ID: 1143023670

View in Genome Browser
Species Human (GRCh38)
Location 17:3929157-3929179
Sequence TCTGGGAGCTCCTGAAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 345}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143023657_1143023670 -3 Left 1143023657 17:3929137-3929159 CCCCTCTTCCGTCCCCCAGGTCT 0: 1
1: 0
2: 5
3: 24
4: 384
Right 1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG 0: 1
1: 1
2: 2
3: 37
4: 345
1143023658_1143023670 -4 Left 1143023658 17:3929138-3929160 CCCTCTTCCGTCCCCCAGGTCTG 0: 1
1: 0
2: 4
3: 29
4: 311
Right 1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG 0: 1
1: 1
2: 2
3: 37
4: 345
1143023648_1143023670 28 Left 1143023648 17:3929106-3929128 CCTGGGCACAGTCCCCTCAGCAA 0: 1
1: 0
2: 0
3: 25
4: 215
Right 1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG 0: 1
1: 1
2: 2
3: 37
4: 345
1143023656_1143023670 -2 Left 1143023656 17:3929136-3929158 CCCCCTCTTCCGTCCCCCAGGTC 0: 1
1: 0
2: 3
3: 49
4: 459
Right 1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG 0: 1
1: 1
2: 2
3: 37
4: 345
1143023659_1143023670 -5 Left 1143023659 17:3929139-3929161 CCTCTTCCGTCCCCCAGGTCTGG 0: 1
1: 0
2: 2
3: 35
4: 280
Right 1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG 0: 1
1: 1
2: 2
3: 37
4: 345
1143023653_1143023670 15 Left 1143023653 17:3929119-3929141 CCCTCAGCAAGGGGTTTCCCCCT 0: 1
1: 0
2: 0
3: 14
4: 147
Right 1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG 0: 1
1: 1
2: 2
3: 37
4: 345
1143023652_1143023670 16 Left 1143023652 17:3929118-3929140 CCCCTCAGCAAGGGGTTTCCCCC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG 0: 1
1: 1
2: 2
3: 37
4: 345
1143023654_1143023670 14 Left 1143023654 17:3929120-3929142 CCTCAGCAAGGGGTTTCCCCCTC 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG 0: 1
1: 1
2: 2
3: 37
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143023670 Original CRISPR TCTGGGAGCTCCTGAAGGTG GGG Intronic
900309087 1:2024799-2024821 TGTGGGAGCCCTTGCAGGTGGGG - Intronic
900461865 1:2805507-2805529 TCTGGGGGCTACTGTGGGTGAGG + Intergenic
902274866 1:15331926-15331948 TGTTGGAGTTCCTTAAGGTGCGG - Intronic
902410971 1:16211410-16211432 TCTGGAAGCTCCTGGAGGGCAGG + Intronic
902482544 1:16719328-16719350 TCTGGGAGCTCCCCCGGGTGGGG - Intergenic
902570216 1:17342287-17342309 TCGGGGAGCTCCTGCAGGGGAGG - Exonic
902801882 1:18835545-18835567 TCTGGGACTTCCTGCAGGAGAGG - Intergenic
903067658 1:20709812-20709834 TCTGGGTGCTCCTTCAGCTGAGG + Exonic
903228909 1:21910090-21910112 TCTGGCAGATTCTGGAGGTGGGG - Intronic
904879389 1:33683950-33683972 TCTGGAAGCTGCTGAACCTGTGG + Intronic
905390504 1:37633274-37633296 GCTGGGAGCTGCTGAGTGTGGGG + Intronic
906073101 1:43031818-43031840 TCTGTGAGTTCCTGGAGGTGGGG + Intergenic
906205758 1:43985505-43985527 TCAGGGAGATCCTGAGGATGGGG - Exonic
906310443 1:44750217-44750239 TCTAGGAGCTCCTGAGGGCAAGG - Intronic
906606970 1:47179598-47179620 TCTGGGAGCTCCTCAAGGGCAGG - Intergenic
907480877 1:54744881-54744903 CCTGGGAGCTCCTCAAGGGCAGG - Intergenic
908967587 1:69784494-69784516 ACTGTGAGCTCCTCAAGGAGAGG - Intronic
909992610 1:82241103-82241125 TCTGGCAGCTCATAATGGTGGGG - Intergenic
910600585 1:89027639-89027661 TCTTGAAGCTCTTTAAGGTGAGG + Intergenic
910934413 1:92475853-92475875 TCTGGCAGCTCCAGGAGGTAAGG + Exonic
911102089 1:94103268-94103290 TCTGGGAGCCCCTAGAGGTGAGG + Intronic
915581554 1:156816053-156816075 TCTGGAAGGTGCTGAAGGTTGGG + Exonic
915640148 1:157218599-157218621 TCTGGGAGCTCCTCCAGGACAGG + Intergenic
915878106 1:159634591-159634613 TCTGGAAGCTCCACAATGTGAGG + Intergenic
