ID: 1143027188

View in Genome Browser
Species Human (GRCh38)
Location 17:3947837-3947859
Sequence CCGATGTGATATTGGTGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143027177_1143027188 19 Left 1143027177 17:3947795-3947817 CCGTGTGCAGGCCGGTGGCCACG 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1143027188 17:3947837-3947859 CCGATGTGATATTGGTGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1143027181_1143027188 -5 Left 1143027181 17:3947819-3947841 CCACACCCACCGCTTTGCCCGAT 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1143027188 17:3947837-3947859 CCGATGTGATATTGGTGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1143027174_1143027188 26 Left 1143027174 17:3947788-3947810 CCCAGCTCCGTGTGCAGGCCGGT 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1143027188 17:3947837-3947859 CCGATGTGATATTGGTGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1143027175_1143027188 25 Left 1143027175 17:3947789-3947811 CCAGCTCCGTGTGCAGGCCGGTG 0: 1
1: 0
2: 1
3: 10
4: 108
Right 1143027188 17:3947837-3947859 CCGATGTGATATTGGTGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1143027180_1143027188 1 Left 1143027180 17:3947813-3947835 CCACGGCCACACCCACCGCTTTG 0: 1
1: 0
2: 0
3: 10
4: 136
Right 1143027188 17:3947837-3947859 CCGATGTGATATTGGTGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1143027179_1143027188 8 Left 1143027179 17:3947806-3947828 CCGGTGGCCACGGCCACACCCAC 0: 1
1: 1
2: 3
3: 34
4: 339
Right 1143027188 17:3947837-3947859 CCGATGTGATATTGGTGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1143027182_1143027188 -10 Left 1143027182 17:3947824-3947846 CCCACCGCTTTGCCCGATGTGAT 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1143027188 17:3947837-3947859 CCGATGTGATATTGGTGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143027188 Original CRISPR CCGATGTGATATTGGTGCCC TGG Exonic
906577466 1:46903850-46903872 CCCATTTGATATTGGGGCCTGGG - Intergenic
912838123 1:113014783-113014805 CTGATATGATATTGGAACCCAGG + Intergenic
914993186 1:152515854-152515876 CCGATGTGATTTTTCTCCCCGGG + Exonic
918176454 1:182050525-182050547 CAGATGTGATACTGGTGTCCAGG + Intergenic
1067173542 10:43926649-43926671 CCCCTGTGGTCTTGGTGCCCTGG - Intergenic
1069659042 10:70111473-70111495 CCGATGTCATTTTGGTCCCTGGG - Intronic
1087968419 11:104448973-104448995 CCACTGTGATATTGGAGCCAAGG - Intergenic
1092445096 12:8548182-8548204 CTGTTGAGATATTGGTGCCGAGG + Intergenic
1099932905 12:89094077-89094099 GAGATGTGATATTGGTCCCTAGG + Intergenic
1102230147 12:111256684-111256706 CAGAGGTGGTATCGGTGCCCAGG - Intronic
1104160003 12:126168883-126168905 CAGATGGGATATTGATTCCCAGG - Intergenic
1105329534 13:19402756-19402778 CTGATGTGGTATTTGTGCCTTGG + Intergenic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1137784021 16:51122661-51122683 CCAAGGTGATATTGATGCACTGG + Intergenic
1138286989 16:55818033-55818055 CCAATGTGGTATTGGTGCTTAGG - Intronic
1142982942 17:3681801-3681823 CTGATGTGATATTGATGGCTGGG - Intronic
1143027188 17:3947837-3947859 CCGATGTGATATTGGTGCCCTGG + Exonic
1145801944 17:27692855-27692877 CCCATTTGATATTGGGGCCTGGG + Intergenic
1152236244 17:79140413-79140435 CAGGTGTGTGATTGGTGCCCAGG - Intronic
1153877282 18:9385282-9385304 CTGATGTGTTATTGGTACCCAGG + Intronic
1154927115 18:20947624-20947646 CCGATGAGATTATGTTGCCCAGG - Exonic
1155339659 18:24801200-24801222 CTTATGTGATGTTAGTGCCCAGG + Intergenic
1157676175 18:49570193-49570215 CCTTTCTGATATTGGTCCCCAGG + Intronic
1167704172 19:51068753-51068775 GCGATGTGTTATTGCTGCCTGGG - Intergenic
931599777 2:63991734-63991756 CCCATTTGATATTGGGGCCTGGG - Intronic
936525416 2:113237962-113237984 GCTATGTGCTAATGGTGCCCTGG - Intronic
937985389 2:127635982-127636004 CCCATGTGATCTTGGAGCCCAGG - Intronic
941301630 2:163809637-163809659 CCCATGTTATTTTGCTGCCCAGG + Intergenic
1174892839 20:54416100-54416122 ACAATGTGATATTGGTGCATGGG - Intergenic
1175115649 20:56679935-56679957 CTGGTGTGTTATGGGTGCCCAGG + Intergenic
1180991219 22:19937880-19937902 CCCATTTGATATTGGGGCCTGGG - Intronic
953250106 3:41238027-41238049 TGGACTTGATATTGGTGCCCAGG + Exonic
956790618 3:72677372-72677394 CAGATGTGGCATTGGTGCCAGGG - Intergenic
957519049 3:81295357-81295379 GTGATGTGATATTTGAGCCCAGG + Intergenic
962843180 3:139253357-139253379 GCCAAGTGAGATTGGTGCCCTGG - Intronic
967194860 3:187017386-187017408 CCTAGGTGATATTAATGCCCAGG + Intronic
1022827571 7:34031515-34031537 CCCATGTGTTCTTGGTGCCAAGG + Intronic
1039436908 8:37565720-37565742 CAGATGTGAGATTTCTGCCCGGG + Intergenic
1040352623 8:46584138-46584160 CCCATTTGATATTGGGGCCTGGG - Intergenic
1052687454 9:31773746-31773768 CCCATTTGATATTGGGGCCTGGG - Intergenic
1060811405 9:126613189-126613211 CCGATGGGAGGTTGGGGCCCCGG - Intergenic
1062610720 9:137372264-137372286 CCGAGGTGCGACTGGTGCCCTGG + Intronic
1189860501 X:45266226-45266248 CTGAGGTGATATTTGTGCCTAGG - Intergenic
1191124793 X:56943534-56943556 CCCATTTGATATTGGGGCCTGGG - Intergenic
1199690306 X:150304555-150304577 CCCAGGTGATATTCCTGCCCTGG + Intergenic