ID: 1143019195

View in Genome Browser
Species Human (GRCh38)
Location 17:3907858-3907880
Sequence CAGAAGGAGCTGATGCAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 470}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143019176_1143019195 26 Left 1143019176 17:3907809-3907831 CCTCCTTGGGCCCCTTCCTCCAG 0: 1
1: 0
2: 7
3: 53
4: 495
Right 1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG 0: 1
1: 1
2: 2
3: 51
4: 470
1143019182_1143019195 15 Left 1143019182 17:3907820-3907842 CCCTTCCTCCAGGAGGGCCTCTG 0: 1
1: 1
2: 3
3: 52
4: 429
Right 1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG 0: 1
1: 1
2: 2
3: 51
4: 470
1143019186_1143019195 7 Left 1143019186 17:3907828-3907850 CCAGGAGGGCCTCTGGTTCTGTG 0: 1
1: 0
2: 3
3: 21
4: 280
Right 1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG 0: 1
1: 1
2: 2
3: 51
4: 470
1143019178_1143019195 23 Left 1143019178 17:3907812-3907834 CCTTGGGCCCCTTCCTCCAGGAG 0: 1
1: 0
2: 4
3: 61
4: 436
Right 1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG 0: 1
1: 1
2: 2
3: 51
4: 470
1143019187_1143019195 -2 Left 1143019187 17:3907837-3907859 CCTCTGGTTCTGTGTCCAAGCCA 0: 1
1: 0
2: 0
3: 16
4: 230
Right 1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG 0: 1
1: 1
2: 2
3: 51
4: 470
1143019185_1143019195 10 Left 1143019185 17:3907825-3907847 CCTCCAGGAGGGCCTCTGGTTCT 0: 1
1: 0
2: 0
3: 27
4: 191
Right 1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG 0: 1
1: 1
2: 2
3: 51
4: 470
1143019181_1143019195 16 Left 1143019181 17:3907819-3907841 CCCCTTCCTCCAGGAGGGCCTCT 0: 1
1: 0
2: 14
3: 133
4: 792
Right 1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG 0: 1
1: 1
2: 2
3: 51
4: 470
1143019183_1143019195 14 Left 1143019183 17:3907821-3907843 CCTTCCTCCAGGAGGGCCTCTGG 0: 1
1: 2
2: 7
3: 75
4: 436
Right 1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG 0: 1
1: 1
2: 2
3: 51
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143019195 Original CRISPR CAGAAGGAGCTGATGCAGGG GGG Intronic
900111186 1:1006271-1006293 CAGCAGGACCTGAGACAGGGCGG - Intergenic
900151342 1:1180475-1180497 CAGTAGGAGCTGATGCTGCGAGG - Exonic
900982395 1:6053638-6053660 CACAAGGCGATGATGCAGGAGGG + Intronic
901467755 1:9433608-9433630 AAGAAGTAGCTGGAGCAGGGAGG + Intergenic
901542086 1:9924927-9924949 CAGCAGGAGGTTTTGCAGGGGGG + Intronic
903171446 1:21556999-21557021 CCACAGGAGCTGATGCAGAGAGG - Intronic
903485850 1:23688944-23688966 CAGACGGGGCGGATGCTGGGCGG - Intergenic
903773776 1:25780331-25780353 CAGAGGGAGCTGAGGAAGGAGGG - Intronic
904324619 1:29720275-29720297 CAGAGGCAGCAGGTGCAGGGAGG - Intergenic
905041994 1:34967808-34967830 CAGACGGAGCGGCTGCAGGGCGG + Intergenic
905460668 1:38120846-38120868 CTGAAGGGGGTGATGGAGGGAGG - Intergenic
905528427 1:38656945-38656967 GAGAAGGAGCAGATGCTGGCAGG + Intergenic
905861505 1:41355118-41355140 CAGAAGTGGCTGACGGAGGGAGG - Intergenic
906136145 1:43502001-43502023 CAGACGGGGCGGATGCTGGGAGG - Intergenic
906427200 1:45724775-45724797 CAGAAGGGGCGGCTGCCGGGCGG - Intronic
906714434 1:47956382-47956404 GAGCATGAGCTGAAGCAGGGCGG + Intronic
907140561 1:52181839-52181861 CAGACGGGGCGGCTGCAGGGCGG - Intronic
910412059 1:86956551-86956573 CAGAAGGAACTGATGGTGAGAGG + Intronic
910891642 1:92026085-92026107 CAGAGGGAGCAGCTGCCGGGCGG + Intergenic
911039649 1:93581909-93581931 CTGATGGAGCTGAGGCAAGGGGG + Intronic
911700826 1:100949985-100950007 GAGAGCGAGCTGAAGCAGGGTGG - Intronic
912120600 1:106467473-106467495 CAGAAGGTGATGATCCATGGTGG - Intergenic
912189334 1:107319245-107319267 CAGAAGGACTTGAGGCAAGGAGG + Intronic
912451280 1:109769148-109769170 CACAAGCAGCTGCTGCAGAGAGG + Intronic
913159543 1:116132770-116132792 CAGAAGAGGCAGAAGCAGGGAGG + Intronic
913161148 1:116147135-116147157 CAGAAGGAGCTGAAGAAGCAGGG - Intergenic
913428409 1:118761034-118761056 GAAAAGGAGCAGAAGCAGGGTGG + Intergenic
914004486 1:143720659-143720681 CATATGGAGCTGTGGCAGGGCGG - Intergenic
914747952 1:150513134-150513156 CAGTAGAAGCTGATGAAAGGGGG + Intronic
915317785 1:155039308-155039330 CAGAAGGGGGTGTTGCAGGTGGG + Intronic
915592412 1:156878267-156878289 CGAAGGGAGCTGAGGCAGGGAGG - Intronic
916966184 1:169945121-169945143 CAGAGGGGGCTGAGGCAGTGGGG + Intronic
918367306 1:183821917-183821939 CAACAGGATATGATGCAGGGAGG - Intronic
918383649 1:183983724-183983746 CAGGAGGAGCTGAGGCACAGTGG + Intronic
918607244 1:186442573-186442595 AAGAAAGAGATGATGCAGAGAGG + Intergenic
919598910 1:199599278-199599300 GAGAGCGAGCTGAAGCAGGGTGG + Intergenic
919739984 1:200975494-200975516 CAGCAGGAGCTCATCCAGGTGGG - Exonic
919787425 1:201268705-201268727 CAGCAGCAGCTGCTGCAGGGAGG + Intergenic
919838299 1:201591670-201591692 CAGAAGGAGATGTTGCAGCTGGG - Intergenic
919915425 1:202135864-202135886 GAGAAGGAGCTGCTGCTTGGAGG + Intronic
