ID: 1143017965

View in Genome Browser
Species Human (GRCh38)
Location 17:3901520-3901542
Sequence TACCCAAGTCAGCTGTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143017965_1143017974 28 Left 1143017965 17:3901520-3901542 CCCTTCCACAGCTGACTTGGGTA 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1143017974 17:3901571-3901593 AGCTGAAAATAGTTACTATCTGG 0: 1
1: 27
2: 199
3: 661
4: 1575
1143017965_1143017970 2 Left 1143017965 17:3901520-3901542 CCCTTCCACAGCTGACTTGGGTA 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1143017970 17:3901545-3901567 TGGCACGGAGCCCATATAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143017965 Original CRISPR TACCCAAGTCAGCTGTGGAA GGG (reversed) Intronic
909448582 1:75774120-75774142 TACCCAAGTCGAATTTGGAAGGG + Intronic
913026083 1:114842078-114842100 TACCTAAGTCAGATTGGGAAAGG + Intergenic
914384412 1:147153998-147154020 TACCCAAATCACCTGTGTCATGG + Intergenic
923230845 1:231984800-231984822 TGGCCAAGACAGCTGAGGAAAGG + Intronic
924183542 1:241463750-241463772 TCCCCAAGTCACATGGGGAAGGG - Intergenic
1063951299 10:11225785-11225807 TACCCATGTTAGCTGAGGACAGG - Intronic
1064931429 10:20632539-20632561 TACCCAAGTTTGTTGTGGAGTGG + Intergenic
1067290596 10:44936800-44936822 TTCCCCTGTCAACTGTGGAAGGG + Exonic
1070014049 10:72506939-72506961 TCCCAAAGTCAGCTGTGGCAAGG + Intronic
1070144479 10:73763899-73763921 TAGCCATGTCAGATGTGCAAGGG - Exonic
1070696742 10:78569505-78569527 AACTCATGTCTGCTGTGGAATGG - Intergenic
1075333615 10:121593413-121593435 TGCCCGAGAGAGCTGTGGAAGGG - Intronic
1077866849 11:6229511-6229533 TACCTCAGTCAGCTGAAGAAAGG + Intronic
1078828646 11:14956326-14956348 TACTCAAGTAGGCTGTGGAGAGG - Intronic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1083144531 11:60748686-60748708 TACCCCACTCACCTGTGCAATGG - Intergenic
1084744951 11:71164113-71164135 GACCCAAGTCAACTGTGGGGAGG - Intronic
1085351089 11:75798218-75798240 GAACCAGGTCAGCTCTGGAAGGG - Exonic
1086051983 11:82603165-82603187 CACAGAAGTCAACTGTGGAAAGG - Intergenic
1091981117 12:4864855-4864877 TCTCCAAGTCAGCTGTGGCCTGG - Intergenic
1092603112 12:10088800-10088822 TACCCTAGTCTTTTGTGGAATGG + Intronic
1093095971 12:14972857-14972879 AACCCAAGTCAGTTTTGAAAGGG + Intergenic
1093489657 12:19689980-19690002 CACCTGAGTAAGCTGTGGAACGG - Intronic
1098660974 12:73093765-73093787 CACCCAAGTCACCTCTTGAATGG - Intergenic
1101682145 12:106979677-106979699 AAATCAGGTCAGCTGTGGAATGG + Intronic
1102194110 12:111012140-111012162 TACCCAAGTTACATGTTGAATGG + Intergenic
1103478937 12:121238525-121238547 CACCAAAGAAAGCTGTGGAAAGG - Exonic
1104100134 12:125599782-125599804 TTCAGAATTCAGCTGTGGAAGGG + Intronic
1105357702 13:19674125-19674147 TACCCAAGTAGACAGTGGAAAGG - Intergenic
1107239585 13:38215910-38215932 TACTCAAAACTGCTGTGGAATGG + Intergenic
1107613170 13:42136845-42136867 TACTCACATCTGCTGTGGAAAGG - Intronic
1107635779 13:42390813-42390835 TACCTAAGGCAGCTCTGGGATGG - Intergenic
1107923377 13:45233440-45233462 TACCTAACTCAGTTGTTGAATGG + Intronic
