Intergenic
1169210965 20:3766126-3766148 GCCAGGACTGAGCCCCAGGCTGG - Intronic
1169276022 20:4234246-4234268 GCTGGAGCTGAGCAACTGACTGG + Intronic
1170585040 20:17728167-17728189 ACTGAGGCTGAGCCCCAGCCTGG - Intronic
1170666101 20:18387529-18387551 ACTGGGGCAGAGCCAGAGGATGG + Intronic
1171217329 20:23362054-23362076 GAAGGGGCTGAGCCACACGTCGG - Intergenic
1171391143 20:24802518-24802540 GGTGGGGCTGAGGGACAGGCTGG + Intergenic
1171458720 20:25286633-25286655 GCAGAGGCGCAGCCACAGGCTGG - Intronic
1171518384 20:25757609-25757631 ACAGGGGCTGGGCCCCAGGCAGG - Intergenic
1171558471 20:26098597-26098619 ACAGGGGCTGGGCCCCAGGCAGG + Intergenic
1172062572 20:32196595-32196617 GCAGGGGCTGTGCCTCAGCCTGG + Exonic
1172184188 20:33021146-33021168 GCAGAGGCTGAGGCACAGGGAGG - Intronic
1172589905 20:36110386-36110408 GCTGGGGCTGAGCTGAAGCCTGG - Intronic
1172852448 20:37976552-37976574 GGGGAGGCTGAGGCACAGGCAGG + Intergenic
1172878432 20:38180816-38180838 GGTGGGGCTGAGCCTGAGGCTGG + Intergenic
1173132960 20:40411754-40411776 CCTGGGGTTCAGCCTCAGGCTGG - Intergenic
1173503638 20:43570736-43570758 CCTGGCTCTGAGCCACAGGCAGG - Intronic
1174101789 20:48132291-48132313 GCTGGGGCAGGGCCACAGAAGGG - Intergenic
1174258726 20:49278058-49278080 GCTGGGGCTTCGGCCCAGGCAGG + Exonic
1174386052 20:50189314-50189336 GCTGGGGATCAGCCCCGGGCAGG + Intergenic
1174943292 20:54956134-54956156 CCTGAGGCTGAGGCTCAGGCAGG - Intergenic
1175505548 20:59481844-59481866 GCTGAGGCTGATCTACAGGAAGG - Intergenic
1175731129 20:61354602-61354624 AGCGGGGCTGAGCCACAGGGAGG - Intronic
1175807113 20:61835791-61835813 GCTGGGCCTCAGCCACAGAGAGG - Intronic
1175815433 20:61880982-61881004 GAGGGGGCTGAGCCACAGGATGG + Intronic
1175837235 20:62004008-62004030 GCTGGGGCTGAGCTGCACACGGG - Intronic
1175994348 20:62805416-62805438 GCTGGGGCTGGGGCCCGGGCCGG + Intronic
1176023251 20:62973194-62973216 GCTGGGGCGGGGTCACATGCGGG + Intergenic
1176236190 20:64054612-64054634 GCTGGGGCTGCCACATAGGCTGG + Intronic
1176426733 21:6552969-6552991 GCTGGGACTGAGGGTCAGGCCGG + Intergenic
1176592262 21:8657263-8657285 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1178513820 21:33229880-33229902 GCGGGGGCGGAGCCAGGGGCGGG - Intronic
1179258288 21:39736805-39736827 GCTGAGGCTGAGGCTGAGGCCGG + Intergenic
1179359229 21:40689949-40689971 GCTGGGGCTGAGCCACTCCAGGG - Intronic
1179405320 21:41121144-41121166 GCTGAAGCTGAGCCTCAGGAAGG - Intergenic
1179485988 21:41711072-41711094 GCTGGGGGTGAGGCAGAGGGAGG - Intergenic
1179702224 21:43161291-43161313 GCTGGGACTGAGGGTCAGGCCGG + Intronic
1180021350 21:45129707-45129729 GCTGGTGCAGAGCCATAGGTAGG + Intronic
1180040765 21:45278314-45278336 GTTATGGCTGAGACACAGGCAGG + Intronic
1180065569 21:45410459-45410481 ACTGGGCCAGAGCCACAGGGAGG + Intronic