915897741 1:159824697-159824719 TCTGTGAACTCCTTAAGGTCAGG + Intergenic
915981869 1:160425407-160425429 TCTGGGGGGTCCTGAGGGGGTGG + Exonic
916752357 1:167734636-167734658 TCAGGAGGCTCCTAAAGGTGAGG - Intronic
919779131 1:201211436-201211458 TTTGGGAGCTCCTGAGGGAATGG + Exonic
920036290 1:203067917-203067939 ACTGGGAGCTCCCTAAGGTGAGG - Intronic
920688934 1:208131097-208131119 TCTGGGTGCCCCTGAGGGAGGGG - Intronic
921259928 1:213377159-213377181 TCTGAGACTTCCTGAACGTGGGG + Intergenic
923758647 1:236818430-236818452 TCTTGGGGCTCCTGGAGGTGAGG - Intronic
924325758 1:242892557-242892579 CCAGGAAGCTCCTGAAGGAGGGG + Intergenic
1062903901 10:1166778-1166800 TCTGGGAGCTCCTGATAGTCAGG - Intergenic
1064030774 10:11881227-11881249 GCTGTGACCTCCTGGAGGTGGGG + Intergenic
1064172011 10:13042011-13042033 TCTGGGATCTCCTGAGTCTGGGG - Intronic
1064345983 10:14533294-14533316 TCTGGGACTTCCTGAAGGACTGG + Intronic
1064381216 10:14843387-14843409 TGTGGGAGCTGCTGTAGCTGGGG - Intronic
1065195641 10:23262387-23262409 TCTGTGGGCTCCTGAATGTCAGG + Intergenic
1067078626 10:43201895-43201917 TCGTGCAGCTCCTGAAGGAGTGG - Exonic
1069559978 10:69422511-69422533 TCTGGGAGGTCATGAGGGAGGGG + Intergenic
1069799400 10:71072795-71072817 TCTGGGAGCTGAGGAAGGGGTGG + Intergenic
1070776292 10:79111714-79111736 TCTTGGAGCTCCCTAAGGTGAGG - Intronic
1070840366 10:79482798-79482820 TCTAGTAGCTCCTGCAAGTGGGG - Intergenic
1071524206 10:86348738-86348760 TCCGGGAGCTCCTGGATGTCAGG - Intronic
1073469229 10:103712537-103712559 CCTTGGAGCTCCTGAGGCTGGGG + Intronic
1076194915 10:128510904-128510926 TCTGGGAGCTTCAGGAGGCGAGG + Intergenic
1076878171 10:133227046-133227068 ACGGGGAGCTCCTGCAGGTGGGG + Intergenic
1076879914 10:133235266-133235288 TCTGGGACCACCTGAGGGGGAGG - Intergenic
1077048966 11:558238-558260 TGTGGGAGCTCCTGGAGGAGGGG + Exonic
1077213029 11:1382294-1382316 GCTGGGAGCACCTGGTGGTGGGG + Intergenic
1077529063 11:3086698-3086720 TCAGGGTGCCCCTGAAGGCGGGG - Intergenic
1078454400 11:11463977-11463999 TCTGTGAGCACCTGAAGCAGAGG + Intronic
1078935159 11:15943177-15943199 TAAGGGAGCTCCTGGTGGTGTGG + Intergenic
1079225086 11:18598071-18598093 TCTTGGAGTTCCTGAAGGGCAGG + Intergenic
1079257062 11:18840093-18840115 TCTGGGTGCTCCTGTATTTGGGG - Intergenic
1081686724 11:45048239-45048261 TCTAGGAGGTCAAGAAGGTGAGG - Intergenic
1081712243 11:45224804-45224826 TCTGGGAGCTCCAGTACCTGTGG - Exonic
1083330997 11:61898326-61898348 TCTGGGAGATCATGAGGTTGCGG - Exonic
1083547435 11:63559351-63559373 TGTGGGAGCTCCAGTAGGTGAGG + Intronic
1084150904 11:67287543-67287565 TCAGGGAGCCCTTGAAGGTGCGG + Intergenic
1084220342 11:67674120-67674142 CCTGGGAGCTCCTCAAAGGGAGG + Intronic
1085186138 11:74577539-74577561 GCTGTGAGCTCCTGAAGGCCAGG - Intronic
1085195754 11:74670694-74670716 CCTGGGAGCTCCTGAGGGCAAGG - Intergenic
1085226142 11:74922959-74922981 GCTGGGAGCTCCTAAAGGGCAGG - Intronic
1085283312 11:75344750-75344772 ACTGGGGGCTCCTGAAGTTGGGG - Intronic
1087514799 11:99144536-99144558 TCTGGGAGTTCCAGGAGGAGAGG - Intronic
1088173587 11:107024263-107024285 CCTGGGGGGTCCTGAAGGAGAGG - Intergenic
1088329380 11:108634332-108634354 TCTGGTGGCTCTGGAAGGTGTGG - Intergenic
1089623916 11:119739449-119739471 CCTGGAAGGTCCTGAGGGTGGGG + Intergenic
1089847252 11:121468073-121468095 TCTGAGAGCACCTCAAGGAGTGG + Intronic
1090414376 11:126530593-126530615 GCTGCGAGCTCCTGGAGGGGTGG - Intronic
1090696789 11:129252889-129252911 TCAGGGAGCTTCTCTAGGTGGGG - Intronic
1091107705 11:132938241-132938263 TCTGGGGGCTCCTGGAGCTTAGG - Intronic
1091849417 12:3683278-3683300 TGTGGGAGGTAATGAAGGTGAGG - Intronic
1093093499 12:14946867-14946889 TATTGGAGCACCTGAAGGTTTGG - Intronic
