ID: 1143017142

View in Genome Browser
Species Human (GRCh38)
Location 17:3896889-3896911
Sequence GTTCACATACACAGTGTGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143017142 Original CRISPR GTTCACATACACAGTGTGGA AGG Exonic
902762567 1:18592410-18592432 GTTCACATACACACACTGTATGG - Intergenic
903942092 1:26938831-26938853 GTGCACATGCACACTGTGTATGG + Intronic
904552116 1:31327601-31327623 GGTAGCGTACACAGTGTGGATGG - Intronic
904983108 1:34523312-34523334 GGAGTCATACACAGTGTGGATGG - Intergenic
906125442 1:43424420-43424442 GATGACATACTCAGTGAGGATGG - Exonic
907693776 1:56700051-56700073 ATTTACATACACAGTTTGTATGG + Intronic
908959783 1:69682551-69682573 TTTAACATATACAGTTTGGAGGG - Intronic
910865595 1:91785579-91785601 CTTCACCTACACGGTGTGGCTGG - Intronic
915770722 1:158420160-158420182 TTGCACCTACCCAGTGTGGAAGG + Exonic
915847878 1:159287198-159287220 GTTCACAAACACACTGTAAAAGG + Intergenic
916063998 1:161121432-161121454 ACACACATACACAGGGTGGATGG - Exonic
916219040 1:162424657-162424679 GTTCCTATAAACAGTGTGCAAGG - Intergenic
917155116 1:171988839-171988861 GTTCAGATACACAAAGTAGAAGG + Intronic
918960246 1:191266196-191266218 GTTCACGCACACAGTGTCAATGG - Intergenic
920241984 1:204559298-204559320 GGTCACATACAAAATGTGAAAGG - Intergenic
920914304 1:210247721-210247743 GTTCACAAATACAGTTTGGTGGG - Intergenic
922306828 1:224351924-224351946 GTCCACTTCCACAGTGTGGAAGG - Intergenic
923109696 1:230880631-230880653 GTTCACATGGGCATTGTGGAAGG - Intergenic
1064683737 10:17837389-17837411 TTTCAAATAAACAGTGGGGAGGG - Intronic
1066303225 10:34115208-34115230 GTGCAGAGACACAGCGTGGAGGG + Intronic
1067794726 10:49312495-49312517 GTTTACAGCCACAGTGTGAATGG - Intronic
1069273169 10:66556246-66556268 ATTCCCATTAACAGTGTGGAAGG - Intronic
1071669760 10:87597527-87597549 GTAGACATAGACAGTTTGGAAGG + Intergenic
1073117469 10:101099671-101099693 ATGCACACACACAGTGAGGAAGG + Intronic
1073155855 10:101346043-101346065 TTTCTCATAGACAGTGAGGAAGG + Intergenic
1074675653 10:115847714-115847736 GTGCACATCCATAGTGTGCAAGG + Intronic
1075224519 10:120614654-120614676 TTTCACAGAGGCAGTGTGGATGG - Intergenic
1075309110 10:121396944-121396966 TTTCAAAGACACAGTATGGAAGG + Intergenic
1075708031 10:124513902-124513924 GGTCACCTACATAGAGTGGAGGG - Intronic
1076711355 10:132336884-132336906 TTTTACAGTCACAGTGTGGAAGG - Intronic
1079115532 11:17638439-17638461 GTTCTCACACACTGTGGGGAAGG - Exonic
1079244397 11:18742395-18742417 CTTCACCTACTCAGAGTGGATGG - Exonic
1080835638 11:35937898-35937920 ATTCCCACACTCAGTGTGGAAGG - Intergenic
1082028827 11:47590643-47590665 GTTCACGTACACCTTGTCGAAGG + Exonic
1083834335 11:65255319-65255341 GTTAGCACACACAGAGTGGATGG - Intergenic
1086402462 11:86472072-86472094 GTTCCCAGACAGACTGTGGATGG + Intronic
1088321076 11:108555091-108555113 GTTCACAAACACAGCTTAGATGG + Intronic
1089042982 11:115471508-115471530 ATTCACATACTCAGTGTGAAAGG - Intronic
1089246347 11:117123276-117123298 GTTCATTTACACAGTGTAGGAGG - Intergenic
1089644449 11:119869418-119869440 AGTGACAGACACAGTGTGGAAGG - Intergenic
1091027189 11:132152097-132152119 GTTCAGATTCAGAGTGGGGAGGG - Intronic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1093189547 12:16058221-16058243 GTCCCCTTCCACAGTGTGGAAGG + Intergenic
1093516688 12:19995481-19995503 GTTATCATAAACAATGTGGAAGG + Intergenic