1180256824 21:46635493-46635515 GCTGGGGCTGCGCCCCGCGCAGG - Intronic
1180275113 22:10634392-10634414 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1180698834 22:17770834-17770856 AAGCGGGCTGAGCCACAGGCTGG + Intronic
1180899049 22:19357688-19357710 GCTGGAGCTCAGACGCAGGCAGG + Intronic
1181031421 22:20150301-20150323 GCTGGGGCTGGGGCAGGGGCAGG + Intronic
1181031441 22:20150344-20150366 GCTGGGGCTGGGGCAGGGGCAGG + Intronic
1181182590 22:21078353-21078375 GGAGGGGCTGAGGGACAGGCTGG - Intergenic
1181408444 22:22701653-22701675 GTTGGGGCTGTACCCCAGGCTGG - Intergenic
1181567917 22:23751009-23751031 GCCGGGGCGGGGCCGCAGGCGGG + Exonic
1181949327 22:26542739-26542761 GCCAGCGCAGAGCCACAGGCAGG + Intronic
1182485145 22:30634988-30635010 GCCGGGGCTGGGGCACAGGGTGG + Intergenic
1183307586 22:37090921-37090943 GCTAGGTCTGAGCCTCAGGCGGG - Intronic
1183380638 22:37488985-37489007 GCTGGGGCTGAGCCATTGCTTGG - Intergenic
1183404405 22:37623407-37623429 GATGGTGATGAGCCACAGCCAGG + Exonic
1183695382 22:39418964-39418986 GCTGGGAATGAACCCCAGGCAGG - Intronic
1184112044 22:42401310-42401332 GGAGGAGATGAGCCACAGGCTGG + Intronic
1184261514 22:43319877-43319899 GCTGGAGCAAAGCAACAGGCAGG + Intronic
1184273936 22:43399801-43399823 CCTGGGGCTCCCCCACAGGCGGG - Intergenic
1184403706 22:44288010-44288032 GGTGTGGCTGGGCCACAGGCTGG + Intronic
1184404513 22:44292482-44292504 GGAGGGGCTGGGCCCCAGGCTGG - Intronic
1184754060 22:46506513-46506535 GCTGGGGCTGGGGCTGAGGCTGG - Intronic
1185053867 22:48567854-48567876 GCATGGGCTGAGCCTCAGCCAGG - Intronic
1185305108 22:50111012-50111034 GCTGGGGCTGCCCCACAAGTAGG - Intronic
1185372979 22:50469442-50469464 TCCAGGGGTGAGCCACAGGCAGG - Intronic
1185409347 22:50674205-50674227 GCGGGGGCCGAGCCACGGGGCGG - Intergenic
950016531 3:9758555-9758577 GCTGTGGCAGAGATACAGGCAGG - Intronic
950865220 3:16183331-16183353 GCTAGGGCTGGGACACAGCCTGG - Intronic
951522320 3:23621250-23621272 GAGGGAGCTGAGCCACAAGCCGG + Intergenic
951732138 3:25821957-25821979 TATGGGGCTAACCCACAGGCAGG + Intergenic
952847911 3:37703914-37703936 GCTGGGATTCAGGCACAGGCAGG + Intronic
952847925 3:37703989-37704011 GCTGGGGTTCAGGCACAGGCAGG + Intronic
953026301 3:39147160-39147182 CCTGGCGCTGACTCACAGGCTGG + Intronic
954716027 3:52527407-52527429 TCTGTGGCTGGGCCACGGGCCGG + Intronic
955054117 3:55441036-55441058 GCTGGGGCTCAGTCCCAGGAAGG + Intergenic
955839378 3:63096256-63096278 GCTGGGGCTGAGCCTGAGGTGGG + Intergenic
956228532 3:66986900-66986922 GCTGAGGCTGAGGCTGAGGCAGG + Intergenic
956750727 3:72342058-72342080 TCTGGGGCTTAGCCAAAGGATGG + Intergenic
956990049 3:74752093-74752115 GCTGGGGCTCTGTCACAGCCTGG - Intergenic
957322501 3:78650397-78650419 ATTGCTGCTGAGCCACAGGCAGG + Intronic