1093478993 12:19585182-19585204 TCTGTGAGCTCCTTAAGGGTAGG + Intronic
1094461602 12:30702496-30702518 TCTCAGAGGTCCTGAAGCTGAGG - Intergenic
1096107101 12:49002746-49002768 TCTGGGAGCTAGGGAAGGTATGG - Exonic
1096531427 12:52244975-52244997 TCTTCGAGCTCCTGCAGCTGGGG + Intronic
1096601918 12:52735709-52735731 TCTGGTAGCCCCTGAACATGGGG - Intergenic
1097198697 12:57259966-57259988 TCAGGAAGCTACTGAAGGTCGGG + Intronic
1099425906 12:82522563-82522585 CCAGGGAGCTACTGAAGGAGTGG + Intergenic
1101494552 12:105241326-105241348 TCTTGGAGCACAGGAAGGTGAGG + Intronic
1102146491 12:110658641-110658663 TCTGAGAGGTCCTGGGGGTGGGG - Intronic
1102950990 12:117031296-117031318 GCTGGGAGCGCCTGTAGGGGAGG - Intergenic
1103516561 12:121512198-121512220 GCTGGGAGCTCCAGAAGGGCAGG + Intronic
1103836348 12:123824174-123824196 AGTGGGACCTCCTGGAGGTGTGG + Intronic
1104343440 12:127973553-127973575 ACTGGGAGCCCCTGCAGGGGAGG + Intergenic
1104521144 12:129476469-129476491 TCTGTGACCTCAGGAAGGTGTGG - Intronic
1104637445 12:130447121-130447143 TGTGGGCACTCCTGAAGGCGTGG - Intronic
1104716359 12:131018902-131018924 TCTGTGAGGTCCTGCAGGTGGGG + Intronic
1105018175 12:132798800-132798822 TCTCTGAGCCCCTGTAGGTGAGG + Intronic
1110328993 13:74249858-74249880 TCTGGAAGTTCCTGAGGCTGGGG + Intergenic
1110374482 13:74776849-74776871 TTTGGAAGCTCCTGGGGGTGAGG + Intergenic
1112718316 13:102212530-102212552 TCTTTAAGCTTCTGAAGGTGAGG + Intronic
1112722826 13:102264659-102264681 TCTGGGAGCTAAAGATGGTGGGG + Intronic
1113585693 13:111462773-111462795 CCTGGGAGCTACTGAGGCTGAGG + Intergenic
1113953173 13:114083436-114083458 GCTGGGTGCTTCTGGAGGTGTGG - Intronic
1113991662 14:16032451-16032473 TGTGGGGGCTGCTGAAGGTTGGG - Intergenic
1114502568 14:23181967-23181989 GCTGGGAGGTGCTGAAGGTGGGG - Intronic
1116939072 14:50772295-50772317 GCCAGGAGATCCTGAAGGTGTGG - Exonic
1118903054 14:70002531-70002553 TCTGGGAGCCCCTGATGAGGGGG - Intronic
1119756392 14:77122961-77122983 TCAGGGAGCTCCTGCAGCTCTGG - Intronic
1119942448 14:78656004-78656026 TCTGGGAGGTCATGAAGGTCAGG - Intronic
1120007538 14:79376729-79376751 CCTGGGAGCTCTCCAAGGTGTGG + Intronic
1121277246 14:92676758-92676780 TCTGTGAGCTCCTGCAGGACAGG - Intronic
1121412005 14:93754678-93754700 TCTGGGAGCTCATGACTGTAAGG - Intronic
1121615735 14:95312264-95312286 TCTGGGAGCTCGGGATGGAGGGG - Intronic
1121724723 14:96138847-96138869 GCTGTGAGCACCAGAAGGTGGGG + Intergenic
1121974044 14:98385842-98385864 CCAGGGAGGTCCTGAAGGTTGGG + Intergenic
1122123072 14:99564933-99564955 CATGGAAGCTCCAGAAGGTGCGG + Intronic
1122207330 14:100154497-100154519 GCTGGGAGCCCATGGAGGTGGGG + Intronic
1122297702 14:100714530-100714552 ACTGGAAGCTCCTGGAGGGGTGG - Intergenic
1122738719 14:103858559-103858581 TCTGGCAGCCCCTGAGGCTGTGG + Intergenic
1122954799 14:105065635-105065657 CCTGGGAGCTCCTGAGTGAGTGG - Intergenic
1123052160 14:105549758-105549780 GCTGGCAGCTCCGGGAGGTGGGG + Intergenic
1123160887 14:106276999-106277021 TCTGGGGGCTTCTGTAGGGGAGG + Intergenic
1123208608 14:106737563-106737585 TCTGGGGGCTTCTGTAGGGGAGG + Intergenic
1123481902 15:20639906-20639928 TCTGGGGGCTTCTGTAGGGGAGG + Intergenic
1123636111 15:22360459-22360481 TCTGGGGGCTTCTGTAGGGGAGG - Intergenic
1125592314 15:40862377-40862399 TCTGGGAGCCACTGCAGGTGGGG - Intergenic
1126669149 15:51100673-51100695 TCAGGGATCTCCCCAAGGTGGGG + Intronic
1126925240 15:53578196-53578218 ACTGTGAGCTCCTGAAGGGAGGG - Intronic
1127517678 15:59712278-59712300 TGTGCAGGCTCCTGAAGGTGAGG + Intergenic
1128744753 15:70105781-70105803 TCTGGCAGCTCCTCCAAGTGGGG + Intergenic
1129229534 15:74189109-74189131 TCTGTGGGCTCTGGAAGGTGAGG - Exonic