920227849 1:204450934-204450956 CAGAGGGCGCAGAGGCAGGGCGG + Intronic
920387245 1:205577666-205577688 CAGAAGGTGCAAATGCAGGAGGG - Intronic
921369602 1:214407981-214408003 GAGAAGGAGCAGAGGCAGTGTGG - Intronic
921384096 1:214551930-214551952 CAGAAGGAGCTCCTGCAGCCCGG - Intronic
921455494 1:215365914-215365936 GAGAGTGAGCTGAAGCAGGGCGG - Intergenic
921960838 1:221032830-221032852 CAAAGGGGGCTGGTGCAGGGAGG - Intergenic
922102452 1:222487755-222487777 CAGATGGGGCGGATGCTGGGCGG - Intergenic
922783461 1:228271668-228271690 CTGGAGGAGCTCATGCATGGAGG + Intronic
922993009 1:229931881-229931903 CAGAAGGGGCGGCTGCCGGGCGG + Intergenic
923266821 1:232322515-232322537 CATAAGGAGCAGAAGCAGGCAGG + Intergenic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
923480075 1:234375575-234375597 AAGAAGGCTGTGATGCAGGGAGG + Intronic
923881765 1:238111310-238111332 CAGAAAGAGCTGCTCCAGGCAGG + Intergenic
924636670 1:245794668-245794690 CAAAAGCAGCTGAGGCAGGAGGG - Intronic
1064321536 10:14309937-14309959 CAGAAGGAGGGAATGCGGGGAGG - Intronic
1064492925 10:15878513-15878535 GAGGGGGAGCTGAAGCAGGGCGG - Intergenic
1064738038 10:18403179-18403201 CATAAATAGCAGATGCAGGGAGG + Intronic
1064829811 10:19450244-19450266 CAAAAGAAGATGATGCAGTGTGG - Intronic
1065467977 10:26045685-26045707 CAAAAGGAGCAGATGAAAGGAGG - Intronic
1065766642 10:29036543-29036565 CAGAAGGAACAGAAGCAGGAAGG + Intergenic
1066245350 10:33578008-33578030 CAGAAGAAACTGGTGCTGGGAGG + Intergenic
1067339778 10:45391875-45391897 CAGAAGGGGCGGCTGCCGGGCGG - Intronic
1067872047 10:49970549-49970571 CAGAAGGGGCAGCTGCTGGGCGG - Intronic
1069052697 10:63811669-63811691 CAGATGGGGCGGATGCTGGGCGG + Intergenic
1069660991 10:70123409-70123431 CAGATGGTGCTGCTGCAGGGTGG - Exonic
1069968090 10:72138495-72138517 CAGAAGGAAATGATGCAGAGAGG + Intronic
1070007134 10:72435562-72435584 GAGGACGAGCTGAAGCAGGGCGG + Intronic
1070566830 10:77610047-77610069 GAGGAGCAGCTGGTGCAGGGTGG - Intronic
1070810159 10:79293537-79293559 CCAAAGGGGCTGATGCCGGGCGG - Exonic
1071876745 10:89850962-89850984 CAGAAGCAGGTGGAGCAGGGAGG + Intergenic
1072130910 10:92493106-92493128 CAGAAGGAAGTGATGCATGTTGG + Intronic
1072477649 10:95778117-95778139 GAGGACGAGCTGAAGCAGGGCGG - Intronic
1072728885 10:97831521-97831543 CATTAGGAGCAGATGGAGGGAGG + Intergenic
1072809204 10:98446477-98446499 CAGAAGGAGCTGCTGAAGACGGG - Intronic
1073327620 10:102651544-102651566 CACCAGGAGCTGGTTCAGGGAGG - Intronic
1073667005 10:105544965-105544987 CTGCAGGAGATGATGCAGGGAGG - Intergenic
1075630226 10:123996046-123996068 CAGACCGAGCTGCTGCAGGTAGG - Intergenic
1075842778 10:125518485-125518507 CAGACGGGGCAGATGCTGGGCGG - Intergenic
1076235435 10:128860718-128860740 CAGCAGGAGCTGGTGCTAGGAGG - Intergenic
1076830827 10:132993332-132993354 TAGCAGGAGCTGCCGCAGGGTGG - Intergenic
1077220585 11:1413767-1413789 CAGGAGGGGCTGATGGAGTGGGG - Intronic
1077223548 11:1427761-1427783 CAGGGGGAGATGATGAAGGGTGG + Intronic
1077231774 11:1461042-1461064 CAGCAGGAGCGGAGGGAGGGCGG - Exonic
1077327720 11:1970934-1970956 CAGAAGGAGCTGAGGGTGGCAGG + Intronic
1079130338 11:17743613-17743635 CAGAAGCTGCTTGTGCAGGGCGG + Intronic
1079472288 11:20789956-20789978 CAGAAGGACCAGCTGCAGAGAGG - Intronic
1080936990 11:36874546-36874568 CAGAGGTGGCTGATGCAGAGTGG - Intergenic
1081269284 11:41064767-41064789 CAGAGGGAGCAGAAGCAGGGTGG + Intronic
1081569190 11:44279103-44279125 CAGGTGGAGATGCTGCAGGGTGG - Intronic
1081569453 11:44280504-44280526 CACAAGGAGCTGCTCCAGGGAGG - Intronic
1081832709 11:46127548-46127570 CAGAAGTAACTGATGCAGATTGG + Intergenic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1082002125 11:47398962-47398984 CAGAAGGAGCTGAGCCAGTGAGG - Intergenic
1082844804 11:57716942-57716964 CAGATGGGGCGGATGCTGGGCGG + Intronic
1082867161 11:57910713-57910735 CAGGGTGAGCTGAAGCAGGGTGG - Intergenic
1083233764 11:61339191-61339213 CAGGAGGGGCTGCGGCAGGGAGG + Intronic
1083687998 11:64388836-64388858 CAGAAGCAGGGGATGCAGAGAGG + Intergenic
1083887801 11:65581298-65581320 CAGAACGAGCTAATGAAGCGGGG + Exonic
1084474009 11:69378514-69378536 GGGAAGGAGCTGATGAATGGGGG - Intergenic
1085042446 11:73334618-73334640 CCCAAGGAGCTGAGGCAGGAAGG - Intronic
1085308731 11:75503424-75503446 GAGAAGGATCTGAGGCAGAGAGG + Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1086366064 11:86110695-86110717 CAGATGGGGCGGATGCTGGGCGG - Intergenic
1086428214 11:86708044-86708066 CAGAAGGAGATAATGAAGGCTGG + Intergenic
1087667705 11:101070169-101070191 GAGAGCGAGCTGAAGCAGGGTGG + Intronic
1088135545 11:106552229-106552251 CAGCAGGAGCTGCTCCACGGAGG + Intergenic
1088469509 11:110177834-110177856 TAGAAGGATTTGAGGCAGGGTGG - Intronic
1088747997 11:112820575-112820597 GAGAAGCAGCAGATGCAGGAAGG + Intergenic
1088840150 11:113620111-113620133 CAGAAGGAACCGAAGCAGGATGG - Intergenic
