ID: 1143020671

View in Genome Browser
Species Human (GRCh38)
Location 17:3915869-3915891
Sequence TTCACCGAAGGCCCCCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143020662_1143020671 11 Left 1143020662 17:3915835-3915857 CCGGCTCCTCAGAACCCAGAGAC 0: 1
1: 0
2: 3
3: 51
4: 992
Right 1143020671 17:3915869-3915891 TTCACCGAAGGCCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 60
1143020665_1143020671 -4 Left 1143020665 17:3915850-3915872 CCAGAGACTCTGCCTCCTGTTCA 0: 1
1: 0
2: 1
3: 21
4: 309
Right 1143020671 17:3915869-3915891 TTCACCGAAGGCCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 60
1143020661_1143020671 24 Left 1143020661 17:3915822-3915844 CCATAACACTGAGCCGGCTCCTC 0: 1
1: 0
2: 0
3: 7
4: 71
Right 1143020671 17:3915869-3915891 TTCACCGAAGGCCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 60
1143020663_1143020671 5 Left 1143020663 17:3915841-3915863 CCTCAGAACCCAGAGACTCTGCC 0: 1
1: 0
2: 1
3: 48
4: 330
Right 1143020671 17:3915869-3915891 TTCACCGAAGGCCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 60
1143020664_1143020671 -3 Left 1143020664 17:3915849-3915871 CCCAGAGACTCTGCCTCCTGTTC 0: 1
1: 0
2: 2
3: 27
4: 320
Right 1143020671 17:3915869-3915891 TTCACCGAAGGCCCCCGGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143020671 Original CRISPR TTCACCGAAGGCCCCCGGGC AGG Intronic
900491237 1:2950157-2950179 ATCCCCGTAGGCCCCGGGGCTGG + Intergenic
900511228 1:3062088-3062110 TTCACCCCAGTCCCCAGGGCAGG + Intergenic
900983087 1:6057685-6057707 TCCTCCGAAGGCCCCAGGGAGGG + Intronic
904034662 1:27552126-27552148 TCCTCCGCAGGCCGCCGGGCGGG + Exonic
915107794 1:153545194-153545216 TCCACTGCAGGCCCCTGGGCAGG - Intronic
918480725 1:184974270-184974292 TGCTCCCCAGGCCCCCGGGCGGG + Intronic
923682622 1:236130569-236130591 TTTACCTATGGCCCCAGGGCAGG - Intergenic
1066080861 10:31929024-31929046 TTGACCGCAGGCTCCCGCGCCGG - Intergenic
1073216899 10:101841403-101841425 GTCAACGAAGACTCCCGGGCGGG - Intronic
1075967613 10:126626217-126626239 ATCACAGAAGGCCCCAGGGAAGG + Intronic
1076743980 10:132503698-132503720 TTGTCCGCAGGCCCCCTGGCAGG + Intergenic
1077008663 11:370444-370466 TTCACCGAAGGCGCCCCCGCCGG - Intronic
1077278987 11:1733442-1733464 TGCACCCCAGGCCCACGGGCAGG + Exonic
1102043342 12:109814765-109814787 TCCAGCGAAGGCCCCCGCGCGGG - Exonic
1106248916 13:27969292-27969314 ATCACGGAAGGCCGCCGGCCTGG - Exonic
1112226082 13:97541771-97541793 TTCACCCAAGGGCCCTGTGCTGG - Intergenic
1117723155 14:58646548-58646570 TTCCCGGCAGGCCCGCGGGCGGG + Exonic
1119765042 14:77182581-77182603 TTCACCGAATGCCCTCTGGAGGG + Intronic
1122838357 14:104442426-104442448 TTCTCCGACGGACCCCGGGGTGG - Intergenic
1132826782 16:1909189-1909211 TTCACAGAGGGCACCCGTGCAGG + Intergenic
1132995573 16:2820761-2820783 ATCACAGAAGGCCCCGGGGAGGG - Intronic
1133279953 16:4659574-4659596 CTCACCAAAGGCCCCCTGGCGGG - Intronic
1133882879 16:9799394-9799416 TCCACCGAAGGCTCCAGGGAGGG - Intronic