1129714227 15:77837693-77837715 ACTGGGAGCTCTTGAGAGTGGGG - Intergenic
1131118655 15:89809572-89809594 TTTGTGTGTTCCTGAAGGTGGGG - Intronic
1131480160 15:92773821-92773843 TCTGTGAGTTCCTGAAGGTCAGG - Intronic
1131545769 15:93314486-93314508 TCTGGGAGCCGGTGAAGGTCTGG + Intergenic
1131967950 15:97865439-97865461 TCTGGGAGCTTCTAAAGGAGGGG + Intergenic
1132574032 16:656571-656593 GCCGGGAGGTCCTGAAGCTGGGG + Intronic
1132580418 16:682265-682287 TCGAGGAGCACCTGCAGGTGAGG + Exonic
1132866191 16:2093805-2093827 GCTGGGAGCCACTGAAGGTGAGG - Exonic
1133254243 16:4506906-4506928 TCTCGGAGCTCCTGAAGGAAGGG + Exonic
1133729629 16:8568653-8568675 TCTGGGAGGTGCTGATGGTTTGG - Intergenic
1133962033 16:10503001-10503023 TCTGGGAATTCCTGAAACTGAGG - Intergenic
1134231925 16:12436277-12436299 TCTGTGAGCTCCTTAAGCTGCGG - Intronic
1135078515 16:19414259-19414281 ACTGGGAGCTCCTCAAGTTTGGG - Intronic
1135568227 16:23528482-23528504 TCTGGCAGCTCCTGAACATTTGG + Intronic
1135587079 16:23679517-23679539 TCTGGGAGCTGCTAGAGGAGGGG + Intronic
1135823468 16:25705275-25705297 TTTGGGAGCCCCTGGAGATGAGG + Intronic
1136010867 16:27362843-27362865 TCAGGGAGTTGCTGAAGCTGCGG - Exonic
1136690590 16:32025598-32025620 GCTGGGAGCTGTTGAAGGTTTGG - Intergenic
1136791178 16:32969162-32969184 GCTGGGAGCTGTTGAAGGTTTGG - Intergenic
1136878636 16:33884770-33884792 GCTGGGAGCTGTTGAAGGTTTGG + Intergenic
1136910972 16:34144021-34144043 TGTGGGGGCTGCTGAAGGTTGGG - Intergenic
1139640500 16:68288130-68288152 CCTAGGAGCTCCTGAAGCTTGGG + Intronic
1139959848 16:70711188-70711210 TCGTGGACCTCCTGGAGGTGAGG - Intronic
1141240289 16:82259610-82259632 ACAGGGAGCTTCTGAAGGTAAGG + Intergenic
1141432729 16:83979219-83979241 TCTGATCCCTCCTGAAGGTGGGG - Intronic
1141767465 16:86067988-86068010 TTTGGGAGCTGCTGCAGGTCAGG + Intergenic
1142142870 16:88480308-88480330 TCTGGCACCTCGTGAGGGTGGGG + Intronic
1142253674 16:89003704-89003726 GCTGGGTGCCCCTGATGGTGGGG - Intergenic
1203093387 16_KI270728v1_random:1230624-1230646 GCTGGGAGCTGTTGAAGGTTTGG - Intergenic
1142590756 17:1004761-1004783 ACTGGGAACTCCAGAAGTTGTGG - Exonic
1143018424 17:3904082-3904104 ACTGGGAGCTCCTGGAGAAGGGG - Intronic
1143023670 17:3929157-3929179 TCTGGGAGCTCCTGAAGGTGGGG + Intronic
1143285492 17:5786065-5786087 TCTGAGAGGGCCTGATGGTGGGG - Intronic
1143483142 17:7238560-7238582 CCTGGGAGTTGCTGAGGGTGAGG - Intronic
1144093744 17:11881397-11881419 ACTTGGAGCAGCTGAAGGTGAGG + Exonic
1144675192 17:17157469-17157491 ACTGGGACCTCCTAAGGGTGAGG - Intronic
1146890672 17:36504509-36504531 GCTGGGCACTGCTGAAGGTGTGG - Intronic
1147153451 17:38531741-38531763 GCTGGGAGCTGTTGAAGGTTTGG - Exonic
1148483533 17:47975972-47975994 TCAGGAAGCTCCTCGAGGTGGGG - Exonic
1148649554 17:49239810-49239832 TGTGGGAGCTCCTGATCCTGGGG - Intergenic
1148778308 17:50108216-50108238 TCTTTGAGCTCTTCAAGGTGAGG + Exonic
1149297362 17:55272931-55272953 GCTAGGAGATCCTGAAGGGGAGG + Intronic
1149781235 17:59398076-59398098 TTTGGGAGCTCCTGAAGAAATGG + Exonic
1151218486 17:72593532-72593554 TCTTGGAGGTCCTGAAGATTAGG + Intergenic
1151624033 17:75265527-75265549 ACTGGGGTCACCTGAAGGTGAGG + Intronic
1152244598 17:79178594-79178616 TCTGGAATCTGCTGAGGGTGTGG - Intronic
1152286480 17:79415924-79415946 TCTGGGGGCGTCTGCAGGTGAGG - Intronic
1152492013 17:80641542-80641564 TCTTGGAGATCCTGCGGGTGTGG + Intronic
1152739523 17:82012808-82012830 CCTGAGGGCTCCTGAGGGTGGGG + Intronic
1153059730 18:982722-982744 TCTGAGAGCTTCTAAATGTGAGG - Intergenic
1154077998 18:11224070-11224092 TCTGCATCCTCCTGAAGGTGGGG - Intergenic
1157603881 18:48913514-48913536 TCTGGGAGCTCCTTGAGGTCAGG - Intergenic