1094431224 12:30371938-30371960 GTTTACATACAAGGTGTGTAGGG - Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1095265515 12:40152451-40152473 GTTAACATACATATTGTGGAAGG + Intergenic
1101698196 12:107146754-107146776 GGTCCCATTCACATTGTGGAGGG - Intergenic
1102893072 12:116576610-116576632 ATTCACTTACACATTGTGTAAGG - Intergenic
1105310196 13:19200016-19200038 TTTTTGATACACAGTGTGGATGG - Intergenic
1105359941 13:19701561-19701583 TTTTTGATACACAGTGTGGATGG - Intronic
1105883595 13:24624182-24624204 GTCCTCTTCCACAGTGTGGAAGG + Intergenic
1108427579 13:50319363-50319385 TTCCACAGACACAGAGTGGAGGG - Intronic
1109055466 13:57541940-57541962 ATTCCCATCCACAGTGTGCAAGG - Intergenic
1111409341 13:87854035-87854057 GTTCCCATTCAGATTGTGGAAGG - Intergenic
1112206943 13:97333833-97333855 CTTCCCCTACACAGTATGGAAGG - Intronic
1112306228 13:98276836-98276858 GGTCACACACCCAGTGTGGGTGG - Intronic
1113579454 13:111418747-111418769 GTCCACATAGACAATCTGGATGG - Intergenic
1113726146 13:112603809-112603831 GCTAACATACACAGAGTGAAAGG + Intergenic
1114047018 14:18884039-18884061 ATTCACAGAAACAGAGTGGAAGG - Intergenic
1114117196 14:19635370-19635392 ATTCACAGAAACAGAGTGGAAGG + Intergenic
1114424814 14:22612568-22612590 GTCGAGATCCACAGTGTGGATGG + Exonic
1114576377 14:23717912-23717934 ATTCAAATACACAGTGTGACAGG + Intergenic
1117604690 14:57415808-57415830 GTTTACAGCCACAGTTTGGAGGG - Exonic
1118905750 14:70022013-70022035 ATTCACATCCTCAGTGTGCAGGG - Intronic
1119548720 14:75492765-75492787 TTTCTCATACACAGTATGTAAGG - Intergenic
1123174446 14:106403040-106403062 GTCCACACACACACTTTGGAAGG - Intergenic
1123183137 14:106488579-106488601 GCTCACATACCCCATGTGGAGGG - Intergenic
1202944242 14_KI270726v1_random:12744-12766 GTCCACACACACACTTTGGAAGG + Intergenic
1123475384 15:20588216-20588238 CTTCACTTACACAGAGTGGAAGG + Intergenic
1123642627 15:22412149-22412171 CTTCACTTACACAGAGTGGAAGG - Intergenic
1131023084 15:89116274-89116296 GTTTACAAGCACAGTGAGGACGG - Intronic
1137519672 16:49181543-49181565 GTTCACATACACACGGTGTCAGG + Intergenic
1137945810 16:52732197-52732219 GTCCCCTTCCACAGTGTGGAAGG + Intergenic
1139454609 16:67063183-67063205 TTTTAAATGCACAGTGTGGAAGG + Intronic
1141318700 16:82986375-82986397 TTTTATATACACAGTGTGCATGG - Intronic
1142146667 16:88495692-88495714 CTTCACACACACAGAGTGGTGGG - Intronic
1143017142 17:3896889-3896911 GTTCACATACACAGTGTGGAAGG + Exonic
1144769825 17:17753217-17753239 GGTCACAGACACAGGCTGGAGGG + Intronic
1147121050 17:38335280-38335302 GTTAGAATACACAGGGTGGATGG + Intronic
1152213127 17:79014215-79014237 TTTTACATGCACAGTGTGTAAGG + Intergenic
1153766006 18:8375874-8375896 GATCTCACACACAATGTGGAAGG - Intronic
1155646905 18:28089812-28089834 GTTCACATACCCAGGGTAGCAGG - Intronic
1158489092 18:57894052-57894074 TTTCCCATACACAGTGTAAAAGG + Intergenic
1163118666 19:15202767-15202789 GCACACACACCCAGTGTGGAGGG + Intergenic
1163396235 19:17063669-17063691 GTGCCCATACACACTGGGGAGGG - Intronic
1164009756 19:21190439-21190461 GTTCACACCAACAGTGTGCAAGG + Exonic
1165844255 19:38808191-38808213 GTTGACATAAAAAGTGGGGATGG + Intronic
1168673607 19:58260161-58260183 GTTCACATTCACAGAGTCCAGGG + Intronic
926468889 2:13227951-13227973 GGTCACAGAAACAGTTTGGAAGG + Intergenic
929531837 2:42757487-42757509 CTTCACAAACACAGGCTGGAGGG - Intergenic