1108092017 13:46858844-46858866 TACCCATCTCAGAGGTGGAATGG + Intronic
1108124026 13:47221133-47221155 TTACCAAGTGAGGTGTGGAAGGG - Intergenic
1108192059 13:47951750-47951772 TGGCCAGGTCAGCTTTGGAAAGG - Intronic
1109513721 13:63413596-63413618 TCCCCAAGTCACTGGTGGAAAGG + Intergenic
1110274926 13:73632564-73632586 AACCCATGCCAGCTTTGGAAAGG - Intergenic
1111313318 13:86517763-86517785 CACCCAAGTCATCTTTTGAATGG + Intergenic
1113029950 13:105982360-105982382 TACCCCAGTCAGCTGCAGCAGGG - Intergenic
1115420394 14:33187256-33187278 AAGCCAATACAGCTGTGGAATGG - Intronic
1115609217 14:35035521-35035543 CACCCAAGTCACCTCTTGAATGG + Intergenic
1115962798 14:38854469-38854491 TTCCCAAGCCAGCTCTGGAGGGG + Intergenic
1117313509 14:54551784-54551806 TACTCAAGTCAGCTTAAGAACGG + Intergenic
1117488166 14:56219819-56219841 GCCTCAAGTCCGCTGTGGAATGG - Intronic
1119516585 14:75253152-75253174 CTCCCAAGTCAACTTTGGAAAGG - Intronic
1126630212 15:50727082-50727104 TAGCCAAGTCTGTTGTGGAGAGG + Intronic
1129252695 15:74317741-74317763 AACCCAGTTCAGCTGGGGAAAGG + Intronic
1129526070 15:76215407-76215429 TTCACTAGTCAGCTGGGGAAGGG + Exonic
1131311366 15:91293506-91293528 TTCACAAGTCATCTGTGTAAGGG - Exonic
1133809357 16:9149233-9149255 TCCCCAAGTGAGCTGTGAAGTGG + Intergenic
1135705276 16:24669709-24669731 TACACAATTCAGCTGAGGACAGG - Intergenic
1135863139 16:26075664-26075686 TACCCCAGCCAGCTGAGAAAAGG - Intronic
1140022159 16:71248756-71248778 TTCCCCAGTGAGCTCTGGAATGG - Intergenic
1143017965 17:3901520-3901542 TACCCAAGTCAGCTGTGGAAGGG - Intronic
1144398694 17:14872563-14872585 AACTCAAGTCAGCTAAGGAAAGG - Intergenic
1144493629 17:15734078-15734100 TACACATCTCACCTGTGGAATGG - Intronic
1144906636 17:18642574-18642596 TACACATCTCACCTGTGGAATGG + Intronic
1147386881 17:40088231-40088253 TTCGCAAGGCAGCTGTGGAGCGG - Exonic
1150314967 17:64161185-64161207 TGCACAAGTCAGCATTGGAAGGG + Intronic
1153136844 18:1927086-1927108 CACCCAAGTCACCTTTTGAATGG - Intergenic
1153223344 18:2880503-2880525 TACCCAAGGCACCTGTGGACGGG + Intronic
1155132535 18:22952683-22952705 TTCCCAGGTCAGCAATGGAAAGG + Intronic
1160359438 18:78259117-78259139 TACCCTATGCAGCTGTGGACGGG + Intergenic
1160389150 18:78517492-78517514 TACTCAGGTGAGCTGTGGCATGG + Intergenic
1160481006 18:79239464-79239486 CAGCCAAGTCTGCTGTGGCAGGG + Intronic
1161882814 19:6968759-6968781 TGCTCAAGGCAGCAGTGGAAAGG - Intergenic
1165642655 19:37403287-37403309 CACCGAAGTCAGAGGTGGAAAGG - Intergenic
1166853955 19:45773193-45773215 CACCCCACTCAGCTGTGGGAAGG + Intronic
925063562 2:911965-911987 CACCGAAGGCCGCTGTGGAAGGG + Intergenic
925190883 2:1882370-1882392 GAGCCAAGTCAGCTGCCGAATGG + Intronic
926268707 2:11348328-11348350 ATCCCAAATTAGCTGTGGAAGGG + Intronic
927638177 2:24831065-24831087 TCACCACGTCTGCTGTGGAAAGG - Intronic
928184731 2:29100223-29100245 TACCAAAGTCAGTTGTGGCCAGG - Intronic
934583573 2:95467951-95467973 AACACCAGCCAGCTGTGGAAAGG - Intergenic
934595879 2:95608763-95608785 AACACCAGCCAGCTGTGGAAAGG + Intergenic
934706335 2:96484254-96484276 TGCCCATGGCAGCTGTAGAAAGG - Intergenic
