ID: 1143029781

View in Genome Browser
Species Human (GRCh38)
Location 17:3961496-3961518
Sequence CTGTGTGCAGTGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 764
Summary {0: 1, 1: 4, 2: 5, 3: 66, 4: 688}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143029775_1143029781 -7 Left 1143029775 17:3961480-3961502 CCCAGCTCTGAAGTGTCTGTGTG 0: 1
1: 0
2: 4
3: 26
4: 237
Right 1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG 0: 1
1: 4
2: 5
3: 66
4: 688
1143029776_1143029781 -8 Left 1143029776 17:3961481-3961503 CCAGCTCTGAAGTGTCTGTGTGC 0: 1
1: 0
2: 2
3: 28
4: 196
Right 1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG 0: 1
1: 4
2: 5
3: 66
4: 688
1143029773_1143029781 2 Left 1143029773 17:3961471-3961493 CCGAGGCTCCCCAGCTCTGAAGT 0: 1
1: 0
2: 1
3: 31
4: 347
Right 1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG 0: 1
1: 4
2: 5
3: 66
4: 688
1143029774_1143029781 -6 Left 1143029774 17:3961479-3961501 CCCCAGCTCTGAAGTGTCTGTGT 0: 1
1: 0
2: 2
3: 19
4: 282
Right 1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG 0: 1
1: 4
2: 5
3: 66
4: 688

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143029781 Original CRISPR CTGTGTGCAGTGAGGGAGGA GGG Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
901052078 1:6430270-6430292 GGGTGAGCACTGAGGGAGGAAGG + Intronic
901144098 1:7053625-7053647 CAGAGTGGAGTGAGGGAGGAAGG - Intronic
901190162 1:7405124-7405146 CTGCAGGAAGTGAGGGAGGAGGG - Intronic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901544732 1:9947406-9947428 CATGGAGCAGTGAGGGAGGAAGG - Intronic
901753611 1:11427464-11427486 CTATGTGCAGGGAGGGTGCAGGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
902292190 1:15442603-15442625 CTGGGGGCAGTGTGGAAGGAGGG + Intronic
902378485 1:16041626-16041648 CTGTCTTCAGTGAGAGGGGAAGG - Intergenic
902517551 1:16997452-16997474 ATGTGTGCAGTGGGGCAGGGTGG + Intronic
902609521 1:17588892-17588914 GTGTGTGTAGTGGGGGAGGTTGG + Intronic
902727545 1:18347165-18347187 CTGTGTTCAGAGAGGGAGGGAGG - Intronic
902979690 1:20113907-20113929 CTGTGTCCTCTGAGGGTGGATGG - Exonic
903228065 1:21904920-21904942 CTGTGGGCAGTGACCCAGGAGGG - Intronic
903268571 1:22173766-22173788 CTGTCTGCAGAGGGGCAGGAAGG - Intergenic
903316525 1:22512211-22512233 TTGTGTGCAGTGAGGGCTGTGGG + Intronic
904204677 1:28846203-28846225 CCATGTGAAGTGAAGGAGGAAGG - Intronic
904616045 1:31750493-31750515 CTGTGTGGAGTTTGGGGGGAGGG - Intronic
904977922 1:34472703-34472725 CTGTGTGAATCAAGGGAGGATGG + Intergenic
905238750 1:36568359-36568381 CTATCTGCCTTGAGGGAGGAGGG - Intergenic
905545008 1:38790645-38790667 GTTTCTGCAATGAGGGAGGACGG + Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905920824 1:41717545-41717567 CTGGGTGAAGTGAGGGAGCAGGG + Intronic
906652043 1:47519755-47519777 GTGTGGGCAGGGAGGGAGGGTGG + Intergenic
907251693 1:53143770-53143792 CAGTCTGCAGTGAGGGTGGGAGG + Intergenic
907690552 1:56660463-56660485 CTGTGTTCAGTTAGAGAGTAAGG - Intronic
907869923 1:58433647-58433669 CTGTGTGGAGGGGGGGAGGCGGG + Intronic
908009110 1:59757584-59757606 CTGTGTCCAGATAGTGAGGAGGG + Intronic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908682815 1:66681800-66681822 GTGTGGGGAGTGAGGGAGGGAGG - Intronic
909046987 1:70722378-70722400 CTGTTGGGAGTGAGGGTGGAGGG - Intergenic
909185999 1:72486664-72486686 CTGGGTGTAGTGAGAGAGTAGGG + Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
910670676 1:89769652-89769674 CTGCCTGCAGTGAGAGAGGAAGG - Intronic
911101101 1:94096398-94096420 GTGAGTTCAGTGAGGGTGGAAGG + Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912607573 1:111008138-111008160 CCCTGTCCAGTGAGGAAGGATGG - Intergenic
912700291 1:111873223-111873245 CTGTGTGCATTGTGTGTGGAGGG + Intronic
912760202 1:112359663-112359685 TGGTGTTCAGTGATGGAGGAGGG + Intergenic
913056236 1:115162788-115162810 CTCTGAGGAGGGAGGGAGGAGGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
914806312 1:150994752-150994774 CTGTGTGCAGGGAGTGAGGGTGG - Intronic
915140465 1:153764771-153764793 GTGTGTGCTGTCAGGGAGGATGG - Intronic
915608316 1:156969432-156969454 CTGTGTGCAGGGCAGGAAGAGGG + Intronic
916171765 1:162006540-162006562 CTGTGTGCTCTGAGCGAAGATGG - Intronic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
916848001 1:168672948-168672970 AGGTATGTAGTGAGGGAGGAGGG - Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
917711380 1:177688675-177688697 CTGTGGGAAGTGAGGGAGGGTGG + Intergenic
917930460 1:179819045-179819067 CTGTGTGCTGGGCTGGAGGATGG - Intergenic
918237881 1:182597957-182597979 CTGTGAGCACTGAGGGAGGGAGG - Intergenic
918720749 1:187849869-187849891 CTGTGTTGAGTGAAGGATGATGG - Intergenic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920760919 1:208783086-208783108 GTGTGTACAGTGAGGGCTGAAGG + Intergenic
921056047 1:211543153-211543175 CTGTGGGCAGTGAGGGTGAATGG + Intergenic
921540678 1:216410955-216410977 TTGGCTGCAGTGAGGGAGAATGG - Intronic
922490664 1:226013970-226013992 CAGTGTGCAGTGCGGGCGGAAGG - Intergenic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