931216433 2:60249197-60249219 GTAAACATACAAAGTGTGCATGG + Intergenic
933436694 2:82258244-82258266 GTTTACATACAAGGTGTAGAGGG - Intergenic
940440532 2:153710558-153710580 GTTAATATACACAGTTTGGATGG - Intergenic
942204137 2:173602282-173602304 GTTCAAATAGAAAGTGTGGCCGG - Intergenic
942513033 2:176722960-176722982 GTTCAAACACACTGTGGGGAAGG - Intergenic
942859506 2:180592106-180592128 GTACACATACACAGTGGCCATGG - Intergenic
943536075 2:189152436-189152458 TTTCACATACATTGTGTGTATGG - Intronic
945097856 2:206236755-206236777 GTTTAGGTACACAGTATGGAAGG - Intergenic
945359260 2:208876919-208876941 GAACACTTACACAGTGTTGATGG - Intergenic
946054122 2:216886053-216886075 GTTCTCTTCCACACTGTGGAGGG + Intergenic
946842275 2:223830622-223830644 TTTGATATACCCAGTGTGGAAGG + Intronic
948730325 2:239959434-239959456 CTTCACAAACCCATTGTGGAGGG - Exonic
1169849328 20:10032524-10032546 GTTCCCTTCCACACTGTGGAAGG + Intronic
1170806687 20:19638983-19639005 GTCCCCTTCCACAGTGTGGAAGG - Intronic
1173270718 20:41532524-41532546 GTTAACATGCACAGGGTGTAAGG - Intronic
1173460282 20:43237780-43237802 GTTCACATAGAAAATGTGAATGG - Intergenic
1176054925 20:63140124-63140146 GTTCACAAACTCATCGTGGAGGG + Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1177998932 21:28135968-28135990 TGACACGTACACAGTGTGGAAGG - Intergenic
1179873304 21:44254619-44254641 TGTCACAGACACAGTGAGGAAGG - Exonic
1180465552 22:15606690-15606712 ATTCACAGAAACAGAGTGGAAGG - Intergenic
1181046542 22:20217302-20217324 GGGCACATACACAGTGGGGCGGG + Intergenic
1181442362 22:22943245-22943267 TGTCACATACACAGGGTGCACGG + Intergenic
1181493181 22:23273546-23273568 GTGCAGACACAAAGTGTGGACGG - Intronic
950574209 3:13821628-13821650 ACTCAGAAACACAGTGTGGAGGG + Intronic
950803871 3:15579920-15579942 CTGCACCTACACAGTATGGATGG + Exonic
950990424 3:17432171-17432193 GTCAACATACACAGTCTGGGTGG + Intronic
953168468 3:40486287-40486309 GATGACAAAAACAGTGTGGATGG - Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963397372 3:144750814-144750836 GTTCCCTTCCACAGTGTGGAAGG + Intergenic
964735271 3:159911044-159911066 CTTCACATGCACAGTATGAATGG + Intergenic
965332763 3:167397329-167397351 CCTCACATACACTGTATGGATGG + Intergenic
965963834 3:174461820-174461842 ATACACACACACAGTGTGGGAGG - Intronic
966778522 3:183563737-183563759 TTTCACATAGTCAGTGTAGATGG + Intergenic
968722990 4:2221477-2221499 TTTTACATAAACAGTGGGGAGGG - Intronic
968893333 4:3384523-3384545 GCTGACATACACATTTTGGAAGG - Intronic
971529444 4:27666785-27666807 GCTCACATGCTCAGTGTTGAAGG - Intergenic
972163638 4:36256276-36256298 GTTCAGAAGCACAGTTTGGAAGG - Intergenic
973558261 4:52108010-52108032 GTTCAAATCCACAGTGTTCAAGG - Intergenic
973814019 4:54602077-54602099 GTTTACATACAAGGTGTGTAAGG - Intergenic
974167872 4:58227363-58227385 GTCAACATACACATTTTGGATGG - Intergenic
974356870 4:60824185-60824207 TTCCACATACTCAGTGGGGAGGG - Intergenic
974590446 4:63942398-63942420 GTTCCCTTCCACAATGTGGAAGG - Intergenic
975856400 4:78629501-78629523 GTTTACATACAGGGTGGGGAAGG + Intergenic
976585230 4:86789899-86789921 GCTTCCACACACAGTGTGGAAGG + Intronic
976588193 4:86822449-86822471 GTTTACATACACAGCTTAGAAGG + Intergenic
982562558 4:156947999-156948021 GTCTACACACACACTGTGGATGG + Intronic
983522498 4:168724768-168724790 CTTCACATACAGAGGTTGGAAGG - Intronic
984069432 4:175093081-175093103 GTCCCCTTCCACAGTGTGGAAGG + Intergenic