936683675 2:114803724-114803746 TACCCAAGTCACCTCTTGAATGG - Intronic
937779424 2:125820285-125820307 TACCCAAGGCAGCAGAGGAGGGG + Intergenic
939632056 2:144537303-144537325 GACCCCAGTCAGCTGTGGAGGGG + Intergenic
941570338 2:167161905-167161927 CACCCAAGTCACCTCTTGAATGG + Intronic
941945826 2:171096202-171096224 TACAAAAATCAGTTGTGGAAGGG + Intronic
944664055 2:201945088-201945110 TACAAAAGTCAGCTTGGGAAGGG - Intergenic
944828075 2:203504771-203504793 CACCCAAGTCACCTTTTGAATGG + Intronic
948588544 2:239035855-239035877 TCCCCAGGCCAGCTGTGGGAGGG + Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170019752 20:11823829-11823851 CACCCAACTCAGCTGAGAAAAGG - Intergenic
1170639439 20:18138407-18138429 GGCCCAAGTGAGATGTGGAAAGG - Intronic
1172780026 20:37431087-37431109 TACCAAAGACAGCTGAGGATTGG - Intergenic
1174205613 20:48836186-48836208 TACCCAAGTCAGATGTTGAGTGG + Intergenic
1179010459 21:37552314-37552336 AAGCCAAGTCAGGTGTGGACAGG - Intergenic
1179710062 21:43208154-43208176 GTCCCAGTTCAGCTGTGGAAAGG + Intergenic
1182085622 22:27559241-27559263 TAACCCAGTCACCTGTTGAAGGG - Intergenic
1185233634 22:49698877-49698899 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233642 22:49698904-49698926 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233650 22:49698931-49698953 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233658 22:49698958-49698980 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233666 22:49698985-49699007 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233674 22:49699012-49699034 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185233682 22:49699039-49699061 AACCCCAGGCAGCTGTGGAGAGG + Intergenic
1185233920 22:49700118-49700140 AACCCTAGGCAGCTGTGGACAGG + Intergenic
1185233927 22:49700145-49700167 AACCCCAGGCAGCTGTGGACAGG + Intergenic
1185302843 22:50091606-50091628 TACCCAAGAGAGCTGCTGAAGGG - Intronic
1185334328 22:50264876-50264898 AAACCAGGCCAGCTGTGGAAGGG + Exonic
951066066 3:18267026-18267048 TGCAGAAGTCAGCTGTGAAAAGG + Intronic
951244724 3:20327625-20327647 TATCTAAGTCACCTGGGGAAAGG - Intergenic
952653754 3:35758757-35758779 AAACCAGTTCAGCTGTGGAATGG + Intronic
956045965 3:65196172-65196194 AACCCAAGTCAGAGGAGGAAAGG - Intergenic
956632296 3:71328636-71328658 TACCCTGGTCAGCTGTAGAAAGG - Intronic
959758120 3:109924256-109924278 CACTCAAGGCAGCTATGGAAGGG + Intergenic
967084733 3:186084168-186084190 TTAGCAAGTCAGCTGTGCAAAGG - Intronic
968611699 4:1560090-1560112 CACCCAAGACAGATGTGGAGGGG - Intergenic
970561221 4:17284020-17284042 GAGCCAAGTCTGCTGTGGGAAGG - Intergenic
970610542 4:17721447-17721469 TACCCAAGTTGGGTTTGGAAAGG + Intronic
970999208 4:22303552-22303574 CACCCAAGTCACCTCTTGAATGG - Intergenic
977568810 4:98609461-98609483 CACCCAAGTCAGGTGTGTACAGG + Intronic
980890370 4:138808403-138808425 TAGCCAAGTCACTTGTGGAGAGG - Intergenic
981231287 4:142358795-142358817 TTCCCAAGCCAGCTGCTGAAGGG - Intronic
983957122 4:173710727-173710749 TAACTAAGACAGCTGTGGAAGGG + Intergenic