1089563439 11:119357357-119357379 CAGAAGGAGAGGTTGGAGGGGGG - Intronic
1091078468 11:132643313-132643335 CTGAAGGAGCTCAGGCAGAGCGG + Intronic
1202810702 11_KI270721v1_random:26114-26136 CAGAAGGAGCTGAGGGTGGCAGG + Intergenic
1091668163 12:2434106-2434128 CAGAGGGAGCGGGTGCAGGAAGG - Intronic
1091716940 12:2784270-2784292 GAAAAGGAGCTGATGGAGGATGG + Intergenic
1092291408 12:7161556-7161578 CAGAGGCAGCTGATCCAGGAAGG - Intergenic
1092638808 12:10481518-10481540 AAGAGCGAGCTGAAGCAGGGTGG + Intergenic
1092866034 12:12762289-12762311 AAGACAGAGCTGATGCAGGTAGG + Intronic
1094239061 12:28201228-28201250 CAGACGGGGCGGCTGCAGGGCGG + Intronic
1094311784 12:29092519-29092541 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1095321782 12:40837515-40837537 AAGAAGGAACTGCTCCAGGGAGG + Intronic
1095459225 12:42424660-42424682 CAGAAAGTGCTAGTGCAGGGTGG - Intronic
1096086186 12:48866545-48866567 CAGCAGGAGCTGATATTGGGAGG - Intergenic
1096596917 12:52701653-52701675 CAAAAGGAGATGCTGGAGGGAGG + Intronic
1097068634 12:56338768-56338790 CAGAGGGGGATGATGCAGGGAGG + Intronic
1097197962 12:57254725-57254747 CAGAAGGAGCAAGGGCAGGGTGG - Exonic
1098009626 12:66036659-66036681 CAGAAAGAGGTGGTGCAGTGTGG + Intergenic
1098670988 12:73231378-73231400 CAGAAGGAAGTGAAGCAGGCAGG + Intergenic
1100048227 12:90411210-90411232 CAGAAGGGGCGGCTGCTGGGCGG - Intergenic
1102179909 12:110904677-110904699 CAGAAAGGGTTGATGAAGGGTGG - Exonic
1102182097 12:110920488-110920510 CAGGAGGTGATGATGCCGGGTGG - Intronic
1102496086 12:113320524-113320546 CAGCAGGAGAGGGTGCAGGGTGG - Intronic
1103960750 12:124607677-124607699 CAGAGGGAGATGATGTGGGGTGG - Intergenic
1104144489 12:126019316-126019338 CAAAGGGAGCTGGGGCAGGGAGG + Intergenic
1104858695 12:131913805-131913827 CTGGGGGAGCTGCTGCAGGGTGG - Exonic
1105562301 13:21505329-21505351 CAGAAGGCACTGATGCAGGGCGG + Intronic
1105590989 13:21792591-21792613 GAGAAGGAGCTGACTCAGCGCGG - Intergenic
1106578203 13:30995840-30995862 CAGAGGGAGCTTCTGCATGGAGG - Intergenic
1106747646 13:32721403-32721425 CAGACGGAGCGGCTGCCGGGCGG + Intronic
1107480391 13:40781257-40781279 TAGACGAAGCTGATGGAGGGAGG - Intergenic
1107551563 13:41480577-41480599 GAGAGCGAGCTGAAGCAGGGTGG - Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1108623325 13:52204827-52204849 TAGATGCAGCTGATGGAGGGAGG - Intergenic
1108663400 13:52606210-52606232 TAGATGCAGCTGATGGAGGGAGG + Intergenic
1112029912 13:95447618-95447640 GTGAAGGAGCTGAAGCAGGGAGG - Intronic
1112458263 13:99581267-99581289 CAGAAGGAGGTGATTAAGAGAGG + Intergenic
1112992075 13:105525998-105526020 CAGAGGGAGGTGATCCTGGGTGG - Intergenic
1113019691 13:105870918-105870940 GCTAAGGAGCTGAAGCAGGGAGG + Intergenic
1113383079 13:109821272-109821294 CAGGAAGAGCAGATGCAGGGAGG - Intergenic
1113529229 13:111008295-111008317 CAGAAGGAACCTATCCAGGGTGG + Intergenic
1113743892 13:112729422-112729444 CAGAAGGCACTGAGGCAGCGCGG + Intronic
1113887494 13:113668487-113668509 CAGGAGGAACTGAGGCAGGACGG + Intronic
1114174766 14:20310059-20310081 CAGATGGGGCGGATGCTGGGCGG - Intergenic
1114659466 14:24335221-24335243 CTGAAGGGGCTGAAGCGGGGAGG - Intronic
1117481336 14:56148430-56148452 CAGAGGGAACTGATGCAGGCAGG - Intronic
1118442112 14:65821534-65821556 CCTAAGGAGGTGCTGCAGGGAGG + Intergenic
1118890345 14:69903334-69903356 CAGACGGAGCGGCTGCCGGGCGG - Intronic
1119009727 14:70972234-70972256 GAGGAGGAGCAGATTCAGGGTGG + Intronic
1120184688 14:81382527-81382549 CAGAAGGTGGTGATACAGAGGGG + Intronic
1120501223 14:85299515-85299537 CAGATGGAGTTGAGGCAGAGAGG - Intergenic
1120751617 14:88203395-88203417 CAGGAGTAGCTGTTGCAGGCAGG - Intronic
1120764068 14:88312360-88312382 GAGAAGCTGCTGATGGAGGGAGG - Intronic
1121195375 14:92067374-92067396 CAGAAGGAGATGAGAAAGGGTGG - Intronic
1123028018 14:105437734-105437756 CCTGCGGAGCTGATGCAGGGTGG + Intronic
1124095962 15:26648942-26648964 CAGGAGGAGCTGAGTCATGGAGG + Intronic
1124623841 15:31297068-31297090 CAGAAAGTGCAGAGGCAGGGTGG + Intergenic
1127837000 15:62797983-62798005 AAGCAGCAGCTGCTGCAGGGAGG + Intronic
1128226883 15:66007988-66008010 CAGGAGGAGGTGCTGCAGAGAGG - Intronic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1129431211 15:75503392-75503414 CAGATGGGGCGGATGCTGGGCGG - Intronic
1130012284 15:80161032-80161054 CAGCAGGAGCTGTTCCAGAGAGG - Intronic
1130028003 15:80286327-80286349 AGGAAGGAGCTGTTGCAGGATGG - Intergenic
1132036990 15:98493086-98493108 CAGACGGGGCGGATGCTGGGCGG + Intronic
1132062103 15:98700717-98700739 CAGCTGGAGCTGATGCCTGGTGG - Intronic
1132361227 15:101217602-101217624 CAGAAGGAAGGGATGGAGGGAGG + Intronic
1132380336 15:101361782-101361804 CAGTAGGGGTTGAGGCAGGGGGG + Intronic
1132463914 16:68882-68904 AAGCAGGAGCCGATGCAGGGAGG + Intronic
1132679789 16:1134989-1135011 CAGAAGGAGTTGATGGAGCACGG - Intergenic