984958977 4:185075636-185075658 GTCCACACACACACTTTGGAAGG + Intergenic
986133628 5:4953812-4953834 GCACACATAGACAGTGTGGAGGG - Intergenic
987579996 5:19777523-19777545 CTTCACAAGCACAGTGTGGCCGG - Intronic
988291619 5:29295863-29295885 GTCCACTTCCATAGTGTGGAAGG - Intergenic
993005822 5:82426998-82427020 GTTGACATCAACAGTGTGCAGGG + Intergenic
994954566 5:106511213-106511235 GTTCCCTTCCACCGTGTGGAGGG + Intergenic
996072064 5:119142566-119142588 GAACACTTACACAGTGTTGATGG + Intronic
997257102 5:132437607-132437629 GGTTACATAAACAGTTTGGATGG + Intronic
997760717 5:136445238-136445260 CTACACTTCCACAGTGTGGAAGG - Intergenic
1001239239 5:170055703-170055725 GTCCACAGACAGAGTGTGGCTGG + Intronic
1001673407 5:173492754-173492776 GTTCACATGCACACAGAGGAAGG - Intergenic
1002645388 5:180650213-180650235 GTTTACCTGCACAGTGTCGACGG + Intergenic
1002879449 6:1238295-1238317 GTTCACTTCCCCAGTGTGAATGG - Intergenic
1008696130 6:54040445-54040467 GAACACTTACACAGTGTTGATGG + Intronic
1010781359 6:79948606-79948628 ATTCACATTAACAGTGTGAAAGG - Intergenic
1011837424 6:91450589-91450611 GATCACATACACAGTCCAGAAGG + Intergenic
1017733553 6:157339655-157339677 GTTCAAATGCCCAGAGTGGAGGG + Intergenic
1019542549 7:1558101-1558123 AGTCACACACACAGTGAGGAGGG - Intronic
1020570114 7:9850403-9850425 GTTGAGATACACAATGTGGTCGG + Intergenic
1021398383 7:20179855-20179877 TTTCACACACAAAGTGTGGTAGG + Intronic
1022563693 7:31375378-31375400 GTTCAAATACGCAATTTGGAAGG - Intergenic
1025586213 7:62791318-62791340 GTTTTCATACAAAGTGTGAAGGG + Intergenic
1027211163 7:76150091-76150113 GTTCCGAAAGACAGTGTGGAAGG + Intergenic
1029035847 7:97520631-97520653 GTTTACAAACACATTTTGGAAGG - Intergenic
1032877801 7:136056472-136056494 GTTCAGATACACAGAGAGAATGG - Intergenic
1033308990 7:140245913-140245935 GATCAGATACAAAGAGTGGAGGG - Intergenic
1033451056 7:141462775-141462797 TTTCACACTCACAGTGTGAAGGG + Intronic
1034555211 7:151845908-151845930 TTTCACACACACAGTGTGTATGG + Intronic
1037065152 8:14567628-14567650 GTCCCCTTCCACAGTGTGGAGGG + Intronic
1038553780 8:28492148-28492170 GTGAACACAGACAGTGTGGATGG - Intergenic
1044007349 8:86954619-86954641 ATTTACATACAAAGTGTGTAAGG - Intronic
1044032778 8:87259040-87259062 GTTTACATACAAGGTGTGTAAGG - Intronic
1044043419 8:87399306-87399328 GTGCACATGCACAGTGTCCAAGG - Intronic
1050346818 9:4697139-4697161 CTTCACATACAAGGTATGGATGG - Exonic
1054741447 9:68810138-68810160 GTTAACATACACAGCCTGAATGG + Intronic
1054806491 9:69400873-69400895 GCTCACTTATGCAGTGTGGATGG + Intergenic
1055291735 9:74788694-74788716 GTTCACTTACACCGTGTTGGTGG - Exonic
1061255348 9:129451949-129451971 ATTCAGAGACGCAGTGTGGACGG + Intergenic
1186579106 X:10798113-10798135 GGTCACAGACACAGTTTGCAAGG - Intronic
1187107740 X:16261478-16261500 GTTCATATTCACATTCTGGAAGG + Intergenic
1189128233 X:38471095-38471117 GTACACTTACACAGTGTAGGTGG + Intronic
1189131391 X:38501486-38501508 GTTCACTTACACACTGTTGGTGG + Intronic
1192319213 X:70076001-70076023 TTTCACATTCACAGTGAAGATGG - Intergenic
1194481836 X:94436255-94436277 CTTCAAAGACACAGTGTTGAAGG + Intergenic
1198812506 X:140549841-140549863 ATTCACATACAGAGTGTAGTTGG - Intergenic
1200955469 Y:8939434-8939456 GTCCACTTCCACACTGTGGAAGG + Intergenic
1201264664 Y:12194187-12194209 GTTCCAATCCCCAGTGTGGAAGG + Intergenic