923076164 1:230610556-230610578 CTGTTCTCAGTGAGGGAGAAGGG + Intergenic
923412647 1:233725406-233725428 CTGTTTGCACTGGGGGAGGCTGG - Intergenic
923608198 1:235464493-235464515 ATGTGGGAAGTGAGGGAGGGAGG - Intronic
924612189 1:245582921-245582943 CGGGGTGCAGGGAGAGAGGAAGG - Intronic
1062816987 10:508114-508136 CTCTGTGGCGTGAGGGAGGAAGG - Intronic
1062823337 10:550940-550962 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1062823354 10:551022-551044 CAGTGTCCAGTGAGGGCAGAGGG - Intronic
1063309689 10:4940599-4940621 CTGTGTGCAGTTGGGGGTGAAGG + Intronic
1063317601 10:5021502-5021524 CTGTGTGCAGTTGGGGGTGAAGG - Intronic
1063447697 10:6130027-6130049 CTGTGTGCAGAGGAGGAGGAGGG - Intergenic
1063702586 10:8400110-8400132 GTGTGTGAAGTGAGGCAGGAAGG + Intergenic
1063981637 10:11457402-11457424 CTGGGGGCAGTGAGGGAGACAGG - Intronic
1064623696 10:17240920-17240942 GTGTGTGTAGTGATGGGGGAGGG + Intergenic
1064873981 10:19971989-19972011 CGTTGTGCATAGAGGGAGGAAGG + Intronic
1065132428 10:22635665-22635687 CTGTGGGCAGCGAGGAAGCATGG + Intronic
1065166860 10:22988604-22988626 CTGAGTGCAGTGAATGATGATGG + Intronic
1065363179 10:24908702-24908724 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1066327893 10:34383799-34383821 CTGTGTGCAGCAAAGGTGGACGG + Intronic
1066402012 10:35085851-35085873 CTTTTTACAGCGAGGGAGGAAGG + Intronic
1066995468 10:42559185-42559207 ATTTGATCAGTGAGGGAGGAGGG - Intergenic
1067061102 10:43078299-43078321 TTGTAAGGAGTGAGGGAGGATGG - Intronic
1067270614 10:44788435-44788457 GTGTGTGGCGTGAGGTAGGAAGG - Intergenic
1067337923 10:45379371-45379393 CTGTGTGCGGTGAGGACTGAGGG - Intronic
1067529140 10:47057842-47057864 TTGTGTCAAGTGAGGGAAGAGGG - Intergenic
1067824228 10:49558323-49558345 CTGTGTGGAGTGAGGTAAGCTGG + Intergenic
1068853485 10:61771727-61771749 CTGTGTGCAGTGGTGGAGTGGGG + Intergenic
1069445730 10:68471770-68471792 CTGTGAGCGGAGAGGGGGGAGGG - Exonic
1069616041 10:69806675-69806697 CCGTGTGCAGTGAATGAGAAGGG + Intronic
1069722244 10:70557232-70557254 CTGTGTGCTTTGAGGGATGGTGG + Intronic
1070147577 10:73785888-73785910 ATGTTTGCAGAGTGGGAGGACGG + Exonic
1070686625 10:78489527-78489549 CTGTGGGCAGTGAAGATGGAAGG - Intergenic
1070771087 10:79082700-79082722 TTGTGTGGAGTGAAGGACGATGG + Intronic
1070972395 10:80578356-80578378 CTGTTTGTTGTGGGGGAGGAGGG + Intronic
1071083696 10:81842794-81842816 CTTTTTGCAGTGAGAGAGGAAGG - Intergenic
1071415153 10:85434139-85434161 CTGTGTGGGTTGTGGGAGGATGG - Intergenic
1071481875 10:86070683-86070705 ATGTGTGCAGGGATGGATGAGGG - Intronic
1072637410 10:97186627-97186649 GTGGGTGCATTGAGGTAGGAAGG - Intronic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1073444855 10:103574560-103574582 CTGAGGTCAGTGGGGGAGGATGG + Intronic
1073763824 10:106659935-106659957 GTGTGTGCAGTGAGGCTGTATGG + Intronic
1074307472 10:112292383-112292405 CTGAGTGCAGTGGGGCAGCAAGG - Intronic
1074884392 10:117683340-117683362 CTGTGTGCAGTGAGTGGGCCAGG + Intergenic
1075216389 10:120539801-120539823 TTGGGAGGAGTGAGGGAGGAAGG + Intronic
1075310651 10:121411004-121411026 CATAGAGCAGTGAGGGAGGAAGG - Intergenic
1075741490 10:124698946-124698968 CTGGGTGGTGTGAGTGAGGAGGG - Intronic
1075746266 10:124730077-124730099 CTGTGTGGCATGAGGAAGGAAGG - Intronic
1075895884 10:125994148-125994170 TAGGGTGCAGTGGGGGAGGATGG + Intronic
1075895905 10:125994208-125994230 TAGGGTGCAGTGGGGGAGGATGG + Intronic
1076526783 10:131117123-131117145 CTGTGTTCAGGGTGGGAGGCTGG + Intronic
1076542958 10:131225742-131225764 CTGTGTGCAGGGAGTTGGGAGGG - Intronic
1076820561 10:132936745-132936767 CTCTGTGCTGGGAGGGAGGCAGG + Intronic
1076852390 10:133099453-133099475 CTCCCTGCAGTGGGGGAGGAGGG - Intronic
1076882389 10:133245844-133245866 CTGCGGGCTGTGAGGGAGGTGGG + Intergenic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077442434 11:2574933-2574955 CTGCCTGCAGTGAGTGTGGATGG + Intronic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1078417277 11:11176036-11176058 CTGAGTGCAATGAGATAGGACGG + Intergenic
1078529118 11:12122754-12122776 GTGTGTGCAGTGAAGAACGATGG + Intronic
1078545407 11:12243421-12243443 AGGTGTGCTGTGAGGGAGGGAGG - Intronic
1078737079 11:14030164-14030186 CTGAGTGCTGCGTGGGAGGAGGG - Intronic
1078766348 11:14302177-14302199 CTGTGTGTAGTGTGGGGGTAAGG - Intronic
1078928582 11:15895925-15895947 CTGTGTTCAGGGAGGGAGTGAGG + Intergenic
1079012683 11:16842341-16842363 CATGGAGCAGTGAGGGAGGAAGG - Intronic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1080084477 11:28261409-28261431 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1080787752 11:35491298-35491320 CAGTTTACAGAGAGGGAGGATGG - Intronic
1080823078 11:35825539-35825561 GTGTGTGCAGTGGGGGTGAATGG - Intergenic
1080935119 11:36855101-36855123 CTATGTGCAGGGAGGGTGGGAGG + Intergenic
1081551911 11:44121574-44121596 CTCTGTGCAGTGTGGGGGCAGGG - Intronic
1081662405 11:44896114-44896136 CTGGGTGGATTGAGGGAGGAAGG + Intronic
1081911381 11:46701881-46701903 GTGTCAGCAGTGAGTGAGGAAGG + Intronic
1083290035 11:61684723-61684745 CTGTGGGAAGTGAGGGCGGAGGG + Intronic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083589470 11:63884850-63884872 CTGGATACAGTGAGGGAGGAAGG + Intronic