988725591 5:33923175-33923197 AACCAAAGTCAGCTGTGCATGGG - Intergenic
989522555 5:42418737-42418759 CACCCAAGGCAGTTGTGGGATGG + Intergenic
989651673 5:43697159-43697181 CACCCACGTCAGCTCTTGAATGG + Intronic
991586944 5:68211266-68211288 CACCCAAGTCACCTCTTGAATGG + Intergenic
992010035 5:72516757-72516779 TACCCAAGTAATCTATGGAGAGG + Intergenic
992315483 5:75548979-75549001 TACCGAAATCTTCTGTGGAATGG + Intronic
993682195 5:90893417-90893439 TACCCTAGTCTACTGTGGGAGGG + Intronic
995369070 5:111398303-111398325 TAGTCCAGTCAGCTGTGGATGGG + Intronic
996827389 5:127700685-127700707 TTCCCAGGTCAGCTTTGGGAAGG + Intergenic
997653922 5:135541782-135541804 GACCCATGACAGTTGTGGAAGGG + Intergenic
1000212491 5:159120098-159120120 TGCCCAAGCCAGCAGTGGCAAGG + Intergenic
1002495917 5:179611322-179611344 TTCCCAAGTCAACTGAGGTAGGG + Intergenic
1002976770 6:2086547-2086569 TCCCCGAGTCAGCTGCAGAACGG - Intronic
1005958626 6:30681452-30681474 TACTCATGTCTGCTGTTGAAAGG + Intronic
1006590728 6:35154121-35154143 AACCCAAGTAAGCAGAGGAAAGG - Intergenic
1006861597 6:37175065-37175087 TCCCCAAGTCAGAGGAGGAAAGG - Exonic
1006926303 6:37657365-37657387 TATCCCAGTAGGCTGTGGAAGGG - Intronic
1008809560 6:55479219-55479241 TTCCCATGACAGATGTGGAAAGG - Intronic
1009808038 6:68627785-68627807 TATCCAAGTTACCTGTGGAGGGG + Intergenic
1014951700 6:127563266-127563288 AACCCAAGTCACCTCTTGAATGG - Intronic
1017764401 6:157594800-157594822 TCCCCAAGATAGGTGTGGAATGG - Intronic
1018239428 6:161758378-161758400 TACACAATTCAGCAGTAGAAAGG + Intronic
1018525009 6:164700513-164700535 TGCCTAAGTCAGCTGTGGGGTGG + Intergenic
1020936539 7:14472905-14472927 CACCCAAGTCACCTCTTGAATGG - Intronic
1021679388 7:23114713-23114735 TACCCAAGAAAGCTTTGAAATGG + Intronic
1025105076 7:56163881-56163903 TTCCCAAGGCAGCAGGGGAAAGG + Intergenic
1028301553 7:89206805-89206827 CACCCAAGTCAGCTTTTGAATGG + Intronic
1037210076 8:16375740-16375762 GACCCAAGTCTGGTCTGGAATGG - Intronic
1038282649 8:26180003-26180025 AACCCAAGTAAGCTGTGGTATGG + Intergenic
1038479701 8:27893313-27893335 TAAGCAAGGCAGCTCTGGAATGG + Intronic
1039769107 8:40664875-40664897 TACCCAAGTTACCTGTGCATGGG - Intronic
1041062820 8:54052643-54052665 CAACCAAGTTACCTGTGGAAAGG + Exonic
1045895677 8:107213491-107213513 TGGCCAAGTCAGCTATGAAAGGG - Intergenic
1051428677 9:16960319-16960341 TGCCCAAGTCAGCTGACAAATGG - Intergenic
1055453897 9:76455456-76455478 TACCTAAGTCATTTGGGGAAAGG + Intronic
1056061987 9:82892970-82892992 TATCCAAGTCATATGGGGAAGGG + Intergenic
1059909121 9:119022793-119022815 TCCACAAGTCAGCTGAGGAGAGG + Intergenic
1062211977 9:135369945-135369967 TAAGCAAGGAAGCTGTGGAAGGG + Intergenic
1185882192 X:3751303-3751325 CACCCAAGTCGGCTGTTGAATGG + Intergenic
1189144368 X:38640611-38640633 TAATCAAGTCAGCTTTGGCAAGG - Intronic
1198818196 X:140615199-140615221 AACCCAAGGCAGCGGTGGCATGG - Intergenic
1199431577 X:147766987-147767009 TAGCCAATTCACCTGTAGAATGG + Intergenic
1199760722 X:150902259-150902281 GATCAAAATCAGCTGTGGAAGGG + Intergenic
1200782779 Y:7231908-7231930 CACCCAAGTCTGCTGTTGAATGG - Intergenic