1135046128 16:19157378-19157400 TTCAGAGAAGGCATCCGGGCTGG + Intronic
1137617116 16:49855067-49855089 TCCACCGAGGCCCACCGGGCAGG - Intronic
1143020671 17:3915869-3915891 TTCACCGAAGGCCCCCGGGCAGG + Intronic
1144575255 17:16425842-16425864 TTCAAGGAAGGCCACAGGGCAGG + Intronic
1150433947 17:65139676-65139698 TTCTCCTAATGCCCCTGGGCAGG + Intronic
1151439366 17:74118338-74118360 TTCACCCAGGGCCGCCTGGCAGG + Intergenic
1151558776 17:74860110-74860132 TTCGCCCAGGGCCCCCGGGCGGG - Intronic
1162494191 19:11013990-11014012 TTCCCAGAAAGCCCCAGGGCCGG + Intronic
1167015381 19:46837996-46838018 CTCACCAAGGGCCCCCAGGCTGG - Intergenic
1168696587 19:58407337-58407359 TTCAGGGAAGGCTCCCAGGCAGG + Intronic
942679573 2:178463038-178463060 TCCACCGTAGACCCCCGGACCGG + Intergenic
945033880 2:205687528-205687550 CTCCCCAAAGGGCCCCGGGCAGG + Intronic
947148095 2:227086960-227086982 TTCACTTAAGGCCCTCGGGTTGG + Intronic
1171223540 20:23421578-23421600 TTCCCAGGAGGCCCCGGGGCGGG + Intergenic
1175229789 20:57466437-57466459 TTCAACGACGGCCCGCAGGCTGG - Intergenic
1176034577 20:63029979-63030001 TTCACCAAGGGCCCCCTGCCCGG + Intergenic
1176090403 20:63316041-63316063 GTCATCGCAGGCCCCCAGGCAGG + Intronic
1179990650 21:44946794-44946816 TGCACTGAAGAGCCCCGGGCTGG + Intronic
1180072494 21:45443322-45443344 CTCATGGAAGGCCCCAGGGCAGG - Intronic
1181256835 22:21568113-21568135 TTCCCCGAAGGCGCCCGGTTTGG - Intronic
1182150204 22:28022250-28022272 TTCACAGATGGCCCCTGGACTGG - Intronic
1183500327 22:38175021-38175043 TTCCCTGAAGGACCCTGGGCAGG + Intronic
1184351551 22:43947405-43947427 TTCACCTCAGCCCCCCAGGCAGG + Exonic
1184735875 22:46397642-46397664 GTCACTGAAGGGCCCCGGGAGGG + Intronic
950663904 3:14483267-14483289 TTCACCAAAGGCCCCTGTGAAGG + Intronic
955374635 3:58384937-58384959 TTCACCTAAGGCCCCCAGAGAGG + Intronic
961324682 3:126103202-126103224 TCCACTGCAGGCCCTCGGGCTGG + Intergenic
962771020 3:138610089-138610111 TTCAGCAAAGGCCCCCAGGTAGG - Intronic
988716562 5:33834690-33834712 TTCACCCAAGTTCCCTGGGCAGG + Intronic
990487263 5:56271359-56271381 TACACCAATGGCCCCAGGGCAGG + Intergenic
1005416057 6:25601330-25601352 TGCACAGGAGGCCCCTGGGCAGG - Intronic
1014913860 6:127121105-127121127 CCCACCGAGGACCCCCGGGCTGG + Intronic
1035302360 7:157905999-157906021 TCCACCCAGGGCCCCCGTGCAGG + Intronic
1037173752 8:15923716-15923738 TCCACCCAAGGCCCCAGGGACGG + Intergenic
1040290550 8:46121913-46121935 ATCACAGAAGCCCCCAGGGCTGG - Intergenic
1049095910 8:140547950-140547972 CTCACCTAGGGCCCCAGGGCAGG + Intronic
1049385399 8:142340638-142340660 CTCACCAAAGGCCCCAGAGCTGG + Intronic
1053274513 9:36773030-36773052 TTCACCTATGGCCCCATGGCGGG - Intergenic
1060166610 9:121422557-121422579 TTCACTCAAGGCCCAAGGGCTGG + Intergenic
1060766444 9:126297770-126297792 TTTTCCGAAGGCCCCCAGGGTGG - Intergenic
1062008049 9:134251448-134251470 CTCACAGGAGGCCCCGGGGCAGG - Intergenic
1189361901 X:40359531-40359553 TTCACCGGAGGCCTCCGTGGTGG + Intergenic