1084115742 11:67042002-67042024 CTGTGAGCAGAGTGCGAGGAGGG + Intronic
1084144355 11:67256205-67256227 GTGTGTGGAGGGAGGGAGGGAGG + Exonic
1084836571 11:71806403-71806425 ACATGTGCAGTGAGGGTGGAAGG - Intergenic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1086900825 11:92365997-92366019 CTCTCTGGGGTGAGGGAGGAAGG + Intronic
1087601855 11:100327373-100327395 CTGTGTGCAGTCTGGAAAGAGGG - Intronic
1089107782 11:116028555-116028577 CTGTATACAGTGAGAGATGAGGG - Intergenic
1089110837 11:116054701-116054723 CTGGGTGCCGTTGGGGAGGAGGG + Intergenic
1090062362 11:123475162-123475184 CTGGGTACAGGGAGGGAGGAAGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1091097491 11:132837860-132837882 CCCTGAGCAGTGAGGGAGGAGGG - Intronic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092124434 12:6065592-6065614 CAGTGAGCTGTGAGGGAGGAGGG - Intronic
1092402665 12:8189702-8189724 ACATGTGCAGTGAGGGTGGAAGG + Intergenic
1092549450 12:9482136-9482158 TTTTGTGAAGTGAGGGAGGGAGG - Intergenic
1093055712 12:14553860-14553882 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1093253703 12:16839695-16839717 CTGGGTGGAGGGTGGGAGGAGGG + Intergenic
1093276313 12:17132495-17132517 CTGTGGGCCATGACGGAGGAGGG + Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094202285 12:27806280-27806302 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1094521814 12:31199005-31199027 TTTTGTGAAGTGAGGGAGGGAGG + Intergenic
1095087689 12:38075462-38075484 TGGGGTGCAGGGAGGGAGGAGGG + Intergenic
1095980819 12:47973770-47973792 CTGTGGGGAGTGGGGAAGGAGGG - Intronic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1096883077 12:54688344-54688366 CAGTGTCCAGTGAGGGAGCAAGG + Intergenic
1096903583 12:54911455-54911477 TTGTGTACAGTGAGCGAGGGGGG - Intergenic
1097297089 12:57978164-57978186 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097806139 12:63967090-63967112 CTGTGAGCCGTTTGGGAGGAGGG + Intronic
1097967003 12:65591987-65592009 CTTTCTGCAGTGAAGGAGAAGGG + Intergenic
1098581903 12:72109910-72109932 CTCTGTGCAGTCAGAGATGATGG + Intronic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1099535887 12:83844129-83844151 CTGTGCGAAGTAAGGGAGTAAGG + Intergenic
1100272080 12:93035534-93035556 GTCTGTGCAGAGAGAGAGGATGG + Intergenic
1101030816 12:100657563-100657585 GTGTGTGTTGTGGGGGAGGAGGG - Intergenic
1101059371 12:100954989-100955011 CTGTGGGCAGTTATGGTGGAAGG - Intronic
1101330949 12:103757558-103757580 CTGTCTGAAGTGATGGGGGAAGG + Intronic
1101643115 12:106602697-106602719 CTGAGTTTAGTGAGGGAGCAAGG - Intronic
1101693559 12:107103401-107103423 CTGAGGGCAATGAGGGAGGGAGG - Intergenic
1101728568 12:107407915-107407937 CGTTGTACAGTGATGGAGGATGG + Intronic
1101999279 12:109546544-109546566 CTGCATGCACTGAGCGAGGATGG - Intergenic
1102396016 12:112586439-112586461 CTGGATGCAGTGAGGGAGTAAGG + Intronic
1102587500 12:113933409-113933431 CTGCGTGCAGTGAGGGCAGGAGG + Intronic
1102623153 12:114213053-114213075 CTGTATGCAGTGACTGAGCAAGG - Intergenic
1102677740 12:114669520-114669542 CTGTGTCACGCGAGGGAGGAGGG - Intergenic
1103518764 12:121524142-121524164 CTTTCTGCAGGGAGGGAGGTAGG - Intronic
1103572779 12:121856289-121856311 CTGGGTGGACTGAGAGAGGAAGG - Intronic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104598981 12:130139636-130139658 CTGGGTTAAGTGAGGCAGGAGGG - Intergenic
1104657951 12:130587958-130587980 CTGTGTGGAGGGACAGAGGAAGG - Intronic
1104723349 12:131059238-131059260 CTGGCTGCAGTGAGCCAGGATGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1104948715 12:132429177-132429199 GTGTGGTCAGGGAGGGAGGAGGG - Intergenic
1105419355 13:20238947-20238969 CTGTGTGGAGTCAGAGAGCAAGG - Intergenic
1106321359 13:28642473-28642495 GTAAGTGCAGAGAGGGAGGAAGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108275420 13:48804470-48804492 ATGTGCTCAGTGAGGGAGGGAGG + Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1109258822 13:60118893-60118915 CTGTGTGCTGTGACGGATAAGGG - Intronic
1109876429 13:68410129-68410151 CTTTGTGCAGTCAGGTAGAATGG + Intergenic
1110426681 13:75375147-75375169 CTCTCTGCAGTGAAGGAGTATGG - Intronic
1111893001 13:94106520-94106542 GTGAGGGAAGTGAGGGAGGATGG + Intronic
1112369325 13:98781491-98781513 CCCTGTGGTGTGAGGGAGGAAGG + Intergenic
1112742533 13:102491502-102491524 CTGTGGGCACTCAGGGAGAAAGG + Intergenic
1113233956 13:108248403-108248425 CTCTGTGGAGGGAGGGAGGGAGG + Intergenic
1113507351 13:110826373-110826395 CTGTGTCCAGTGATGCTGGATGG + Intergenic
1113743443 13:112726282-112726304 CTGTGTGCAGGGAGAGGGGCTGG + Intronic
1113776391 13:112948084-112948106 CTGTGGGCAGTGAGGTTGCATGG + Intronic
1113777946 13:112959490-112959512 GTTCCTGCAGTGAGGGAGGAGGG + Intronic
1113850813 13:113416929-113416951 GTGTGTGCAGTGAGAGATGAGGG + Intergenic
1113887683 13:113669588-113669610 CTGTGTGCAGTGGGCGTGGCCGG + Intronic
1114484945 14:23056877-23056899 GTGTCTGCTCTGAGGGAGGAGGG - Intronic
1114583474 14:23787238-23787260 GTGGGTGGAGTGTGGGAGGAAGG - Intergenic