957966268 3:87324810-87324832 GCTAGGGCTGAACCTCAGGTGGG - Intergenic
959580252 3:107976195-107976217 GCTGGGCATGAGCCACTGCCTGG + Intergenic
960842035 3:121969257-121969279 TCTGGTGCTGATCCCCAGGCTGG + Intergenic
960941986 3:122940869-122940891 GCTGGGGCACAGCCATAAGCTGG - Intronic
961005787 3:123404513-123404535 GCTGGGCCTCAGACACAGGCAGG - Intronic
961194026 3:124986309-124986331 CCTGGGGCTGTGACTCAGGCTGG - Intronic
961406592 3:126684063-126684085 CCTGGGGCTGTGCCACAGGAAGG - Intergenic
961431898 3:126889523-126889545 GCTCCTGCTGAGCCACTGGCTGG + Intronic
961446955 3:126985374-126985396 GCTGAGGCAGAGCCAGAGCCAGG - Intergenic
961449380 3:126995549-126995571 GCTGGGCCTCAGCCAGGGGCTGG - Intronic
961627704 3:128275196-128275218 GCTGGGGCTCTGACACTGGCTGG - Intronic
961650689 3:128415369-128415391 GGTGGGGTGGAGCCTCAGGCAGG + Intergenic
961737702 3:129012577-129012599 GGTGGGGCTGTGACCCAGGCTGG - Intronic
961749238 3:129085864-129085886 GCTGGGGCAGAGGCCCAGGCAGG + Intergenic
961756159 3:129128421-129128443 GCTGGGGCAGAGGCCCTGGCAGG - Intronic
962712715 3:138101359-138101381 GCTAGGGCTGAGCCTCAGGTGGG + Intronic
963074235 3:141331696-141331718 GCTGAGGCTGAGCCTGAGGCTGG + Intronic
964010680 3:151887892-151887914 GCTGGGGCTGGGTCTGAGGCTGG + Intergenic
964011577 3:151898479-151898501 GCTGGGGCTGGGTCTGAGGCTGG - Intergenic
964627948 3:158776936-158776958 GCTGGGGCTGTGTTACAGACTGG + Intronic
964691390 3:159453966-159453988 GCTTGGGCTTAGACACAGGATGG - Intronic
965605880 3:170496980-170497002 GCTAGGGCTGAGCTTCAGGTGGG - Intronic
968236660 3:197035474-197035496 GCCAGGGCTGAGGCTCAGGCAGG + Intergenic
968570401 4:1337434-1337456 GGTGGGACAGAGTCACAGGCAGG - Intronic
968616939 4:1581289-1581311 GCGGGGCCTGGGCCGCAGGCGGG - Intergenic
968619042 4:1595418-1595440 GCTGGGGGTCCACCACAGGCCGG + Intergenic
968669920 4:1843735-1843757 GCTGGGGCTGGGCCAGCGCCTGG - Intronic
968916124 4:3497742-3497764 ATGGGGGCGGAGCCACAGGCAGG + Intronic
969260860 4:6032564-6032586 ACTGGGGCTGACCCACAGAAGGG - Intronic
969343425 4:6556720-6556742 GCTGGGGAGGAACCACAGCCTGG - Intronic
969612750 4:8236325-8236347 GCTGCGGCTGTGCAACAAGCTGG + Exonic
971954673 4:33400780-33400802 GCTAGGGTTGAGCCTCAGGTGGG - Intergenic
973294623 4:48503388-48503410 ACTGGTGCTGAGCCACAGGGTGG + Intronic
974028848 4:56757662-56757684 GCTGGAGAAGAGACACAGGCTGG + Intergenic
975986195 4:80203001-80203023 GCTGGTGCTGGGCCAGAAGCTGG + Exonic
977928582 4:102728645-102728667 GCTAGGGCTGGGCCTCAGGTGGG + Intronic
979130859 4:117043186-117043208 GCTGTGGCTTAGAGACAGGCTGG + Intergenic
979384139 4:120044051-120044073 GCTGGGTGTGAGCCACAGCGAGG - Intergenic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
980932047 4:139191563-139191585 GCTGGGGCAGAGCCAGGGCCTGG - Intergenic