1157778980 18:50420697-50420719 GTTGGGAGGTCCTGACGGTGAGG + Intergenic
1158949844 18:62483868-62483890 TCTGGTTGCTCCTGAAGGGAAGG + Intergenic
1161028585 19:2047799-2047821 TCTGGGGCCTGCTGAAGGTGGGG + Intronic
1161720596 19:5900158-5900180 GCTGGGGGCTCCTGGAGGGGTGG - Intronic
1162458876 19:10802653-10802675 TCTGAGAAGTCCTGAAGGAGAGG - Intronic
1162722971 19:12673300-12673322 TCTGGGACCTGGTGGAGGTGAGG + Exonic
1163103175 19:15109547-15109569 TCTGGGAGCATCTGACGGGGTGG - Intronic
1164055668 19:21620212-21620234 TCTGGTAGCCCCTGAAGGGGTGG + Intergenic
1164638015 19:29805637-29805659 CCTGGGAGCTCCTGGAGGGCAGG + Intergenic
1164713373 19:30375010-30375032 TCTGGGAGCGGGGGAAGGTGAGG + Intronic
1165408778 19:35645710-35645732 ACTGTGAGCTCCTTAAGGGGAGG - Intergenic
1165756568 19:38296693-38296715 AATGGCAGCTCCTGAATGTGGGG + Intronic
1166046031 19:40231798-40231820 CCTGGGAGCTCCTGAGCGTTTGG - Exonic
1166682315 19:44776702-44776724 TCTGGGTGCCCCTAATGGTGTGG - Intergenic
925853797 2:8110138-8110160 TCTGGGGGCTCAGGAGGGTGAGG + Intergenic
927143670 2:20146344-20146366 AATGGGAGCTACTGAAGGTTTGG - Intergenic
928242894 2:29601935-29601957 TCTGAGGACACCTGAAGGTGGGG + Intronic
930533655 2:52620638-52620660 GCTGTGAGCTCCTGAAGATAGGG - Intergenic
931982679 2:67711212-67711234 TCTGGAAACTCCTGAAGGGTGGG - Intergenic
933787066 2:85851689-85851711 CATTGCAGCTCCTGAAGGTGCGG - Intronic
935022288 2:99243320-99243342 TCTGGGAGATGCTGAACTTGAGG + Intronic
935538917 2:104326428-104326450 TGTGGGAGCACCTGATGGTCAGG + Intergenic
935681600 2:105643002-105643024 CCTGAGAGCTCCTGATGGGGGGG - Intergenic
936479656 2:112874283-112874305 CCTGAGAGCTCCTGAAGGGTTGG + Intergenic
938103290 2:128512754-128512776 GCTGGGAGCTCCTCAGGGGGAGG - Intergenic
938697253 2:133845411-133845433 TCTGGTAACTCTTGGAGGTGGGG - Intergenic
938733086 2:134161469-134161491 CCTGGGAGATCCTGCAGGAGGGG - Intronic
940039674 2:149347264-149347286 TTTGGGAGATCATGATGGTGGGG - Intronic
940659080 2:156524148-156524170 ACTGGGGGCTCCAAAAGGTGGGG - Intronic
945542543 2:211106217-211106239 GCTGGGAGCTATAGAAGGTGAGG + Intergenic
946007848 2:216540813-216540835 CCTGGGAGCTCCTCAAGGGCAGG + Intronic
946827775 2:223696314-223696336 TCTGGGGGCTGCAGAATGTGGGG - Intergenic
948482921 2:238261754-238261776 TCTGTGAGCTCCTGAATGCTGGG + Exonic
1168791910 20:583447-583469 TCTTGGGGCTGCTGAGGGTGAGG - Intergenic
1169037152 20:2462865-2462887 TCTGGGAGCTGCTGAGAGGGTGG - Intronic
1169511539 20:6269334-6269356 ACTGGGAGCTCCTGAAGACAGGG + Intergenic
1169558800 20:6776573-6776595 TCTAGCAGCTCCTCAAGGAGGGG - Intronic
1170475943 20:16714570-16714592 TCTTGGAACCCCTGTAGGTGGGG + Intergenic
1170575020 20:17655911-17655933 CCTGGGAGCTGCTGATGCTGTGG - Intronic
1171124166 20:22587054-22587076 TCTGGGAGCTCCGGTAGGGTAGG + Intergenic
1171937177 20:31286057-31286079 TCAGGAAGCTCCTCGAGGTGGGG + Intergenic
1172632486 20:36388403-36388425 TCTGGGGGCTCCAGGAGCTGGGG - Intronic
1172899655 20:38325140-38325162 TCTGGGAGCTCCAGGAGGGTAGG - Intronic
1173193856 20:40897500-40897522 TCAGGGAGCCCCTGAGGGTGTGG - Intergenic
1174323769 20:49762772-49762794 TTGGGGAGCTCCTGGAAGTGAGG + Intergenic
1174742185 20:53025846-53025868 TCGAAGAGCTCCTAAAGGTGAGG - Intronic
1175403850 20:58714912-58714934 CCCGGGAGCTCCTCAGGGTGGGG - Intronic
1175692128 20:61073151-61073173 TCTGGAAGCTGCAGAAGGCGAGG - Intergenic
1177215861 21:18127898-18127920 GATGGGAGTTCCTGAAGGAGAGG + Intronic
1179454651 21:41490801-41490823 CCTGGGAGCTCCTGGACCTGGGG - Intronic
1179655108 21:42839887-42839909 GCTGGGAGCGCCTGTGGGTGAGG + Intergenic