1115139564 14:30154617-30154639 CTGTGAGAAGTTAGGGAAGATGG - Intronic
1115376460 14:32682323-32682345 ATCTGTGCAGTGAGAGAGAAGGG + Intronic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1115727336 14:36231672-36231694 CATGGGGCAGTGAGGGAGGAAGG + Intergenic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116034857 14:39615543-39615565 CTGTGTGCCCTGAGAGAGGATGG + Intergenic
1116057083 14:39876985-39877007 CTTTGACCAGTGAGAGAGGAGGG - Intergenic
1116870922 14:50068655-50068677 CATAGAGCAGTGAGGGAGGAAGG - Intergenic
1117939242 14:60943571-60943593 CAGTGGGCAGTGAGGGAGTGGGG + Intronic
1118339243 14:64880323-64880345 CTGTGTGCAGTGGGGATGCAGGG - Intergenic
1118348225 14:64955228-64955250 GTGTGGGCGGGGAGGGAGGAAGG - Intronic
1118807472 14:69250574-69250596 CTGTGTGCAGCTGGGGAGGCAGG + Intergenic
1118811963 14:69281723-69281745 CTGTGTGCTGGGATGGAGAAAGG - Intronic
1119895970 14:78220336-78220358 AGGTGTGCAGAGAGGGAGGAGGG + Intergenic
1121023765 14:90599337-90599359 CTATGTGCTGTGAGGGGAGAGGG - Intronic
1121105913 14:91279668-91279690 CTCTGTGCAGTAATAGAGGAGGG - Intronic
1121302291 14:92881334-92881356 CTCTGTGCAAAGAGGGAGGTGGG - Intergenic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1121775035 14:96584754-96584776 CTGTGAGGACTGAGGGAGGGTGG + Intergenic
1121794920 14:96726758-96726780 CTGTGTGTAGTGGTAGAGGATGG + Intergenic
1121837816 14:97107679-97107701 GAGGGTGGAGTGAGGGAGGAGGG + Intergenic
1121894508 14:97634014-97634036 ATTTGTGGAGGGAGGGAGGAAGG + Intergenic
1122125057 14:99574464-99574486 CTGTGAGGAGTGAGTGGGGATGG - Intronic
1122126299 14:99580356-99580378 GTGAGTGCAGTGGGGGAGGCAGG + Intronic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1123433445 15:20237523-20237545 CCGTGGGAAGTGAGGTAGGAAGG - Intergenic
1123476510 15:20595280-20595302 CTGGGTGCAGGGATGGAGGAAGG + Intergenic
1123641501 15:22405084-22405106 CTGGGTGCAGGGATGGAGGAAGG - Intergenic
1123793987 15:23753384-23753406 CAGTGTGCAGAGCAGGAGGAGGG + Intergenic
1127410747 15:58704044-58704066 CATGGAGCAGTGAGGGAGGAAGG + Intronic
1127806021 15:62521277-62521299 CTGGGTGCCGTGAGGGTGGGGGG + Intronic
1128340388 15:66818500-66818522 CAATGTCCAGTGATGGAGGAAGG - Intergenic
1128762639 15:70227925-70227947 CAGTGTGGAGGGTGGGAGGAGGG - Intergenic
1128768855 15:70267070-70267092 GGGTGTGGAGTGAGAGAGGAGGG - Intergenic
1129121400 15:73399042-73399064 CAGTCTGGAGTGTGGGAGGAGGG + Intergenic
1129351769 15:74959462-74959484 ATGCGGGGAGTGAGGGAGGAAGG + Intronic
1129364701 15:75047177-75047199 CTGTGTGCAGGGCAGGAGCAAGG - Intronic
1129680699 15:77656934-77656956 AGCTGTGCAGTGAGGGAGCAAGG + Intronic
1129692351 15:77721046-77721068 ATGTGAGCATTGAGGCAGGAGGG - Intronic
1129762026 15:78134748-78134770 GTGTTTGCTGGGAGGGAGGATGG + Intronic
1129858862 15:78844645-78844667 CTGTGGCCAGTGAATGAGGATGG - Intronic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130904404 15:88229672-88229694 CTGTGTGCAGAGAGTGACCAGGG - Intronic
1131116636 15:89800005-89800027 ATGAGAGGAGTGAGGGAGGAGGG - Intronic
1131151998 15:90053194-90053216 CTGTTTGGAGTGAGGGAGCTGGG + Intronic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1133993371 16:10728059-10728081 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
1134008799 16:10835892-10835914 GTGTGTGCAGTGAGGAAAGTGGG - Intergenic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135730673 16:24892542-24892564 CTGTGGGCAGGGAGGCAGGGCGG + Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1136659978 16:31749184-31749206 CTGTGCACAGTGAGAAAGGATGG + Intronic
1136851181 16:33613605-33613627 CCGTGGGAAGTGAGGTAGGAAGG + Intergenic
1137351730 16:47719212-47719234 CCATGTGGAGTGAGGGAGGAAGG - Intergenic
1137494286 16:48957784-48957806 CTGTGTGCTGGGAGGTGGGATGG - Intergenic
1138344462 16:56311622-56311644 ATGTCAGCAGGGAGGGAGGAGGG - Intronic
1138392843 16:56682842-56682864 CTCTGAGCAGTCAGGGTGGATGG + Intronic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138907413 16:61353949-61353971 CTGTGTTAAGTGAGGCAGGAAGG - Intergenic
1139194326 16:64900925-64900947 TTCTCTGCAGTGAGGGAGAAGGG + Intergenic
1139334817 16:66224322-66224344 ATGGGTGCAGTGAGGAGGGAGGG - Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140613273 16:76627123-76627145 ATGTGTACATTGAGGAAGGATGG + Intronic
1140865841 16:79061402-79061424 ATGTGTGCAGTGAGTGTGGGAGG + Intronic
1140932171 16:79637834-79637856 CTGTGTGCAGTTTGGGAAAAGGG + Intergenic
1141867834 16:86762885-86762907 TTTTGTGCAGACAGGGAGGAAGG + Intergenic
1141995416 16:87634086-87634108 GTGGGTGCAGAGAGGCAGGAGGG + Intronic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142060258 16:88024649-88024671 CAGAGTGCAGTGGGTGAGGAGGG - Intronic
1142132057 16:88435658-88435680 CTGTGTCCAGGGAGGATGGATGG + Exonic
1142363281 16:89637165-89637187 CTGGGGGCTGTGAGGGTGGACGG + Intronic
1142458546 17:72914-72936 CTGTGTCGAGTGAGGGAGTGAGG - Intergenic
1142697098 17:1639775-1639797 CTGGGTGAAGTGGGGGAGGCAGG + Intronic
1142740198 17:1927403-1927425 TGGTGTGGAGTGAGTGAGGAAGG + Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143491206 17:7286189-7286211 CTGAGTGCAGTAACTGAGGATGG + Intronic