982136759 4:152279761-152279783 GCAGGGGCTGAGCCTAGGGCTGG - Intergenic
982781389 4:159494709-159494731 GCTGAGGCTGAGGCTGAGGCTGG - Intergenic
983213003 4:164977632-164977654 GCGCAGGCTGAGCCCCAGGCAGG - Exonic
985635815 5:1035493-1035515 GGTGGGGCTGTGCCTTAGGCGGG + Intronic
985790847 5:1926274-1926296 GCTGGGGCTGTGGCAGGGGCAGG - Intergenic
985963793 5:3324595-3324617 GGTGGGGCTGGGTCCCAGGCTGG + Intergenic
986909101 5:12532472-12532494 GCTGAGGCTGTGCTACAAGCAGG - Intergenic
987318305 5:16744656-16744678 GCTGGGGCTGGGGAACAGGTGGG + Intronic
990023426 5:51157069-51157091 GCTGAGGCAGAGCCGCAGCCAGG + Intergenic
990900391 5:60743440-60743462 GCTAGGGCTGAGCCTCAGGTGGG + Intergenic
990949704 5:61286594-61286616 GAAAGGGCTGAGGCACAGGCAGG - Intergenic
991586333 5:68205840-68205862 GATAGGGCTGAGCCTCAGGTGGG - Intergenic
991588031 5:68219464-68219486 CCTGGGGCAGAACCCCAGGCTGG - Intronic
992958235 5:81932292-81932314 GCTATGGCTCGGCCACAGGCAGG + Intergenic
992962689 5:81971933-81971955 GGCGGGGCTGAGACCCAGGCCGG - Intergenic
993431057 5:87832300-87832322 TCTGGGACTGAGTAACAGGCAGG - Intergenic
995036897 5:107544286-107544308 GCTGGGGCTCAGCCCCACACAGG + Intronic
995334465 5:110983600-110983622 GCAGGGCATGAGCCACAGGGAGG + Intergenic
996058779 5:119009836-119009858 TATGGGGATGAGCCACATGCTGG + Intergenic
996432815 5:123400802-123400824 CCTAGGGCTGAGCCTCAGGTGGG + Intronic
997196923 5:131986364-131986386 CCTGGGGTTGAGCCACAGTGAGG - Intronic
998164906 5:139837330-139837352 CCTGGGGCTCAGGCACATGCTGG + Intronic
998374996 5:141684651-141684673 GATGGGGCAGAGCCACAGAGAGG + Intergenic
998452980 5:142249233-142249255 GCTGAGGCCAAGCCACAAGCTGG - Intergenic
999250934 5:150181953-150181975 GCTGGGCCTGCACCAGAGGCCGG - Intronic
999386451 5:151157373-151157395 GCCGGAGCTGAGCCAGGGGCTGG - Intronic
1000128722 5:158273981-158274003 GATGGGGCTGAGGCACAACCCGG + Intergenic
1001102216 5:168823753-168823775 GAGGAGGCTGAGCCACAGGGAGG + Intronic
1001157761 5:169287834-169287856 GCTGTGGCTGTGTCAGAGGCAGG - Intronic
1001454423 5:171849706-171849728 GCAGTGGCTGAGCCACAGACCGG - Intergenic
1001745052 5:174086143-174086165 TCTGGGGCTGAGCCAGGAGCTGG - Intronic
1001745460 5:174089246-174089268 GCTGGGGTTGAGGCTCAGGGTGG + Intronic
1001956007 5:175848563-175848585 GCTGGGACAGAGCCACAGGAAGG + Intronic
1002617668 5:180465772-180465794 GCTGGGGCTGAGGCAGATGCCGG - Intergenic
1002636684 5:180612208-180612230 GATGGGGCTGCCTCACAGGCCGG + Intronic
1002924634 6:1598200-1598222 GATGGGGGAGAGGCACAGGCAGG + Intergenic
1003035262 6:2636095-2636117 CCTGGGGCCAGGCCACAGGCAGG + Intergenic
1003199296 6:3944206-3944228 GCTGGGCCTGAGGGATAGGCTGG - Intergenic
1003363048 6:5446881-5446903 GCTGGTGCAGAGACACAGGGAGG + Intronic
