ID: 1143018639

View in Genome Browser
Species Human (GRCh38)
Location 17:3904882-3904904
Sequence CTTCGGGGTCACGATGAAAT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143018633_1143018639 7 Left 1143018633 17:3904852-3904874 CCTCACCTCTGCGCAGTAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 117
Right 1143018639 17:3904882-3904904 CTTCGGGGTCACGATGAAATTGG 0: 1
1: 0
2: 0
3: 1
4: 28
1143018634_1143018639 2 Left 1143018634 17:3904857-3904879 CCTCTGCGCAGTAGCCTTGAGTC 0: 1
1: 0
2: 0
3: 3
4: 65
Right 1143018639 17:3904882-3904904 CTTCGGGGTCACGATGAAATTGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143018639 Original CRISPR CTTCGGGGTCACGATGAAAT TGG Exonic
900949036 1:5847281-5847303 ATTCTGGGTCACGAGGAAAGGGG - Intergenic
921460884 1:215425327-215425349 CCTCTGGGTCACGGTGACATAGG + Intergenic
1063504929 10:6589193-6589215 CTTTGGGGTGATGATGAACTGGG - Intergenic
1070535421 10:77373839-77373861 CTTCAGGGTCAAGCTGAAAGTGG - Intronic
1074329243 10:112487510-112487532 CTTGGGGGTCAGGAAGAACTGGG - Intronic
1092869796 12:12795976-12795998 CTTTGGGGTCAAGTTGAATTTGG + Intronic
1095764793 12:45882305-45882327 CTTCTGGGTCATGGTGAAGTAGG - Intronic
1096776106 12:53965390-53965412 CTTGGGGATGACAATGAAATTGG - Intergenic
1112075786 13:95911740-95911762 CTTTGGTGTCAGGATGATATTGG - Intronic
1121356988 14:93223749-93223771 CTTCAGGATCTCGATGGAATGGG + Intronic
1130008848 15:80130780-80130802 GTTCGGGGTCAGAATGACATAGG - Intronic
1143018639 17:3904882-3904904 CTTCGGGGTCACGATGAAATTGG + Exonic
1146933333 17:36793488-36793510 CCACTGGGTCACGGTGAAATGGG + Intergenic
1152387902 17:79986164-79986186 CTTTGGGACCACGAGGAAATTGG - Intronic
1159712224 18:71774794-71774816 CTTTGGAAACACGATGAAATTGG - Intronic
1160314067 18:77823868-77823890 CTTCGGTGACACAATGAAGTAGG + Intergenic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
1175338701 20:58213870-58213892 CCTCGGGGTCACGCTGACAAGGG + Intergenic
1183343279 22:37293805-37293827 CTGCAGGGTCAAGATGAAATGGG + Intronic
1185046807 22:48532688-48532710 CTTCCAGGTCACCATGAAAGGGG + Intronic
950762066 3:15239801-15239823 CTTTGGGGTCAGAATAAAATGGG - Intronic
975332759 4:73137070-73137092 CTTCGGGGTACCTATAAAATTGG + Intronic
979582848 4:122380040-122380062 CCTAGAGGTCACGATAAAATTGG - Exonic
986585277 5:9309956-9309978 CTTCTGGGTCAAGATCAACTGGG + Intronic
1001193121 5:169648733-169648755 CTGCAGATTCACGATGAAATGGG + Intronic
1042940331 8:74100786-74100808 TTTCCGGGTCACCATGAATTTGG - Intergenic
1044932449 8:97262858-97262880 CTTCTGGGTCAACATGCAATTGG - Intergenic
1189827577 X:44935389-44935411 CTTCAGAGTCTTGATGAAATAGG + Intronic
1191628631 X:63297232-63297254 CTTTGGTGTCAGGATGATATTGG - Intergenic
1193260511 X:79401325-79401347 CTTCTGGGTCAGGATGCAAATGG + Intergenic