1143577411 17:7802377-7802399 CTGTGTTGAGTGAGAGAGTAGGG - Intronic
1143870474 17:9954452-9954474 CAGTCTGCAGTGATGGGGGATGG + Intronic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1144773533 17:17772404-17772426 GTGGCTGCAGTGAGGCAGGATGG - Intronic
1146278212 17:31528795-31528817 CTGTGTCCAGTGGGGCAGGGTGG + Intronic
1146916636 17:36682290-36682312 CATGGAGCAGTGAGGGAGGACGG - Intergenic
1147047246 17:37762378-37762400 CTGTGTGCAGTCAGGGCTCAAGG + Intergenic
1147182635 17:38696195-38696217 CTGTGTGCCCTGGTGGAGGAGGG - Intergenic
1147407141 17:40220117-40220139 TGGTGTGAAGTGAGGGAAGATGG + Intronic
1148000097 17:44382829-44382851 GAGTGTCCAGAGAGGGAGGAGGG - Intronic
1148074816 17:44929148-44929170 CTGTCTGGGGTGAGGCAGGAGGG - Intronic
1148239052 17:45988082-45988104 CCGTGTGCAGCGAGGGAAGGAGG + Intronic
1148444093 17:47727269-47727291 CTGTCTGCTGAGAGGCAGGAAGG + Intergenic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1148761401 17:50003587-50003609 CTGTGTCCGGTGAGGCAAGAGGG + Intergenic
1148806897 17:50268503-50268525 CTGTGGGCCGGGAGGGTGGAGGG - Intergenic
1149028381 17:52056274-52056296 TTCTGTTCAGTGAGGGAAGAAGG + Intronic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1150125160 17:62630468-62630490 CTGTCTGGAGAGAGGCAGGAAGG + Intronic
1151733058 17:75922242-75922264 CTGTGGACATTGAGGCAGGAAGG - Intronic
1151882928 17:76905675-76905697 CTGGGTGGAGGGAGGGAGGGAGG - Intronic
1151905291 17:77044147-77044169 CTGTGTGCACTGTGGGCAGAGGG + Intergenic
1152120178 17:78413679-78413701 CTGGGTGCCCTGTGGGAGGAAGG + Intronic
1152471714 17:80493188-80493210 CTGTTTCCAGTGAGCGGGGAGGG + Intergenic
1152603599 17:81277842-81277864 CTGTGTGCAGCCGGGGAGAAGGG + Intronic
1153288896 18:3481190-3481212 CTGTGTGCAGTTTGGGAGCTTGG + Intergenic
1153812262 18:8762583-8762605 CTACGTGGAGTGAGGAAGGACGG + Intronic
1153871368 18:9323417-9323439 CAGTGTGTATTGGGGGAGGAGGG - Intergenic
1154399551 18:14023532-14023554 CTGTGTCCAGAGACAGAGGAGGG + Intergenic
1154493111 18:14936400-14936422 GTTTGTGGAGGGAGGGAGGAAGG - Intergenic
1155177518 18:23313772-23313794 TGGGGTGCAGTGAGAGAGGAGGG - Intronic
1156480005 18:37430442-37430464 TTGTGTGGAGTGGGGGTGGAGGG - Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1158315972 18:56211443-56211465 GTGTGTGTAGGGAGGAAGGAAGG - Intergenic
1158932399 18:62334465-62334487 CTCTGTGTAGGGTGGGAGGAGGG + Intronic
1159082648 18:63752899-63752921 CTTTGTGCAGTCTGGGATGAAGG + Intergenic
1159444328 18:68522020-68522042 TTGTGAGCAGTGAGGGGTGATGG - Intergenic
1159678364 18:71314860-71314882 CAGTGTGTAGGGTGGGAGGAGGG + Intergenic
1159904361 18:74076800-74076822 ATGTGTGCAATGAGGTGGGATGG - Intronic
1159994998 18:74955829-74955851 GTGTGTGCAGGGAGAGAGGATGG - Intronic
1160017857 18:75158005-75158027 CGCTGTGCAGTGAGGGAGCCTGG - Intergenic
1160025875 18:75215796-75215818 GTGTGTGCAGGGTGGTAGGAGGG - Intronic
1160764334 19:800695-800717 GTTTGTTCAGTGTGGGAGGAGGG + Intronic
1160841170 19:1147615-1147637 CTGTGTCCAGTGGGGGTGGGAGG - Intronic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161480553 19:4508210-4508232 CTGTGTGCAGAGGGGGATGTGGG - Intronic
1161576697 19:5058401-5058423 CTCTGAGGACTGAGGGAGGAGGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161734395 19:5982085-5982107 CAGGCTGCAGTGAGGTAGGATGG + Intergenic
1161914425 19:7218012-7218034 CTGTCTCCACTGTGGGAGGATGG + Intronic
1162085417 19:8246018-8246040 AAGTGTGCAGTGAGGTATGATGG + Intronic
1162339342 19:10082672-10082694 CTGTGTTCAATTATGGAGGAAGG - Intergenic
1162522715 19:11191471-11191493 CTGTGGCCTTTGAGGGAGGAAGG - Intronic
1162819041 19:13211893-13211915 CTGTCCTCTGTGAGGGAGGAGGG + Intronic
1163037352 19:14578190-14578212 CTGTGTGCATTGAGAGTGGCTGG + Intergenic
1163383657 19:16985742-16985764 ATGGGTGGAGGGAGGGAGGAAGG + Intronic
1163737173 19:18988518-18988540 CTGTGTGGAGGGAGGCAGCAAGG + Intergenic
1163822269 19:19502730-19502752 CTGGGTGCAGAGAGTGAGGGTGG - Intronic
1164577005 19:29411375-29411397 CTCTGAGGAGTGGGGGAGGAGGG - Intergenic
1164707314 19:30329675-30329697 CTGGGTGCAGAGAGGGAGAGGGG - Intronic
1165380472 19:35476044-35476066 CTGGATGAAGTGAGGGAGCAAGG + Intergenic
1165466592 19:35978527-35978549 CGTGGTGAAGTGAGGGAGGAGGG - Intergenic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1165977197 19:39686607-39686629 GAGTGTCCAGTGAGAGAGGAGGG - Intergenic
1166010100 19:39935319-39935341 GTGTGGGCAGTGAGGGTGGGAGG + Intergenic
1166283172 19:41808716-41808738 AGGTGTGCAGTCAGGGAAGAAGG - Intronic
1166366422 19:42280673-42280695 CTTTGTGCAGGGAGGGCGGACGG - Intronic
1166606520 19:44148213-44148235 TTGTGTGCACTGAGGCATGATGG + Intronic
1167600454 19:50451604-50451626 CTGTAGGGTGTGAGGGAGGAGGG + Intronic
1168396900 19:56056004-56056026 TTGTGTGCAGTCAGGGATCATGG + Intronic
1168428055 19:56255457-56255479 CTGTGAGCACTGAGGCAGGTTGG - Intronic
1168550751 19:57291296-57291318 TTGTGTGCAGTGAATGTGGAAGG + Exonic
925196590 2:1930939-1930961 GTGTATGCAGTGCGGGAAGATGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925546755 2:5024719-5024741 CTGTGAGGAGTGAGGGGTGAGGG - Intergenic