1133050752 16:3115959-3115981 CAGAACCAGCAGATGCAGGAAGG - Intronic
1134354971 16:13473571-13473593 CAGAAGAAACTGAGGAAGGGTGG - Intergenic
1136074425 16:27807144-27807166 TAGAAGGAGCCGAGGCAGGGAGG - Intronic
1137336560 16:47554812-47554834 GAGAGCGAGCTGAAGCAGGGTGG - Intronic
1137403334 16:48171118-48171140 CAGAAGGAACAGGTGCTGGGAGG - Intronic
1137607042 16:49793788-49793810 CACAAGGAGGGCATGCAGGGTGG + Intronic
1137828040 16:51516775-51516797 GAGAGAGAGCAGATGCAGGGTGG + Intergenic
1139912779 16:70408387-70408409 CAGAAGGAGCTGGGGCGGAGGGG + Intronic
1139949451 16:70662047-70662069 CAGAGGGAGCTGATGAAGAATGG - Exonic
1141810732 16:86373701-86373723 CCAAAGGATCTGATCCAGGGAGG + Intergenic
1141880790 16:86857510-86857532 CAGAAAGAGTTGCTGTAGGGTGG - Intergenic
1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG + Intronic
1143688859 17:8543288-8543310 CAGAATGAGGTCATGCAAGGAGG + Intronic
1144235206 17:13254042-13254064 GAGAAGGGGCGGATGCAGGTAGG + Intergenic
1144562202 17:16330038-16330060 CAGAAGGAGCAAAAGCAGGAAGG + Intronic
1144661415 17:17073249-17073271 CAGAGGGGACTGATGCAGGTGGG - Intronic
1144859576 17:18292416-18292438 CAGCAGGAGCTGATGGAGAGTGG + Intronic
1145860933 17:28209314-28209336 CAGAGGGAGCTTATTCAGGTTGG + Intergenic
1146448879 17:32955714-32955736 CTCAGGGAGCTGAGGCAGGGAGG + Intergenic
1146465560 17:33083652-33083674 CAGAGGGAGCAGATGCACAGAGG + Intronic
1146465687 17:33084394-33084416 CACAGGGAGCTAATCCAGGGAGG - Intronic
1146789454 17:35743196-35743218 CAGAGGGAGCGGATGAAGGATGG + Exonic
1148778528 17:50109208-50109230 CTGCAGGGACTGATGCAGGGAGG - Intronic
1149458081 17:56805431-56805453 CAGGAGGAGTGGGTGCAGGGAGG - Intronic
1151453845 17:74214679-74214701 CACAAGGAACTGATACAGGTGGG - Intronic
1152309859 17:79543572-79543594 AAGGAGGAGCTGATGAAGGGGGG - Intergenic
1152334547 17:79693036-79693058 CAGATGGAGGCGATGCAGGTTGG + Intergenic
1152621744 17:81368372-81368394 CAGAACGAGGTGGTGCAGGAAGG + Intergenic
1153221747 18:2868078-2868100 CAGATGGAGCGGCTGCCGGGTGG + Intronic
1155049308 18:22132679-22132701 CAGAAGGGGCTGTGGCAGAGAGG + Intergenic
1155347381 18:24871932-24871954 CAGAAGGTTCTGAAGCAAGGAGG - Intergenic
1155393400 18:25361187-25361209 CAGCTGGAGATGATGCATGGTGG - Intergenic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1155830222 18:30507663-30507685 GCAAAGGAGCTGATGGAGGGAGG - Intergenic
1156052375 18:32952474-32952496 CAGCTGGAGCTGAAGCAGGTGGG + Intronic
1157574169 18:48732638-48732660 CAGAAGGAGCTGGGGAAGGATGG - Intronic
1157629500 18:49080780-49080802 CAGACGGGGCGGATGCCGGGCGG + Intronic
1157679012 18:49589041-49589063 CAGAGGGAGTTGAAGCAGGTCGG + Intronic
1158390943 18:57044431-57044453 CAGAGGGAGATGACGAAGGGAGG + Intergenic
1158504962 18:58039304-58039326 CTCAAGGAGCTGAGGCAGGAGGG - Intergenic
1160676195 19:392625-392647 CAGAGAGAGCTGCTGCAGAGAGG - Intergenic
1160741046 19:685988-686010 CAGAGGGTTCTGAGGCAGGGAGG - Intronic
1161741985 19:6026934-6026956 CTGAAGGACCTGATGGAGGTGGG + Intronic
1161797377 19:6394914-6394936 CAGAAGGAACTGGGGCAGGCAGG + Intergenic
1161931839 19:7345766-7345788 CAGCTGGAGCTCCTGCAGGGCGG + Intergenic
1162064825 19:8119054-8119076 ATGAAGGTGCTGATGCAGGGAGG + Intronic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1163130728 19:15271203-15271225 CAGTGGGAACTGAAGCAGGGAGG - Intronic
1163171303 19:15533003-15533025 CAGGAGGTCCTGATCCAGGGTGG - Intronic
1164152429 19:22566448-22566470 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1164623802 19:29713847-29713869 CAGGAGGAGCTGGGGTAGGGAGG - Intronic
1164656056 19:29922791-29922813 CAGAAAGAGGTGATGAAGCGAGG - Intergenic
1165090326 19:33384072-33384094 CAGAAGGAGCTGTCCCAGGAAGG - Intergenic
1165822014 19:38682745-38682767 CAGAAGGAGCTTGTAGAGGGTGG - Intronic
1165939999 19:39410193-39410215 CCGCAGGCGCTGACGCAGGGCGG - Intergenic
1166191588 19:41180228-41180250 CAGATGGGGCGGATGCTGGGCGG - Intergenic
1166239295 19:41478872-41478894 CAGAAGGAGAAGACTCAGGGAGG - Intergenic
1166551579 19:43669122-43669144 GAGAAGGAACTGAGTCAGGGCGG - Intronic
1166664946 19:44673837-44673859 CAGAAGAAGGTGATTGAGGGAGG + Intronic
1167353663 19:48991217-48991239 CAGACGGAGAGGGTGCAGGGTGG - Intronic
1167368056 19:49064985-49065007 GAGGAGGAGCTGCTGCCGGGCGG - Intronic
1167922402 19:52792623-52792645 CAGAAGGACTTGAAGCAGCGAGG - Intronic
1168493470 19:56830825-56830847 CTCAAGAGGCTGATGCAGGGGGG + Intronic
1168718940 19:58544440-58544462 CAGAAAGAGCCGAGGCCGGGGGG - Intronic
925067987 2:943987-944009 CAGGAGGAACTGCTGCAGAGAGG - Intergenic
926558302 2:14386558-14386580 CAGAAGGAGGAGAAGCAGGAGGG + Intergenic
927195026 2:20541027-20541049 CAGATGGAGCAGCTGCAGAGGGG + Intergenic
927506879 2:23620576-23620598 CAGAGGGAGCTGACCCAGGATGG + Intronic
927512930 2:23655739-23655761 CAGGTGGAACTGGTGCAGGGTGG + Intronic