1180231724 21:46430427-46430449 GCTGGGAGCTCCAGGAGGGGAGG - Intronic
1180315608 22:11275076-11275098 TGTGGGGGCTGCTGAAGGTTGGG + Intergenic
1180863157 22:19099088-19099110 TCTGGAAGCAACTGAAGATGTGG + Intronic
1180979223 22:19870960-19870982 TCAGGGGGCTGCTGCAGGTGAGG + Intergenic
1181681182 22:24496773-24496795 TGTGGGAGATTCTGGAGGTGAGG + Intronic
1181854800 22:25774214-25774236 CCTGGGAGTGACTGAAGGTGTGG - Intronic
1182045970 22:27274378-27274400 TCTGGGATGGGCTGAAGGTGAGG + Intergenic
1182356593 22:29724944-29724966 TCTGGGAGCTCCCGAAGGGTAGG + Intronic
1182653432 22:31870676-31870698 TCTGGGAGTTCCCAAAGGTCTGG - Exonic
1183099542 22:35575447-35575469 GCAGGGAGCTCCTGAGGCTGCGG - Intergenic
1183417845 22:37692718-37692740 TGTGGGAGCTCCTGGAGTGGGGG + Exonic
1183425129 22:37735090-37735112 TCTTGGAGCTCCTGCAGGCCAGG + Exonic
1183489460 22:38108888-38108910 TCTGGAGGCACCTGAAGGAGGGG + Intronic
1184324421 22:43772171-43772193 GCTGGGAGCTCCTCAAGGGCAGG + Intronic
1184726895 22:46352314-46352336 TCTGGGAACACATAAAGGTGAGG + Exonic
1184743028 22:46440015-46440037 CCTGTGAGCTCCTGAAGGGCAGG + Intronic
1184853117 22:47132161-47132183 AATGGGGGCTCCTAAAGGTGGGG - Intronic
1185167307 22:49269638-49269660 TCTGAGAGCTCCTGTCGTTGGGG - Intergenic
1185236357 22:49715775-49715797 TCTGGGACCACCTTCAGGTGAGG - Intergenic
950008466 3:9705704-9705726 GCTGGGACCTGCAGAAGGTGAGG + Exonic
950199765 3:11034671-11034693 TCAGGGAGCCCTTTAAGGTGAGG - Exonic
950890287 3:16398633-16398655 CCTGGGAGCTCCTGAAGGTGAGG - Intronic
951704930 3:25534890-25534912 TCTGGGTGCACCTGAAGGAAGGG - Intronic
952961115 3:38589685-38589707 GCTGAGAGCTCCTACAGGTGGGG + Intronic
953245119 3:41183850-41183872 TCAGGAAGCACCTGAAGATGGGG + Intergenic
953405381 3:42657273-42657295 TCTGGAAGCCCCAGATGGTGTGG + Intronic
954748544 3:52800778-52800800 TCTGGGAGCCCCTCAAGGGCAGG + Intronic
957772079 3:84707463-84707485 TTTGGGAGCTTCTGAGGGTCAGG + Intergenic
959104214 3:102047960-102047982 TCTGGGAGATTCTGAAAGTTGGG - Intergenic
960226265 3:115172791-115172813 TGTGAGAGATCCTGAAGCTGAGG + Intergenic
961025348 3:123550795-123550817 TGTGGGAGCCACTGAAGCTGTGG + Intronic
961100865 3:124197878-124197900 TCGGAGAGCAGCTGAAGGTGGGG - Intronic
961116505 3:124334425-124334447 TCTGGCAGCACCGCAAGGTGCGG + Exonic
962722397 3:138187802-138187824 TCCGGGAGCTCCCGCCGGTGCGG + Intronic
963452747 3:145505525-145505547 TCTTGGAGCTCCTGAAGGAGGGG - Intergenic
964547919 3:157855633-157855655 CCTGGGAGCTTCTGCAGGAGTGG - Intergenic
966024466 3:175259119-175259141 TCTGTGAGCCCCAGAACGTGTGG + Intronic
966994777 3:185268842-185268864 TCTGGGAGCTCCTGGAACTGGGG - Intronic
967967466 3:194973476-194973498 CCTGGGAGCACCTGTGGGTGGGG - Intergenic
968964201 4:3761347-3761369 GCTGTGAGCTCCTGGGGGTGGGG - Intergenic
969060911 4:4433664-4433686 TCTGGGAGCTGCTGTAGGTGGGG + Intronic
969184379 4:5464465-5464487 GCTGGGAGCTTCGGAGGGTGAGG + Intronic
970179334 4:13373476-13373498 TCTGGGAGCTCCTTGAGGATAGG + Intronic
971517779 4:27510237-27510259 TCTGCAAGCTCCTTTAGGTGCGG + Intergenic
972390014 4:38605516-38605538 GCTGGGAGGTCCTAAAGGTTGGG - Intergenic
973636126 4:52862964-52862986 CCTGGGAGGTCTTGAAGGTTAGG + Intronic
974219720 4:58950914-58950936 TCCTGGACCTCCTGAGGGTGAGG - Intergenic
978196911 4:105982734-105982756 TCTGGGTGCTCCTGTATTTGGGG + Intronic
980011445 4:127599383-127599405 TCTAGGTGCTGCAGAAGGTGGGG - Intergenic
980243272 4:130203560-130203582 TCTGGGAGCTCCTGGAGCCAGGG + Intergenic
981599179 4:146466485-146466507 TCTGTGAGCTCCTGATCTTGGGG - Intronic
982129184 4:152212106-152212128 GCAGGGAGCTCTTGACGGTGTGG - Intergenic