925756847 2:7141431-7141453 CGTGGAGCAGTGAGGGAGGAAGG + Intergenic
925817551 2:7768415-7768437 CTGTGTGCAGTGTGGGTGTGTGG - Intergenic
926217635 2:10915183-10915205 CTCTGTGCTGGGAGGGAGGTGGG + Intergenic
926300114 2:11596374-11596396 ATGTGTATAGTGAGGGGGGACGG + Intronic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
926728196 2:16014713-16014735 CTGGCTGCAGTGAGAGAAGATGG - Intergenic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
928255469 2:29718550-29718572 CTGAGTGCAGGGAGGAGGGAAGG + Intronic
928394886 2:30935934-30935956 ATTTCTGAAGTGAGGGAGGAGGG + Intronic
928578457 2:32680564-32680586 CTGTGTGAAATGAGGGATGGGGG + Intronic
928856508 2:35808916-35808938 CTGTGTGCAAAGAGGAAGCAGGG - Intergenic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
930544863 2:52753810-52753832 CTGGGTGCAGGGACAGAGGATGG + Intergenic
930694201 2:54394696-54394718 ATGTGTGGAGGGAGGGAGGGAGG - Intergenic
930842472 2:55862785-55862807 CTGTGTCCAGTCAGAGAGCATGG + Intergenic
930851512 2:55965940-55965962 GTGTGTGAAGGGAAGGAGGAAGG + Intergenic
931771934 2:65504914-65504936 CTGGTTGCAGTGAGGGAAAATGG - Intergenic
932299962 2:70659705-70659727 CTTTCTGCAGTTTGGGAGGAAGG + Exonic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
932457797 2:71860700-71860722 GTGTGTGCAGTGAGACAGGAGGG + Intergenic
933319489 2:80755926-80755948 AAGGGTGGAGTGAGGGAGGAGGG - Intergenic
933349689 2:81137531-81137553 GTGTCTGCAGTGATGGATGAGGG - Intergenic
933758910 2:85661318-85661340 CTGTGCGGTGAGAGGGAGGATGG + Intronic
934559159 2:95303405-95303427 CTGTGTTCAGGGGGAGAGGAAGG + Intronic
934968619 2:98744728-98744750 AAGGGTGCGGTGAGGGAGGAAGG + Intergenic
934982068 2:98850824-98850846 CTGTGGTCAGTTAGGGTGGAGGG - Intronic
937293090 2:120793776-120793798 GTGAATGTAGTGAGGGAGGAGGG - Intronic
937470719 2:122171863-122171885 CTGATTTCAGTGGGGGAGGACGG + Intergenic
938135648 2:128754353-128754375 CTGTGTGCAGTGAGTGCTGCAGG + Intergenic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938654086 2:133412941-133412963 CCTTCTGCAGGGAGGGAGGAAGG + Intronic
938722202 2:134076743-134076765 CTGGCTGCAGTGGGGGAGGCAGG - Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
938951529 2:136259112-136259134 ATGTGGGCAGTGAGGCAGTAAGG - Intergenic
938995493 2:136673558-136673580 ATATGTGCAGTGAGGGGGGCAGG + Intergenic
939258618 2:139778054-139778076 TGGTGTGCAGTGAAGGAGGTGGG + Intergenic
939530761 2:143358209-143358231 CCGTGTCCAGTGAGGGATTATGG - Intronic
940058375 2:149537553-149537575 CTGTTATCAGTGAGGTAGGATGG - Intergenic
941539791 2:166768053-166768075 CAGGGTGGAGTGTGGGAGGAGGG - Intergenic
941925679 2:170892051-170892073 CTGGGTGGAGGGAAGGAGGAGGG + Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
944868595 2:203886695-203886717 TTGTGTGGAGTGGGGAAGGAAGG - Intergenic
945039281 2:205730611-205730633 CGGTGTGCAGGGAAGGAAGAGGG + Intronic
945432410 2:209779546-209779568 CTCTGTTCAGTGAGGGTGAAGGG - Intronic
945854271 2:215049002-215049024 GAGTGTGAAGTGTGGGAGGAGGG + Intronic
945918321 2:215728342-215728364 TTCTGTTCAGTGAGGGAGCAGGG + Intergenic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
946486474 2:220105323-220105345 CTGGGTGGAGAGAGGAAGGAGGG + Intergenic
946768290 2:223060618-223060640 CTCTCTGCACTGGGGGAGGAGGG - Intronic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
947179004 2:227395578-227395600 CTGTGTGCCCAGAGGGAGGCTGG - Intergenic
947573114 2:231250758-231250780 CTGTGTTGAGTGTGGAAGGAGGG + Intronic
947703731 2:232257507-232257529 CTGTTTGGAGTGACGGAGGGTGG - Intronic
948389403 2:237601261-237601283 CTCTGTGCAGGGTGAGAGGATGG - Intronic
948456777 2:238108185-238108207 CTGCGCGAAGGGAGGGAGGATGG - Intronic
948650372 2:239439972-239439994 CTCTGTGCAGTCAGGGATGTAGG + Intergenic
948711212 2:239826912-239826934 CTGAGTGCACGGAGAGAGGAAGG - Intergenic
948717450 2:239874455-239874477 CTGAGTGCCGTGAAGCAGGAAGG - Intergenic
948762685 2:240202346-240202368 GTGTGTGGAGTGAGAGAGAAAGG + Intergenic
948768129 2:240233743-240233765 CTGTGGGCAGGGTCGGAGGAGGG - Intergenic
948768148 2:240233798-240233820 CTGTGGGCAGGGCCGGAGGAGGG - Intergenic
948797418 2:240412080-240412102 CTGTGTGCGGGGAAGGAGAACGG - Intergenic
948901131 2:240957465-240957487 CTCTGTGCAGTCAGTGAGAAGGG - Intronic
1168832562 20:854607-854629 CGGTGGACACTGAGGGAGGAGGG - Intronic
1169219915 20:3816168-3816190 CTGAGAACAGTGAGGCAGGAAGG - Intergenic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170208841 20:13827968-13827990 GTGTGTGTTGTGAGGGAGAAGGG + Intergenic
1170566858 20:17612468-17612490 GTGTGTGAGGTGAGGGAGGCTGG - Intergenic
1170705272 20:18738739-18738761 CTGCCAGCAGGGAGGGAGGAAGG + Intronic
1170937881 20:20825408-20825430 CTGTGAGCTGCGAGGGAGGCCGG + Intergenic
1171367173 20:24633319-24633341 CTGGGTGGTGTCAGGGAGGAAGG - Intronic
1171381539 20:24737694-24737716 CTGTGTCCAGGGAGTGATGAGGG - Intergenic
1171388561 20:24786567-24786589 AAGGGGGCAGTGAGGGAGGAAGG - Intergenic
1172592751 20:36128957-36128979 GTGGGTGGAGAGAGGGAGGAAGG + Intronic