927576764 2:24207381-24207403 CAGGAGGAGCTGCTGCTGGAAGG + Intronic
927676566 2:25110562-25110584 CAGAAAGAATGGATGCAGGGAGG - Intronic
928436746 2:31259443-31259465 CAGTAGGAGCTGAAGTAGGAGGG - Intronic
929923444 2:46190259-46190281 CAAAAGGAGCTGTTGTAGGAAGG + Intergenic
930510254 2:52335492-52335514 AAGAAGGAGCAGAAGCAGGAAGG - Intergenic
930893666 2:56421207-56421229 GAGCACGAGCTGAAGCAGGGTGG + Intergenic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
934659151 2:96133921-96133943 AAGAAGGGGCTGAGGCAGGGAGG + Intronic
934879255 2:97959251-97959273 TAGAAGGAGCTGACGCTGGAGGG + Intronic
934995958 2:98960684-98960706 CAGAGGCAGCTGATGTAGGGAGG - Intergenic
935064642 2:99636964-99636986 CAGAGTGAGCAGCTGCAGGGTGG + Intronic
935091802 2:99901736-99901758 GAGAAAGAGCAGATGCAGGGAGG - Intronic
935663470 2:105489212-105489234 CAGAAGGAAGGGAGGCAGGGAGG + Intergenic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
939652721 2:144785121-144785143 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
941308259 2:163897658-163897680 CAGAAGGAACTGCTCCAGGCAGG + Intergenic
941768720 2:169326972-169326994 CAGATGGGGCGGATGCTGGGTGG - Intronic
941989062 2:171537018-171537040 CAGAGGAAGCTGAGGCAGAGAGG - Intronic
941998760 2:171626362-171626384 CAGCAGGAGCTGAAACAGGCAGG + Intergenic
942445211 2:176072975-176072997 TGGCAGGAGCTGATTCAGGGCGG - Intergenic
942513568 2:176728263-176728285 CAGATGGAGCTGGTCCACGGTGG - Intergenic
944733050 2:202535244-202535266 CAGACGGAGCGGCTGCTGGGCGG + Intronic
945207147 2:207344304-207344326 CAGAGGGAGCTGAAGCAGGGTGG + Intergenic
947638824 2:231694499-231694521 CAGAAGGAACTGGTGGAGGTGGG - Intergenic
947762033 2:232610222-232610244 CACAAGGAGCTGATGGCAGGTGG - Intronic
947987462 2:234461152-234461174 TAGAAGGAGCTGAAGCGGGCAGG + Intergenic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948469105 2:238166014-238166036 CTGAAGGGACTGGTGCAGGGAGG + Intronic
948565776 2:238885109-238885131 CAGATTGTGCAGATGCAGGGAGG + Intronic
949006674 2:241653383-241653405 CAGGTGGAGCTGATGGAGGAGGG + Intronic
949077937 2:242073285-242073307 AAGAAGGCCCTGCTGCAGGGTGG + Intergenic
1168795823 20:609735-609757 CAGAAGGTGCAGATGGAGCGCGG + Exonic
1169217881 20:3803921-3803943 CAGAAGGAGCTCAGCCAGGGAGG - Intronic
1170455738 20:16531094-16531116 CAGCAGGAACTTATGCAGGTTGG - Intronic
1170923602 20:20702359-20702381 GAGAAGGAGCTGGTGAAGGCAGG + Intronic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1171567283 20:26207744-26207766 CAAAAGAAACTGATGCAGGAGGG - Intergenic
1171951622 20:31427056-31427078 CAGATGGGGCGGATGCTGGGCGG - Intergenic
1172222906 20:33285998-33286020 CAGAGGGACCTGAGGCAGAGGGG - Intronic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1173809627 20:45948092-45948114 GAGAAGGAGCTGCTGGAGGGAGG - Intergenic
1174361435 20:50031272-50031294 GGGAAGGAGCTGAGGGAGGGAGG + Intergenic
1174476938 20:50802329-50802351 CGGAAGGTTCTGATGCAGGGAGG - Intronic
1174942165 20:54941040-54941062 AGGAAGGAGCTGAAGAAGGGAGG + Intergenic
1179041006 21:37802207-37802229 AAGAAGCAGTTGTTGCAGGGGGG + Intronic
1179292648 21:40032051-40032073 CAGAAGGAGCTGAGTTAGGCTGG - Intronic
1179534717 21:42044088-42044110 CAGATGGAGCTGCTGCAGCCAGG - Intergenic
1179977337 21:44875856-44875878 GAGAAGGAGCTGAGGGAGGAGGG - Intergenic
1181314690 22:21963712-21963734 CAGCAGGTGCTGTTGCAGGGAGG - Intronic
1181323624 22:22027798-22027820 CAGAAGTAGCAGAAACAGGGTGG + Intergenic
1181863884 22:25840315-25840337 CAGAAGGAGCTGCTGAAGCCAGG - Intronic
1181919090 22:26305965-26305987 CACAAGGAGCTGATCCAGAAAGG - Exonic
1182070922 22:27463058-27463080 CAGCAGAGGCTGAGGCAGGGAGG + Intergenic
1183111770 22:35654825-35654847 AAGAAGCAGCAGATGCAGGAAGG + Intronic
1183185787 22:36290943-36290965 CAGACGGGGCGGCTGCAGGGCGG - Intronic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183360141 22:37379054-37379076 AAGAAGGGGGTGCTGCAGGGAGG + Intronic
1183949904 22:41347148-41347170 CAGCAGCAGCTGGTGCTGGGAGG - Intronic
1185068647 22:48644450-48644472 CAGAAGGAGCTGGGGCAGGCCGG + Intronic
1185397184 22:50598909-50598931 CAGAAGGAGCTCATGCAAGTCGG - Intronic
1185408541 22:50671344-50671366 CAGGAAGTGCTGAGGCAGGGAGG + Intergenic
949743073 3:7258733-7258755 CAGAAGGAGATGATGGATTGTGG - Intronic
950427128 3:12930516-12930538 CAGAAGGAGCCGATGAGGGGAGG + Intronic
951605452 3:24429033-24429055 AAGAAGGAGCTGGGGCAGTGAGG + Intronic
951966104 3:28387039-28387061 CAGAGAGAGCTGATGCTGGGCGG - Intronic
952318929 3:32258031-32258053 CAGAAGTCGCTGCTGGAGGGAGG + Intronic
953966216 3:47309333-47309355 CAGAAGGGGCAGCTGCCGGGCGG + Intronic
954584067 3:51719088-51719110 CAGAAGGAGCTTATGGGGAGAGG + Intergenic
954702435 3:52457284-52457306 CACAAGCAGCTGATGTGGGGAGG - Intronic