983410906 4:167396780-167396802 TCTGGCAGCACCTCAAGCTGAGG - Intergenic
984160357 4:176245040-176245062 TCTGGGAACTCCTGAAGAGCTGG - Intronic
985423172 4:189804251-189804273 TCTGAGAGCTCCTAAAGAAGTGG + Intergenic
985937635 5:3108979-3109001 TCTGGGAGCTCCTGCAGTAGAGG - Intergenic
986789270 5:11144373-11144395 TCGGGGAGCTCGGGAAGGTTTGG + Intronic
992739230 5:79756338-79756360 GCAGGAAGCTCCTGAAGATGAGG - Intronic
999142544 5:149371996-149372018 TCTGGGGGCTCCTGATGCTTGGG + Intronic
1000307341 5:160006979-160007001 TCTGTGAGCTCCTGATGATGGGG + Intergenic
1001559437 5:172659641-172659663 TCTGGGGGCTGCTGAAGGGTTGG - Intronic
1003260413 6:4511222-4511244 TTTGGGGGCAGCTGAAGGTGGGG + Intergenic
1003338124 6:5194224-5194246 ACTGAAAGCTCCTGAAGGTTTGG + Intronic
1003577615 6:7312737-7312759 TCTGGCCGCTCCTGCAGGCGAGG + Intronic
1004449037 6:15727596-15727618 GCTGAGAGTTCCTGGAGGTGTGG + Intergenic
1005493981 6:26372898-26372920 GCTGGGCGCTCCTGAAGAAGGGG - Exonic
1005498457 6:26409534-26409556 TCTGGGCGCTCCTGAAGAAGGGG - Exonic
1005503219 6:26448249-26448271 GCTGGGCGCTCCTGAAGAAGGGG - Exonic
1005755207 6:28920006-28920028 CCAGGGAGCTCCTGCAGGTAAGG - Exonic
1005893404 6:30158393-30158415 CAAGGGAGCTCCTGACGGTGAGG - Exonic
1006151330 6:31991781-31991803 CCCGGGGCCTCCTGAAGGTGGGG - Exonic
1006157631 6:32024519-32024541 CCCGGGGCCTCCTGAAGGTGGGG - Exonic
1006455011 6:34126661-34126683 TCTGCGAGCTCCTGGCTGTGGGG - Intronic
1007220953 6:40278326-40278348 TATGAGGGCACCTGAAGGTGAGG + Intergenic
1007531555 6:42547493-42547515 TCTGGGAATTCCTGAGGGAGGGG + Intergenic
1007664645 6:43507096-43507118 TCTGGCAGCTCCTGGCAGTGTGG - Exonic
1007740142 6:44004995-44005017 TCAGGGAGCTCCAGATGGAGGGG - Exonic
1007952611 6:45885724-45885746 TTTGGGAGCTCCAGAATGAGAGG - Intergenic
1008543851 6:52568578-52568600 TCTGGGAGCTCCTGACCTGGAGG - Intronic
1010065933 6:71682308-71682330 CCTGGTAGGTCCTTAAGGTGGGG + Intergenic
1014911051 6:127093325-127093347 ACAGGGAGCTCCTAATGGTGAGG - Intergenic
1014947469 6:127515572-127515594 TCTTGGAGCTGCTGCGGGTGCGG + Exonic
1015579359 6:134706508-134706530 TTGAGGAGCTCCTGAAGTTGAGG - Intergenic
1018792128 6:167156952-167156974 GATAGGAGCTCCTGAAGGTGGGG + Exonic
1019159663 6:170061350-170061372 GGTGGGGGCTGCTGAAGGTGGGG - Intergenic
1019899136 7:4006343-4006365 TCTGAGAGTCCCTGAAGGGGAGG + Intronic
1020026707 7:4904813-4904835 CCTGGGAGCTCCTGGAGGGAGGG - Intergenic
1020097726 7:5377862-5377884 TCTAGGAGCCCCTGGGGGTGAGG - Intronic
1020180023 7:5915087-5915109 TCACGGAGCTGCTGGAGGTGGGG - Intronic
1020245273 7:6424498-6424520 TCTGGGAGCTCCTGTGGCGGGGG + Intronic
1020302911 7:6809795-6809817 TCACGGAGCTGCTGGAGGTGGGG + Intronic
1022001572 7:26230969-26230991 TCTGGGAGCACATGGATGTGTGG - Intergenic
1022501941 7:30887331-30887353 TGTGTGAGCTCCAGAAGGTCTGG + Intronic
1022965199 7:35465928-35465950 GCTGTGAGCTTCAGAAGGTGAGG + Intergenic
1023183980 7:37514474-37514496 TATGGGAGCTCCAGAGGATGGGG + Intergenic
1023279629 7:38556389-38556411 GCTGTGAGCTCCTGAAGGCCTGG - Intronic
1024209537 7:47191843-47191865 GCTGGAGGCTCCTGGAGGTGGGG - Intergenic
1024365018 7:48510408-48510430 GCAGGGAGCACCTTAAGGTGAGG + Intronic
1025998789 7:66545192-66545214 GCTGGGGGCTCCTGAAGGCTAGG - Intergenic
1030913876 7:115288072-115288094 TCTGAGACCTCATGAAGGTAAGG - Intergenic
1031426549 7:121612324-121612346 TCTGAGATTTCCTTAAGGTGAGG - Intergenic
1033506532 7:142008223-142008245 ACTAGAAGCTCATGAAGGTGGGG - Intronic
1033990458 7:147278096-147278118 TCTAGGAGCTCAGGAAGGGGTGG + Intronic
1034499047 7:151438459-151438481 ACTGTGAGCTCCTAAGGGTGGGG - Intronic
1035557935 8:580335-580357 TCTGGGAGCTGGGAAAGGTGAGG - Intergenic