1172687787 20:36770021-36770043 TGGGGTGCAGGGAGGGAGGAGGG + Intronic
1172967288 20:38845995-38846017 CTGTGTCAAGTGACAGAGGAGGG + Intronic
1173279671 20:41617815-41617837 CTGTTTGCAGGGGTGGAGGAGGG - Intronic
1173497931 20:43532648-43532670 GTGTGGGCAGTGAGAAAGGAAGG - Intronic
1173502077 20:43561288-43561310 CTGAGGGCAGTCAGGAAGGAGGG + Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1173827865 20:46058726-46058748 CTGGGACAAGTGAGGGAGGAGGG + Intronic
1173894595 20:46541481-46541503 CCGAGAGCAGTGAGGGAGAAGGG - Exonic
1174199638 20:48798301-48798323 CAGTGTCCAGTGAGGGATGGTGG - Intronic
1174836927 20:53865061-53865083 CTGTGTACAGAGAGGGCCGATGG + Intergenic
1174937057 20:54882308-54882330 TTGGGTGCGGGGAGGGAGGAGGG - Intergenic
1175239565 20:57536997-57537019 CTGGGTGGGGTGAGGGAAGAGGG - Intergenic
1175548859 20:59802606-59802628 CTGTGTGCAGGGAGCGTGGAAGG + Intronic
1175984203 20:62755849-62755871 ATGGGTGGAGGGAGGGAGGATGG - Intronic
1177983853 21:27948628-27948650 GTGTGTTGTGTGAGGGAGGAGGG - Intergenic
1178615195 21:34126940-34126962 CTGTGTGCAGTGGTGGGGGTTGG + Intronic
1179083112 21:38191680-38191702 AGGTGTGCAGTGATGGAGGCTGG - Intronic
1179161662 21:38904447-38904469 GTGTGTGCAGTGAAAGAGCAGGG + Intergenic
1179255589 21:39712680-39712702 GAGTGAGCAGTGAGTGAGGAGGG + Intergenic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179487112 21:41717431-41717453 CTCCGTCCAGTGAGTGAGGAGGG - Intergenic
1179884444 21:44307551-44307573 CAGTGAGCAGTGAGGGGGGTGGG - Intronic
1179934376 21:44592882-44592904 CTGTGTCCGGTGATGGGGGAAGG - Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181342746 22:22195824-22195846 ACCTGTGCAGTGAGCGAGGAGGG - Intergenic
1181806242 22:25376005-25376027 CTGCCTGCAGTCAGGGAGGCGGG + Intronic
1181832412 22:25571652-25571674 CCATGTGCTCTGAGGGAGGAGGG + Intronic
1181929485 22:26388624-26388646 CTCTGAGCAGTGAGGGAGCTGGG + Intergenic
1183261495 22:36798578-36798600 CTGTGTGGAATGCAGGAGGAGGG - Intergenic
1183300206 22:37055237-37055259 CCTGGAGCAGTGAGGGAGGAAGG + Intronic
1183316476 22:37139794-37139816 CTGTGTGCATTGAGGGGCTAAGG - Intronic
1183647002 22:39132745-39132767 GTGTGGGCAGTCAGGGAGGGAGG - Exonic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1183952279 22:41358484-41358506 CTGTGTGAGGTGTGGGAGGTGGG + Exonic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
1184515140 22:44957096-44957118 CTGTGAGCTCAGAGGGAGGAGGG - Intronic
1184564939 22:45286142-45286164 CTGTCTGCAGGGAGGAGGGAAGG + Intronic
1184602550 22:45552178-45552200 GTGTGTGCTAGGAGGGAGGAGGG + Intronic
1184835652 22:47019557-47019579 GGGTGTGCAGGGAGGGAGGATGG + Intronic
1184944590 22:47794114-47794136 AGGTGTGAAGGGAGGGAGGAAGG - Intergenic
1185051199 22:48555177-48555199 CCGAGTGAAGGGAGGGAGGATGG + Intronic
1185409789 22:50675478-50675500 GTGTGTGCAGTGAGCGGGCAGGG + Intergenic
949483740 3:4518160-4518182 CTGTGCACAGTCAAGGAGGAGGG - Intronic
950151981 3:10694842-10694864 CTGTCAGCAGAGAGGGAGGGGGG - Intronic
950486989 3:13279759-13279781 CTGTGTGCAGGTAGGGGGAAAGG + Intergenic
950551356 3:13668131-13668153 GTGTGTGCTGTGAGGAAGAAAGG + Intergenic
951432859 3:22628235-22628257 CCCTGTCCAGTGAGGGGGGATGG + Intergenic
952815865 3:37447236-37447258 CTCTCTGCAGTGAGGCAGGAGGG + Intergenic
952926854 3:38326607-38326629 TTGTGGGGAGTGAGGGAGGCAGG - Intergenic
953391348 3:42535692-42535714 CTGTGTGCAGTGAGTGGGGAGGG + Intronic
953407174 3:42665230-42665252 CTGTGTGGAGTGGGGCAGGCAGG + Exonic
953412115 3:42696527-42696549 CTGTCTGCAGCCTGGGAGGATGG - Intronic
954462988 3:50638264-50638286 CCCGGTGCAGGGAGGGAGGATGG + Intronic
954469032 3:50675484-50675506 CTCTGTGCAGAGAGGGCGGCAGG + Intronic
954680218 3:52341770-52341792 CTGAGTCAAGTGAGGAAGGATGG + Intronic
954801702 3:53190736-53190758 CTGTGTGCCCTGGTGGAGGAGGG - Intronic
956079322 3:65540846-65540868 CAGTCTGCTGTGAGAGAGGAAGG + Intronic
956661364 3:71601577-71601599 CTGACTGCAATGAGGGAGGAAGG + Intergenic
957079383 3:75623543-75623565 CTGTGTGCACTGGGGGGGGGGGG - Intergenic
959197520 3:103203560-103203582 CTATATGCAGTGAAGAAGGAAGG + Intergenic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
960733601 3:120753291-120753313 GTGTGTGTAGTAAGGAAGGAGGG + Intronic
960944764 3:122958401-122958423 CTGTCTGCAGTTTGGCAGGAAGG + Intronic
961088377 3:124089731-124089753 GTCAGGGCAGTGAGGGAGGATGG + Intronic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961653176 3:128427562-128427584 CTGTGGGCCATGAGGGAGGCTGG - Intergenic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
964621577 3:158724478-158724500 CTGTTTGCTTTGATGGAGGATGG + Intronic
965152632 3:164999395-164999417 CTGTGTTCAGTCAGAGAGAAAGG - Intronic
965475227 3:169147833-169147855 GTGTGTGCACCGAGGCAGGAGGG + Intronic
966216018 3:177503439-177503461 CATGGGGCAGTGAGGGAGGAAGG + Intergenic
966629012 3:182051088-182051110 GTGTGGGAAGTGAGGCAGGAAGG - Intergenic
966770600 3:183500350-183500372 GTGTGGCCAGGGAGGGAGGAAGG + Intronic
966962510 3:184954209-184954231 CAGTGTGCACTGAGAGAGCATGG - Intronic
967054279 3:185815087-185815109 ATGTATGCAGTGTGGGAGGAGGG - Intronic