957111068 3:75958570-75958592 CAAAAGAAACTGATGCAGGAGGG + Intronic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
959093157 3:101925334-101925356 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
959340403 3:105122327-105122349 CAGAGGGACCTGATGCAAAGAGG + Intergenic
959392499 3:105793404-105793426 CATAAGGAACTGATGGAGGAAGG + Intronic
959683763 3:109124129-109124151 CAGACGGGGCAGATGCTGGGCGG - Intergenic
960054117 3:113264588-113264610 CAGATGGGGCAGATGCAGAGAGG - Intronic
960166573 3:114409493-114409515 CAGAAGCAGCTGAAGGAAGGGGG + Intronic
960224908 3:115157798-115157820 CAGATGGAGCTGAAGCAGCTGGG - Intergenic
960698647 3:120419559-120419581 AAGAGGGAGATGAAGCAGGGTGG + Intronic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960787732 3:121392375-121392397 GAGAGTGAGCTGAAGCAGGGTGG - Intronic
961483397 3:127198088-127198110 CAGAAGGTGCTGATGGGGTGAGG - Exonic
961590423 3:127975557-127975579 AAGAAGAAGCTGGTGCAAGGTGG - Intronic
962008405 3:131370467-131370489 CAGATGAAGCTGCTGCAGGCTGG - Intergenic
962414493 3:135169631-135169653 CTGAAGGCTCTGATGGAGGGAGG + Intronic
962542001 3:136391729-136391751 CAGAAGGAGCTGAAGGAAGAAGG + Intronic
962675144 3:137750846-137750868 GAGAGTGAGCTGAAGCAGGGCGG + Intergenic
962978123 3:140463859-140463881 TAGCAGGAGCTGATGCTGGAGGG + Intronic
963051763 3:141149212-141149234 GAGAAGGAGCTCATGAAGAGGGG + Intergenic
964219299 3:154325634-154325656 CAGAAAAAGGTGATTCAGGGAGG - Intergenic
964727893 3:159833798-159833820 CAGAAGGAACTGATTCTGAGAGG - Intronic
965396088 3:168161712-168161734 CAGAAAGAGGTGGTGCAGGGAGG + Intergenic
965398103 3:168185222-168185244 CAGAAGGAGAAGATTCAGAGGGG - Intergenic
967595143 3:191319123-191319145 TACAAGGAGCTAATGCAAGGAGG - Intronic
968525116 4:1052850-1052872 CAGAACCAGGTGCTGCAGGGTGG + Intergenic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
969157125 4:5220769-5220791 CAGAAAGAACAGAGGCAGGGAGG + Intronic
969194121 4:5547228-5547250 CAGAGGGGGCTGAGGCAGTGGGG - Intronic
971500517 4:27313501-27313523 CAGAAAGATCTGATGCAGATTGG + Intergenic
971594852 4:28515016-28515038 CAGAAGGGGCGGCTGCCGGGCGG + Intergenic
973237110 4:47917199-47917221 CACAAGGGCCTGTTGCAGGGTGG - Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
974021244 4:56693643-56693665 CAGAAGGGGCGGCTGCCGGGCGG + Intergenic
975032935 4:69645548-69645570 CAGAAGTAGCTGATAAATGGAGG - Intronic
975076332 4:70213192-70213214 GAGCATGAGCTGAAGCAGGGCGG - Intergenic
975449274 4:74505471-74505493 AAGAGTGAGCTGAAGCAGGGTGG + Intergenic
976265068 4:83182233-83182255 CAGATGGGGCGGATGCTGGGCGG - Intergenic
976728836 4:88242758-88242780 GAGAAAGAGCTGACGCAGGAAGG + Intergenic
976774017 4:88687247-88687269 CAGAAGAAGCTGATACCTGGGGG + Exonic
978108190 4:104930405-104930427 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979577427 4:122310708-122310730 GAGAAGCAGCAGATGCAGGAAGG - Intronic
979610442 4:122683673-122683695 GAGAAGGAACTGTTTCAGGGAGG - Intergenic
980583722 4:134786901-134786923 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
980852939 4:138405339-138405361 CAAAACGAGGTGATGCAGGATGG + Intergenic
981964439 4:150583177-150583199 CTCAAGGAGCTGATGAAGCGAGG - Exonic
982110024 4:152045567-152045589 CAGCAGGTGCTGATGCATGGGGG - Intergenic
982192071 4:152866736-152866758 CAGAAGGGGCGGCTGCCGGGCGG + Intronic
982456165 4:155611615-155611637 CAGAAGGAGCAGATTTAGTGAGG - Intergenic
983678791 4:170328340-170328362 CAGAAGGACCTCATGGAGGAAGG + Intergenic
983750678 4:171265617-171265639 CAGTAAGATCTAATGCAGGGTGG + Intergenic
984531545 4:180922629-180922651 CAGAAGGCGCTAAAGCAGGCAGG + Intergenic
985229064 4:187795686-187795708 AAGAAGTAGCTGGTGCAGAGTGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
989202065 5:38773549-38773571 CAGAAGGAACAGATGGAGGAAGG + Intergenic
989522504 5:42418395-42418417 GAGAATAAGCTGAAGCAGGGTGG - Intergenic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
990459107 5:56015212-56015234 CAGATGGGGCGGATGCTGGGCGG + Intergenic
990743116 5:58932603-58932625 CAGAAGAAGCAGATGAAGGGTGG - Intergenic
991151422 5:63375836-63375858 GAGGGGGAGCTGAAGCAGGGTGG + Intergenic
991968058 5:72110629-72110651 AAGATGGAGCTGCTCCAGGGGGG + Intronic
993001912 5:82389028-82389050 CTGAAGGAGCACATGGAGGGCGG - Intergenic
993015761 5:82532858-82532880 CAGAGAGAGCTTATGCAGGCAGG + Intergenic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
994804044 5:104420413-104420435 CAGAAGGAGTTGATCCACAGAGG + Intergenic
994946807 5:106404605-106404627 CAGTAGCAGGAGATGCAGGGAGG + Intergenic
996477831 5:123941541-123941563 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
996773577 5:127110407-127110429 CAGAAGGAGCAGTTTCAGGGAGG - Intergenic
997051183 5:130382510-130382532 AAGAAGGATCAGATGCAGGAAGG + Intergenic