1004958599 6:20758901-20758923 GCTGAGGCTGAGGCTGAGGCTGG + Intronic
1005661526 6:28003497-28003519 ACTGGGGCGGGGCCATAGGCAGG - Intergenic
1005776631 6:29139229-29139251 CCTGGGGCTGAGGAACAGGATGG + Intergenic
1006516247 6:34547177-34547199 GCTTGGCCTCAGCCACAGGTAGG + Intronic
1007174090 6:39884602-39884624 GCTGAGGCTGAGGCTGAGGCTGG + Intronic
1007269448 6:40624910-40624932 GCTGGGGCTGGGCCACATTGAGG + Intergenic
1010752470 6:79631116-79631138 GCTGGAGGGGAGCCACAGCCCGG - Intergenic
1013073507 6:106750648-106750670 GGTGGTGCTGAGCCACACGGAGG - Intergenic
1013204368 6:107933657-107933679 GCAGGGGCAGAGGCAGAGGCAGG - Intronic
1013232096 6:108168444-108168466 GCGGGGGCGCAGCCGCAGGCGGG - Intronic
1015024636 6:128519466-128519488 GCGGGGCCAGAGCCCCAGGCCGG + Intronic
1015539097 6:134296878-134296900 GCTAGGACTGAGCCTCAGGTGGG + Intronic
1016759995 6:147726510-147726532 CCTGGGCCTGGGCCCCAGGCAGG - Intronic
1017051787 6:150400129-150400151 GCTGCCCCTGAGCCACAGGAGGG - Exonic
1017666229 6:156722448-156722470 GTAGGGTCTGAGACACAGGCGGG + Intergenic
1018041856 6:159931659-159931681 GCAGGGGTGGAGCCAGAGGCTGG + Intergenic
1018134520 6:160767028-160767050 TCTGGGGCTGAGCCTCAGGTAGG - Intergenic
1018211452 6:161486529-161486551 ACTGGTGCTGAGTCACAGGCTGG + Intronic
1018310941 6:162507918-162507940 GCTTGGGCAGAGTCCCAGGCAGG + Intronic
1018317356 6:162569824-162569846 GCTAGGGCTGAGCCTCAGGTGGG - Intronic
1018342283 6:162863533-162863555 GCAGAGGCTAAGCTACAGGCTGG + Intronic
1018641637 6:165909241-165909263 GCTGGGGCTGTGCCACACAAAGG + Intronic
1019176269 6:170160831-170160853 TCTGGGGCTGTGGCTCAGGCAGG + Intergenic
1019423595 7:962993-963015 GCAGGGGCTGAGCCAGAGCCTGG - Intronic
1019511278 7:1418825-1418847 GCTGGGGCTTAGGCATTGGCAGG - Intergenic
1019558252 7:1643083-1643105 GCTGGGGCAGGGACACAGGAGGG - Intergenic
1019614123 7:1951212-1951234 GCTCTGGCTGAGCCTCAGGCAGG - Intronic
1019652798 7:2169780-2169802 GCAGGGGCTGGACCACAGTCTGG + Intronic
1019652820 7:2169856-2169878 GCAGGGGCTGGACCACAGTCTGG + Intronic
1019652843 7:2169932-2169954 GCAGGGGCTGGACCACAGTCTGG + Intronic
1019735323 7:2647432-2647454 GGTGGGGCTGAACCACACGGCGG + Exonic
1020016399 7:4834444-4834466 GCTGGGGGGCAGCGACAGGCAGG + Intronic
1020098653 7:5382317-5382339 GCTGGGGCTGGGCCTCTGGGCGG - Intronic
1020113147 7:5459268-5459290 ACTGGGGCTGAGCCAAGGCCAGG - Intronic
1020127688 7:5542011-5542033 GCTGGGGACAAGGCACAGGCAGG + Intronic
1020650191 7:10865532-10865554 GCGGGGGCTGAGCCACAACAGGG + Intergenic
1023078586 7:36506826-36506848 GCTGAGGCTGAGGCTGAGGCAGG - Intergenic
1023289754 7:38656709-38656731 GCTAGGGGTGAGCCTCAGGTGGG - Intergenic
1023989072 7:45117413-45117435 GCTGGGACAGAGCCCCGGGCAGG - Intergenic
1024000885 7:45188850-45188872 GCAGGGGCCGAGCTCCAGGCAGG + Intergenic