1035640276 8:1179447-1179469 TGGGGACGCTCCTGAAGGTGTGG - Intergenic
1035670106 8:1410347-1410369 GCTGGGAGCTCCTCACCGTGAGG - Intergenic
1037343983 8:17878468-17878490 ACTGGGGGCTCCTGAAGAAGGGG + Intronic
1037443309 8:18939242-18939264 TCTGGAAGTTCATGAAGCTGGGG + Intronic
1038730003 8:30118513-30118535 TCTGAGATCTCCTGAAGGAGTGG + Intronic
1039829588 8:41202303-41202325 GCAGGGTGCTGCTGAAGGTGGGG - Intergenic
1041053009 8:53955976-53955998 TCATGGAGCTCCTGGAGATGTGG + Intronic
1041317049 8:56574900-56574922 GCTGGGAGCCCCTGCAGTTGTGG - Intergenic
1043079364 8:75746330-75746352 TATGATAGCTCATGAAGGTGGGG + Intergenic
1043666218 8:82818069-82818091 TCTGGGCGTTCCTTAAAGTGGGG + Intergenic
1047049871 8:121098891-121098913 TCTGTGAGGTCCTGAAGGACAGG - Intergenic
1047119531 8:121885568-121885590 TCTGTGAGCTCCTGAACATATGG + Intergenic
1049276187 8:141721206-141721228 TCTGGGGGCTGCTGAGTGTGTGG - Intergenic
1049342959 8:142123570-142123592 CCTGGGAGCCCCTGGGGGTGAGG - Intergenic
1049424212 8:142530870-142530892 CCCGGGAGCTGCTGAAGGGGAGG - Intronic
1052364370 9:27595763-27595785 CCTGGGAGCTCCCGAAGCTAGGG + Intergenic
1052981271 9:34451444-34451466 TCAGGGAGCTCCAGAGCGTGTGG - Intronic
1053860029 9:42377656-42377678 TGTGGGAACTCCCGAAGCTGCGG + Intergenic
1055658511 9:78476486-78476508 TCTGGAAGCTGCTGAATATGTGG + Intergenic
1056099541 9:83287586-83287608 TCTGGGGGATGGTGAAGGTGAGG - Intronic
1056588299 9:87943945-87943967 TCTGGGCCCTCCCGAAGCTGAGG - Intergenic
1057197917 9:93125285-93125307 TATGGGGGCTACAGAAGGTGGGG - Intronic
1057753262 9:97809445-97809467 GCTGGGAGCTCCTGGAGGGCAGG - Intergenic
1058804343 9:108576814-108576836 TTTGGGAGAGCATGAAGGTGGGG - Intergenic
1058897661 9:109413994-109414016 TTTGGGAGCTTCTCAAGGTCAGG + Intronic
1059663259 9:116422310-116422332 TCTGGGAGTTCCTTAAGGGGAGG + Intergenic
1060396369 9:123319574-123319596 TTTGGGACCCCCTGAATGTGAGG - Intergenic
1060857441 9:126926270-126926292 TCTTGGTGCTCCTGAGGGTAGGG - Intronic
1060985203 9:127815714-127815736 TCTGGGTGCTCCCGATGCTGTGG + Exonic
1061476615 9:130871804-130871826 TCTTGGAGCTCGTGGGGGTGTGG - Intronic
1061743801 9:132725555-132725577 TCTCGTACGTCCTGAAGGTGAGG - Intergenic
1061777127 9:132973088-132973110 TCTGGGAGCCCCTGGAGGGCAGG + Intronic
1062056217 9:134470859-134470881 CCTGGGAACTCCTGAACCTGGGG + Intergenic
1062119558 9:134827045-134827067 ACTGCGAGCTCATGAAGGAGAGG - Intronic
1062394941 9:136349026-136349048 TCTGTGGGCTCCCGAGGGTGTGG - Intronic
1062399341 9:136365619-136365641 TCTGGGTCCTCCTGAAGTGGGGG + Intronic
1062450713 9:136614633-136614655 CCTGGGAGCGCCTGGAGGTTGGG - Intergenic
1203363897 Un_KI270442v1:241013-241035 TGTGGGGGCTGCTGAAGGTTGGG + Intergenic
1203377457 Un_KI270442v1:387370-387392 TGTGGGGGCTGCTGAAGGTTGGG - Intergenic
1188566303 X:31530399-31530421 TCTGGGAGCTCCTAAGGGCTGGG + Intronic
1189602029 X:42637099-42637121 CCTGTGAGCTCCTGAAGCTTTGG + Intergenic
1190465376 X:50720887-50720909 TGTGGGATCACCTGAGGGTGAGG + Intronic
1192262107 X:69511630-69511652 ACTGGTATCTCCTGAAGGTGGGG + Intronic
1193277392 X:79605035-79605057 GCTGGAAGCTCCAGAAGGTGTGG - Intergenic
1196505545 X:116436765-116436787 TCTGGGAGCTGCGGGAGGTGTGG + Intronic
1198286174 X:135194362-135194384 TCTGGGAGCCCCTGCTGCTGTGG + Intergenic
1198935206 X:141896868-141896890 TCTGGGTGTTCCAGAAGATGAGG + Exonic
1199722029 X:150549105-150549127 TCTGGCAACTTTTGAAGGTGAGG + Intergenic
1200144821 X:153921091-153921113 TCTCAGAGCTCCAGACGGTGAGG - Exonic
1200962306 Y:9006772-9006794 CCTGTGAGCTCCTGAGGCTGCGG - Intergenic
1201223209 Y:11791097-11791119 CCAGGAAGCTCCTGAAGGAGGGG + Intergenic