997459620 5:134043034-134043056 CAGCAGGGGCAGATCCAGGGAGG + Intergenic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
998927566 5:147142833-147142855 GAGAGGGAGCAGAAGCAGGGTGG - Intergenic
999330695 5:150671853-150671875 CAGCAGGGGCGGCTGCAGGGTGG - Exonic
1001380044 5:171299394-171299416 CAGATGCAGCTGAGGCAGGGAGG - Exonic
1001475682 5:172048990-172049012 CTGAAGGACCTGAGGGAGGGAGG - Intronic
1003147034 6:3517329-3517351 CGGAAGGAGATGATGGAGAGTGG - Intergenic
1004446074 6:15699933-15699955 AAGAAGAAGCTGTTGCAGGTGGG + Intergenic
1005978809 6:30820293-30820315 CTGAAGGAGCTGATGGCTGGAGG - Intergenic
1006065102 6:31455742-31455764 CAGATGGGGCGGATGCTGGGCGG + Intergenic
1006081918 6:31572786-31572808 CAGAAGGAGGAGGTGTAGGGTGG - Exonic
1006225377 6:32532340-32532362 CAGACGGGGCGGCTGCAGGGCGG - Intergenic
1006460992 6:34157986-34158008 GAGAAAGGGCTGATGCTGGGTGG + Intergenic
1006975011 6:38091802-38091824 CAGACGGAGCTGAGGCATGGAGG + Intronic
1009401125 6:63257116-63257138 CAGAAGGAGCTGAGATAGGTTGG - Intergenic
1010277274 6:73983961-73983983 CACACAGAGCTGATGCTGGGAGG - Intergenic
1010671699 6:78694469-78694491 GAGCATGAGCTGAAGCAGGGCGG + Intergenic
1010748245 6:79588527-79588549 GAGAAGCAGCAGATGCAGGAAGG - Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1014227213 6:118862024-118862046 CAGAAGGAGCCAAGGCAGTGGGG + Intronic
1014287432 6:119516476-119516498 CAGAAGGATCAAATACAGGGTGG - Intergenic
1014535403 6:122607869-122607891 CAGAAGGTGCATATCCAGGGAGG - Intronic
1015181238 6:130365296-130365318 CAGAGGGAACTGAAGCACGGGGG - Intronic
1016562971 6:145417894-145417916 CTGAAGGAGCTGAAGGAGTGTGG - Intergenic
1016792532 6:148080354-148080376 CAGAAGCACCTGGTGCAGGGTGG - Intergenic
1017209038 6:151834785-151834807 GAGAAGGCGCTGAGACAGGGAGG + Intronic
1017248106 6:152249696-152249718 AAGAAGAAACTGATGGAGGGAGG - Intronic
1018405106 6:163472395-163472417 CAGAAGGAGGTGATGGAGGTGGG + Intronic
1018527450 6:164728800-164728822 CAGCTGGAGCTGAAGCAGGTGGG - Intergenic
1019452506 7:1107031-1107053 CAGGCAGAGCTGATGCTGGGCGG - Intronic
1019497800 7:1348466-1348488 CAGACGGAGCTGATGGTGGGTGG - Intergenic
1020581360 7:10006830-10006852 AAGAAGGAACTAATGAAGGGAGG - Intergenic
1022140919 7:27492292-27492314 CGGCAGTAGCTGATGCTGGGGGG + Intergenic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1025573003 7:62599887-62599909 CAGATGGGGCAGATGCTGGGCGG + Intergenic
1025803666 7:64809657-64809679 CAGATGGGGCTGCTGCCGGGCGG + Intronic
1026589864 7:71685250-71685272 CAGAAGCAGGTGGTTCAGGGTGG + Intronic
1026773672 7:73217860-73217882 CAGAAGGAGCAGGTGCCGGCGGG + Intergenic
1026895387 7:74007300-74007322 GAGAATGAGCTGAGGCAGGTGGG - Intergenic
1027014531 7:74771254-74771276 CAGAAGGAGCAGGTGCCGGCGGG + Intergenic
1027073502 7:75174703-75174725 CAGAAGGAGCAGGTGCCGGCGGG - Intergenic
1028004557 7:85547548-85547570 CAGAATGGGCTGAAACAGGGAGG - Intergenic
1028340797 7:89717680-89717702 GAAAAGGGGCTGATGCAGGTAGG - Intergenic
1028652924 7:93170707-93170729 GAGGAGGAGCCGAAGCAGGGTGG - Intergenic
1029415773 7:100442272-100442294 CAGAAGGAAGAGATCCAGGGAGG + Intergenic
1029479829 7:100805617-100805639 CAGCATGAGCTGGTGGAGGGAGG + Exonic
1029569325 7:101359535-101359557 CAGATGGGGCGGATGCTGGGCGG + Intergenic
1029698082 7:102227717-102227739 CAGGAGGAGCAGGTGAAGGGCGG + Intronic
1031382823 7:121109533-121109555 AAGAAGAAGCTGATGTAGAGGGG - Intronic
1031552111 7:123127743-123127765 CAGAAGGTTCTGATTCAGGGAGG + Intronic
1031687104 7:124744533-124744555 TAGAAGGAGCTGATGAAAGATGG - Intergenic
1033210810 7:139458936-139458958 CTGCAGGTGCTGAGGCAGGGTGG - Intronic
1034275022 7:149820249-149820271 AAGAAGGAGCTGAAGCTTGGGGG - Intergenic
1034346480 7:150388439-150388461 CAGCCGGCGCTGATGCTGGGAGG + Exonic
1034481144 7:151321128-151321150 CAGAGGGAGCTGAGGCAGCTTGG - Intergenic
1034943203 7:155245222-155245244 GAGGATGAGCTGATGCAGGCAGG - Intergenic
1035040081 7:155920859-155920881 CAGAAGGAGCTGATGCTGGGTGG + Intergenic
1035046262 7:155969276-155969298 CAGAAGGCACGGATGCAGGTGGG + Intergenic
1035049999 7:155993266-155993288 CAGCAGGGGCTGATGGAGGCAGG - Intergenic
1035050016 7:155993356-155993378 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035050049 7:155993536-155993558 CAGAAGGGGCTGATGGAGGCAGG - Intergenic
1035300703 7:157895706-157895728 CAGAGGGTGCTGAGACAGGGTGG + Intronic
1035657635 8:1322773-1322795 GAGAAGGCCCTGATGCAGGGGGG - Intergenic
1035951050 8:4021529-4021551 CAGAAGGAGCTGATCCTTGCTGG - Intronic
1036690782 8:10943489-10943511 CAGCAGGAGCAGATACAGAGAGG - Intronic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1037656063 8:20885183-20885205 CAGAAGCAGCTGCTGCGGCGAGG + Intergenic
1037995971 8:23352568-23352590 CAGACAGAGCTGCTGCTGGGAGG + Intronic
1038190978 8:25320230-25320252 CAGAAAGAGCTGATGGAGCCCGG - Intronic
1039461904 8:37752071-37752093 CAGAAGTAGCTAAGGCAAGGGGG - Intronic