1024007310 7:45235311-45235333 GCTGGGGCTGTGCTCAAGGCTGG + Intergenic
1024046902 7:45591227-45591249 GCTGGGGCTGAGGAGCAGGTAGG - Intronic
1024279733 7:47709435-47709457 GGTGGGGGTGGGGCACAGGCTGG + Intronic
1024612541 7:51080017-51080039 GCTTGGGCTGAGTTCCAGGCAGG + Intronic
1024777587 7:52805779-52805801 GTTGGGGCTGAGCTTGAGGCCGG + Intergenic
1024823189 7:53358475-53358497 TCTGGGGCTCAGCCACAGAGGGG - Intergenic
1025148700 7:56527535-56527557 GCTGGGCCTGAGGAACAGGCTGG + Intergenic
1025246558 7:57322006-57322028 TTTGGGTCTGAGCCACAGTCAGG - Intergenic
1026310108 7:69175886-69175908 GCAGGAGGTGAGCCACAGGCAGG + Intergenic
1026479053 7:70763159-70763181 GCTGGAGCTGGGCCTCAGGAGGG - Exonic
1026979556 7:74518351-74518373 GCTGGGGCTGGGCCAGGGCCGGG + Intronic
1027521579 7:79215800-79215822 CCTGTGGCTGTGTCACAGGCAGG + Intronic
1028165200 7:87530435-87530457 AGTGGGGCTGAGGCACAGGCAGG - Intronic
1028689525 7:93636102-93636124 CCTGAGGCTGTGTCACAGGCAGG - Intronic
1029125877 7:98295027-98295049 GGTGTGGCCGGGCCACAGGCTGG - Intronic
1029363455 7:100102659-100102681 GGTGATGCTGAGACACAGGCAGG - Exonic
1029425828 7:100493630-100493652 GGTGGGGCTGTGCCGCGGGCGGG - Exonic
1029690140 7:102175686-102175708 CGTGGGGCTGAGCCACAGGAGGG - Intronic
1030171431 7:106606796-106606818 TTTTGGGCTGAGCCACAGGATGG - Intergenic
1031586241 7:123534780-123534802 GAAGGGGATGAGCCAGAGGCGGG + Intronic
1031974738 7:128086500-128086522 CCTGGGCCAGAACCACAGGCAGG + Intronic
1032953101 7:136938782-136938804 GCTAGGGCTGAGCTTCAGGTGGG - Intronic
1034336937 7:150329944-150329966 GCTACGGCCCAGCCACAGGCTGG - Exonic
1034445342 7:151111189-151111211 GCCGGGGCTGAGGCAGTGGCTGG - Intronic
1034943589 7:155247992-155248014 GCTGGGGCTGTCCCGCAGGCTGG + Intergenic
1035018897 7:155788846-155788868 GTTGGGGCTGAGTCACAGCCAGG + Intergenic
1035244122 7:157551429-157551451 GCTGGGGCTCACCCAAAGGAAGG + Intronic
1035316708 7:158001188-158001210 GCTGGGGTCGGGCCGCAGGCGGG + Intronic
1035392940 7:158517476-158517498 GGTGGGGCTGAGGCAGAGTCAGG - Intronic
1035632164 8:1116306-1116328 GCTGTGTCTCAGCCACAGCCTGG + Intergenic
1035693881 8:1578885-1578907 GCAGGGTCTGACCCACAGACGGG - Intronic
1035755575 8:2028634-2028656 TCCCGGGCTGAGCCACTGGCTGG + Intergenic
1036644774 8:10605500-10605522 GCTTAGACTGAGCCACATGCAGG - Intergenic
1037638196 8:20719447-20719469 GCTGGGGCTGGGCCCCAGGTAGG + Intergenic
1037906650 8:22719449-22719471 TCTGAGGCTCAGCCACAGCCAGG + Intronic
1038507202 8:28094628-28094650 GCTGAGGCTGAGGCAGAGGCGGG + Intronic
1038546320 8:28428204-28428226 GCTAGGGCTGCACCACAGACCGG - Intronic
1038648785 8:29383553-29383575 TCTGGGGCTGTGCAACAGCCTGG + Intergenic
1039443308 8:37610820-37610842 TTTGGGGATGAGCCTCAGGCAGG - Intergenic
