ID: 1143025112

View in Genome Browser
Species Human (GRCh38)
Location 17:3937088-3937110
Sequence ACACACACACGACTGCCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143025109_1143025112 30 Left 1143025109 17:3937035-3937057 CCTCTCACTCAGGCACTCAGGCC 0: 1
1: 0
2: 1
3: 27
4: 369
Right 1143025112 17:3937088-3937110 ACACACACACGACTGCCTAAAGG 0: 1
1: 0
2: 0
3: 19
4: 177
1143025110_1143025112 9 Left 1143025110 17:3937056-3937078 CCATGTGCACACAAATACACATT 0: 1
1: 0
2: 8
3: 51
4: 455
Right 1143025112 17:3937088-3937110 ACACACACACGACTGCCTAAAGG 0: 1
1: 0
2: 0
3: 19
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143025112 Original CRISPR ACACACACACGACTGCCTAA AGG Intronic