1039754911 8:40512728-40512750 GAGAACAAGCTGAAGCAGGGTGG - Intergenic
1040580638 8:48696110-48696132 TTGAAGGAGCTGCTGCAGAGAGG + Intergenic
1040876537 8:52158327-52158349 CAACAGGAGATGATTCAGGGAGG - Intronic
1041257591 8:55992501-55992523 CATAAGGAGCCCAGGCAGGGAGG - Intronic
1043464065 8:80487318-80487340 GGGAAGGAGTTGATGCAGGACGG + Exonic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1044584391 8:93856086-93856108 CACAAGGGGCTGAGGCAGGGTGG - Intergenic
1044927892 8:97224641-97224663 CAGGTGGAGCAGCTGCAGGGAGG + Intergenic
1045021920 8:98051833-98051855 CAGACGGGGCTGCTGCCGGGCGG + Intergenic
1045088161 8:98710318-98710340 GAGCATGAGCTGAAGCAGGGCGG + Intronic
1046539055 8:115555568-115555590 CAGAGGGGGTTGATGAAGGGAGG + Intronic
1046900745 8:119521145-119521167 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1047965270 8:130041798-130041820 CACAAGGTGCTGATGGAGTGTGG + Intergenic
1048354590 8:133642804-133642826 CGGAAGGGGCTGGTGCATGGCGG + Intergenic
1048839664 8:138553861-138553883 CACATGGAGCTGAGGCAGAGTGG - Intergenic
1049040826 8:140110814-140110836 CAGGGGGAGCTGCTGCAGGGGGG - Intronic
1049411500 8:142475754-142475776 CAGAAGGGGCCGGTGGAGGGAGG + Intronic
1049872452 8:144991093-144991115 GAGAGGGAGCAGAAGCAGGGAGG - Intergenic
1050679286 9:8091115-8091137 CAGAAGGGGCTGATGCACTGGGG - Intergenic
1051112165 9:13651411-13651433 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1051863472 9:21652146-21652168 GAGGAGGAGCTGAAGCAGGGTGG - Intergenic
1051883947 9:21870100-21870122 CTGAAGGAGCTGCTGTAGTGAGG - Intronic
1052122242 9:24731587-24731609 CAGAAGGAGTTGATAGAGGCAGG - Intergenic
1052274839 9:26664448-26664470 CAGATGGGGCTGCTGCCGGGCGG - Intergenic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1053053920 9:34982481-34982503 CAGAAGAAGCTGATGCCCTGAGG + Exonic
1054876335 9:70100383-70100405 CAGCAGGACCTGATCCAGGGAGG + Intronic
1056152490 9:83804009-83804031 CAGACGGGGCGGATGCTGGGCGG - Intronic
1056861503 9:90188520-90188542 CAGAAAGAGATGATGCTGGTTGG + Intergenic
1057578253 9:96261567-96261589 CTGAGGAGGCTGATGCAGGGTGG + Intronic
1057719323 9:97519489-97519511 CACCAGGAGCTGCTGCAGGTGGG + Intronic
1058313889 9:103539992-103540014 AAGAAGGAGCTACTGGAGGGTGG + Intergenic
1059157961 9:112006390-112006412 CCGAAGGAGCTGGTTCAGAGAGG + Intergenic
1059326029 9:113504458-113504480 CAGCAGAGGCTAATGCAGGGAGG - Intronic
1060459911 9:123841690-123841712 CTGAAGGAATTGGTGCAGGGTGG + Intronic
1060471854 9:123954692-123954714 CAGAAGATGCTGATGCTGGTGGG + Intergenic
1060703921 9:125780875-125780897 CAGACGGGGCGGATGCTGGGCGG + Intronic
1060784072 9:126435324-126435346 CAGAGGGAGCTCATGAATGGTGG + Intronic
1061778795 9:132983922-132983944 AAGAAGGAGCTGAAGCCTGGAGG - Intronic
1062199870 9:135296870-135296892 CAACAGGAGGTGAGGCAGGGCGG + Intergenic
1062317147 9:135973359-135973381 CAGAGGGAGCTGCTACAGGCAGG + Intergenic
1062713294 9:137988365-137988387 CTGTAGAAGCTGTTGCAGGGAGG + Intronic
1185595760 X:1305743-1305765 CAGGAGAAACTGAGGCAGGGTGG + Intronic
1185601310 X:1341607-1341629 CAGAAGGAGCTGCTTCTGGAGGG - Intronic
1185882136 X:3750925-3750947 GAGAAGGAACTGATACAGGTGGG - Intergenic
1186084187 X:5968742-5968764 CCGATGGAGCTGTTGCAGGGAGG + Intronic
1187093641 X:16123651-16123673 TAGAAAGAACTGATGCAGAGTGG + Exonic
1187527624 X:20068428-20068450 CAGAAGAAGCAGATGCTGTGTGG - Intronic
1189189554 X:39088650-39088672 CAGAGGGAGCCAAAGCAGGGTGG + Intergenic
1191079635 X:56495421-56495443 GAGAGTGAGCTGAAGCAGGGTGG - Intergenic
1191237819 X:58150496-58150518 GAGAGTGAGCTGAAGCAGGGTGG + Intergenic
1192949176 X:75998100-75998122 GAGCATGAGCTGAAGCAGGGTGG - Intergenic
1193081670 X:77412335-77412357 GAGGGGGAGCTGAAGCAGGGTGG - Intergenic
1194181194 X:90713825-90713847 CAGACGGGGCGGCTGCAGGGCGG - Intergenic
1194961132 X:100236775-100236797 GAGAATGAGCCGAAGCAGGGTGG - Intergenic
1195671154 X:107471148-107471170 CACAAGGGGCTGAAGCAGGAGGG + Intergenic
1195693650 X:107650216-107650238 CAGAATGAGATAATGCAGGTAGG - Exonic
1196483842 X:116181529-116181551 GAGAAGGAACTGCTCCAGGGAGG + Intergenic
1197902841 X:131392540-131392562 CAGCAGCATCTGATTCAGGGAGG - Intronic
1198152243 X:133922570-133922592 CAGCAGGAGTGGGTGCAGGGTGG + Intronic
1198592370 X:138198452-138198474 GAGCATGAGCTGAAGCAGGGTGG + Intergenic
1198680632 X:139178007-139178029 CAGGGCGAGCTGAAGCAGGGTGG - Intronic
1199896985 X:152135909-152135931 TAGGTGGAGCTGATGCAGTGGGG + Intronic
1200527822 Y:4295754-4295776 CAGACGGGGCGGCTGCAGGGCGG - Intergenic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1200782836 Y:7232281-7232303 GAGAAGGAACTGATACAGGTGGG + Intergenic
1202335109 Y:23800819-23800841 CAGCATGAGCTGAAGCAGGGTGG + Intergenic
1202535658 Y:25869240-25869262 CAGCATGAGCTGAAGCAGGGTGG - Intergenic