1040072634 8:43200923-43200945 GCTGGGCCTGAGACATGGGCTGG - Exonic
1040296475 8:46151621-46151643 GCGGCAGCTGAGCCACAGGCAGG - Intergenic
1040374867 8:46815182-46815204 TCTGTGGCTGTGCCACAGGCAGG - Intergenic
1040386650 8:46918883-46918905 GCAGGGGCACAGCCACAGCCTGG - Intergenic
1041743108 8:61177333-61177355 ACTGGGCCTGAGCCACTAGCAGG + Intronic
1041781241 8:61579766-61579788 GCTAGGGCTGAGCCTCAGGTGGG - Intronic
1043372821 8:79612935-79612957 GCTGGGGCTGAGAGCCACGCCGG - Intronic
1045305580 8:100953329-100953351 GGTGGGAGTGGGCCACAGGCCGG + Intronic
1047261833 8:123269644-123269666 GATGGGGCTGAGGCACAGATAGG - Intronic
1047288216 8:123506493-123506515 GCAGAGGCTGAGCGACGGGCGGG - Exonic
1047757916 8:127932535-127932557 GCTGGGACTCAGCCACAGCGTGG - Intergenic
1048167624 8:132077365-132077387 GGTGAGGCTGAGCAGCAGGCAGG + Intronic
1048257281 8:132914652-132914674 GGTGGGGCTGACACACAGGAGGG + Intronic
1048981312 8:139704380-139704402 GCGGGGGCGGAGCCGCCGGCGGG + Intergenic
1049190171 8:141282996-141283018 TCTGGCACTGAGCCTCAGGCAGG - Intronic
1049194302 8:141307415-141307437 ACCGGGGCAGAGCCACAGTCTGG + Intronic
1049201604 8:141343305-141343327 GCTGGGGCTGGGGCACAAGGGGG - Intergenic
1049265241 8:141664388-141664410 GCTGGGTCTGAGTCCCCGGCAGG - Intergenic
1049510548 8:143024777-143024799 GCTGGGGCTGAGCCCGATCCTGG + Intergenic
1049611854 8:143559567-143559589 GCTGAGGCAGAGCCCCAGGGAGG + Intronic
1049683969 8:143931895-143931917 GCTGCCGCTGAGCCACAGTGCGG + Intronic
1049725502 8:144143826-144143848 GCTGGGACTGCGGCAGAGGCAGG + Intergenic
1049828634 8:144685883-144685905 GCGGGGGCGGAGCCGGAGGCGGG - Intergenic
1051526865 9:18055042-18055064 GCTGTGGCAGAGCTGCAGGCAGG - Intergenic
1052321189 9:27169532-27169554 CCTGGGGCTGAGCATGAGGCAGG - Exonic
1053174300 9:35910887-35910909 GCTGGGGTTGACCCACAGGATGG + Intergenic
1055002136 9:71463549-71463571 GCTGTGGCAGAGCCCCAGGTGGG - Intergenic
1056329712 9:85511316-85511338 GCTGGGGCTGGGCCAGGGCCTGG - Intergenic
1056756102 9:89382950-89382972 GCTGGGGCTGAGTCTCCCGCAGG - Intronic
1056943051 9:90971615-90971637 GCTGGAGCTGACCCACAGTGAGG - Intergenic
1057138954 9:92715333-92715355 GCTGGCGCTGACCCAGCGGCTGG - Exonic
1057195446 9:93113750-93113772 GCTGGGGCGATGCCACTGGCAGG + Intergenic
1057882834 9:98806332-98806354 GCGGGGTCTGAGACACAGGGTGG - Intergenic
1057937929 9:99256497-99256519 GCTGAGGCTGAGTGACAGGGAGG + Intergenic
1059329026 9:113523589-113523611 GCTGGGGCTCAGGCACATGTGGG + Intronic
1060209010 9:121699188-121699210 GCTGGGGCCGAGCCCGAGCCCGG + Intronic
1060506627 9:124202710-124202732 CCAGGGGCTGAGTCACTGGCGGG - Intergenic
1060514819 9:124258805-124258827 GCTGCGGCAGGGCCACTGGCAGG + Intronic
1060889206 9:127177544-127177566 GCTGAGGCTGAGGCTGAGGCAGG - Intronic
1061012783 9:127965283-127965305 CCTGGGGCTGTGCTACTGGCAGG - Intronic
1061265443 9:129502157-129502179 GCTGGGACTTATCCCCAGGCAGG + Intergenic
1061422759 9:130480958-130480980 GATGGGGCTGTGCCACAGTTGGG + Intronic
1061473568 9:130846761-130846783 GCTGGTGCTGTGCCAGACGCTGG - Intronic
1061532798 9:131228231-131228253 GCTGGGGCTGAACCGAATGCTGG - Exonic
1061845387 9:133385285-133385307 GGTGGGGATCAGCCACAGCCAGG - Intronic
1062025203 9:134337045-134337067 GCTGGGGCCTCTCCACAGGCAGG - Intronic
1062029758 9:134356913-134356935 GCTGAGGCTGGGAGACAGGCAGG - Intronic
1062036484 9:134384830-134384852 GCTGGCCCTGAACCACAGGAGGG - Intronic
1062267257 9:135692859-135692881 GCTGTGGCTGAAGAACAGGCGGG + Intergenic
1062637428 9:137498868-137498890 GCCTAGCCTGAGCCACAGGCAGG + Intronic
1203622316 Un_KI270749v1:136110-136132 GCTGGGGCAGGGCCAGAGCCAGG - Intergenic
1186660832 X:11665805-11665827 GCTGGGGCGGAGCCAGGAGCAGG + Intergenic
1187403722 X:18984372-18984394 GCGGGGGCAGAGCCAGGGGCGGG - Exonic
1189069375 X:37847527-37847549 CCTGGGGCGGAGCGACACGCCGG + Exonic
1190338214 X:49275860-49275882 ACTGGGGCTGATGCACAGGAAGG + Intronic
1190941057 X:55041644-55041666 GCTAGGGCTGAGCCTCTGGTGGG + Intergenic
1191722736 X:64248313-64248335 GCTGGCAGTGGGCCACAGGCAGG + Intergenic
1191979755 X:66912658-66912680 GCTAGGGGTGAGGCACTGGCAGG + Intergenic
1192369971 X:70504994-70505016 GTGTGGGCTGAGCCACAGGAAGG + Exonic
1193768512 X:85561068-85561090 CCTGGGGCTGAGCCACTAGGGGG - Intergenic
1195066180 X:101240333-101240355 GCTGAGGCTGAGGCTGAGGCTGG - Intronic
1195094907 X:101493273-101493295 GCTGGGGCTGTGGATCAGGCTGG + Exonic
1195095085 X:101494020-101494042 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
1195095088 X:101494026-101494048 GCTGGGGCTGAGGCTGGGGCTGG + Exonic
1195095092 X:101494038-101494060 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
1195095095 X:101494044-101494066 GCTGGGGCTGAGGCTGGGGCTGG + Exonic
1195095102 X:101494062-101494084 GCTGGGGCTGGGGCTGAGGCTGG + Exonic
1195095109 X:101494080-101494102 GCTGGGGCTGAGGCTGGGGCTGG + Exonic
1198989103 X:142490480-142490502 GCAGGTGCTGAGACACAGTCTGG + Intergenic
1200124442 X:153806675-153806697 GCAGCCTCTGAGCCACAGGCAGG + Intronic
1200129153 X:153831503-153831525 GCTGGGGCTGAGGAACAGGTAGG - Intergenic
1200215999 X:154368543-154368565 GCTGGGGCTGAGGAAGAGGAAGG + Intronic
1200893873 Y:8354126-8354148 TCTGTGGCTCAGGCACAGGCAGG + Intergenic
1202368630 Y:24183056-24183078 GCTGGGGCGGGGCCTCAGGGGGG - Intergenic
1202370826 Y:24194432-24194454 GCTGGGAGGGGGCCACAGGCAGG - Intergenic
1202499958 Y:25475685-25475707 GCTGGGAGGGGGCCACAGGCAGG + Intergenic
1202502155 Y:25487061-25487083 GCTGGGGCGGGGCCTCAGGGGGG + Intergenic
1202583290 Y:26403294-26403316 GCTGGGGCAGGGCCAGAGCCAGG + Intergenic