967911176 3:194543735-194543757 CGGTGCTCAGTGGGGGAGGAGGG - Intergenic
968494911 4:910228-910250 CTGTGCTGAGTGAGGGAGGGTGG - Intronic
968602824 4:1518404-1518426 CTGTGGCCAGTGAAGGAGGCCGG + Intergenic
968615719 4:1576972-1576994 CAGTGTGCAGTGTGGGAGGGAGG - Intergenic
969311862 4:6357605-6357627 CTGTGTGCAGTAAAGAAGGGAGG - Intronic
969777981 4:9373924-9373946 ACATGTGCAGTGAGGGTGGAAGG - Intergenic
970535533 4:17026573-17026595 CCTTTTGCAGTGAGGGAGGGAGG + Intergenic
970740755 4:19234959-19234981 GTGTGTGAAGGGAGGAAGGATGG - Intergenic
971041671 4:22760187-22760209 CTATGTGCAGAGATGGGGGAGGG + Intergenic
971231800 4:24806282-24806304 CTGTGTGTAGTCAGCGGGGAGGG - Exonic
972018682 4:34280681-34280703 GTGTCTGCAGTGATGGATGAAGG + Intergenic
972452310 4:39214365-39214387 CTGTGTGCAGAGATGGGGGGCGG - Intronic
972921002 4:43941699-43941721 CAGTCTGCAGAGAGGCAGGAAGG - Intergenic
975170838 4:71230482-71230504 CTGTGTGAAGTGAGAGATTATGG + Intronic
975229391 4:71913647-71913669 TTGTGTGTAGTGAGTGAGGAGGG + Intergenic
976303077 4:83534025-83534047 ATCTTTGCAGTGATGGAGGAGGG - Intergenic
976846673 4:89496516-89496538 CTGTGTGCAGTGGGCTAAGAAGG + Intergenic
979993943 4:127408624-127408646 CTGTCTGTAGTGAGGTAGGGAGG - Intergenic
980652672 4:135740032-135740054 CTGTCAGCAGTGTGGGAGGCGGG - Intergenic
980731256 4:136826675-136826697 CAGAGTGCAGAGAGGTAGGAGGG - Intergenic
981894561 4:149782881-149782903 GAGTGTCCAGTGAGGGTGGAAGG - Intergenic
982539256 4:156647071-156647093 ATGTTTGAAGTGAGAGAGGAAGG - Intergenic
982636190 4:157899714-157899736 ATGTGTGGGCTGAGGGAGGAGGG + Intergenic
982677630 4:158394299-158394321 GTGTTTGAAGTGAAGGAGGAAGG + Intronic
982899650 4:160981838-160981860 CTGTGGGCATTGGGGGTGGAGGG + Intergenic
983551849 4:169025794-169025816 CAGTGAGCAGTGAGGGAGGACGG + Intergenic
985535587 5:464112-464134 CTGCGTGCAGCGTGGGAGGGAGG - Intronic
985535597 5:464164-464186 CTGCGTGCAGTGTGGGAGGGAGG - Intronic
985710661 5:1426775-1426797 GGGGCTGCAGTGAGGGAGGATGG + Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
986347490 5:6848352-6848374 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
986454228 5:7899552-7899574 CTGTGTGCTTTGAGAGTGGAGGG + Intronic
986831821 5:11588883-11588905 CGTGGTGCAGGGAGGGAGGAGGG - Intronic
988339247 5:29948916-29948938 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
988636882 5:32994539-32994561 GTGTGTGTAGAGAGGGAGGTAGG - Intergenic
989725948 5:44586982-44587004 ATGTGTGCAGGGATGGATGAGGG - Intergenic
990267913 5:54098414-54098436 TTGTGTGCTTTGACGGAGGATGG - Intronic
990996489 5:61737085-61737107 CAGGGTGCAGTTGGGGAGGAAGG + Intronic
992091632 5:73322838-73322860 CAGTGTGCAGTGACTGAGGAAGG + Intergenic
992529508 5:77640997-77641019 CTGTCTGGAGGGAGGGAGAAGGG + Intergenic
992645666 5:78808793-78808815 CTGTTTGCAGTGATGCTGGAGGG + Intronic
992847829 5:80771565-80771587 CTCTGAGAAGTGAGGGAGGCAGG + Intronic
993647166 5:90475244-90475266 CTGTTTGCAGTGAGTTAGAAGGG + Intronic
994513088 5:100733146-100733168 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
994767289 5:103934954-103934976 GTATCTGCAGTGAGGCAGGAGGG - Intergenic
997510709 5:134451903-134451925 CTGTGGCCAGCCAGGGAGGATGG + Intergenic
997665241 5:135625298-135625320 CTGTGTGCTGTGAAGATGGAGGG + Intergenic
997681804 5:135761755-135761777 GTGTGGGCAGTGGAGGAGGAGGG + Intergenic
998011991 5:138702854-138702876 CTGTGTGTTCTGAGGGAGTAAGG + Intronic
999127803 5:149259230-149259252 CTGGGAGCAGTGAGGGAGAGAGG - Exonic
1001032401 5:168272368-168272390 ATGTGTGGAGTGAGGGAGTGGGG - Intergenic
1001171230 5:169420783-169420805 AAGTGTCCAGTGAGGGATGACGG + Intergenic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001867194 5:175116077-175116099 CTGTGTGAAGTGAAGGAAGCTGG - Intergenic
1001897371 5:175393149-175393171 ATGTGTGCTGTGATGGAGGTGGG - Intergenic
1002190738 5:177476173-177476195 CTGTGAGGAGGGAGGGAGGGAGG - Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003127564 6:3367788-3367810 CTGGGTGCATTGATGGAGGCTGG - Intronic
1003266135 6:4566221-4566243 CTGTGTGCAGTGATGGAGAGTGG + Intergenic
1004294717 6:14400218-14400240 CTGTATCCTGGGAGGGAGGATGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1004856368 6:19755062-19755084 GTGTGTGCAATCAAGGAGGATGG - Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1006879948 6:37330890-37330912 CTGTGTACTGTTTGGGAGGAAGG + Intronic
1006903417 6:37517244-37517266 CTGAGGGCAGTCGGGGAGGAGGG + Intergenic
1006958673 6:37903016-37903038 CTGTGTGCAGTAATTTAGGATGG + Intronic
1007235984 6:40391896-40391918 CTGTGCGCAGGGTGGGAGAAGGG - Exonic
1007285535 6:40744758-40744780 CTGTGTGCAGACAAGGAGGCTGG - Intergenic
1007290878 6:40785821-40785843 CTGGGAGCAGTGAGTGGGGATGG - Intergenic
1007426186 6:41747673-41747695 ATGTGTGCATTTAGGGACGAGGG + Intronic
1007518252 6:42430376-42430398 CTTTTTGGAGTGAGGGAAGATGG - Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008463682 6:51805758-51805780 CTGGCTGCAGTGGGGGAGAATGG + Intronic
1008684295 6:53907091-53907113 CTCTGTGCAGTGAGTGTGGTAGG + Intronic
1008883832 6:56410564-56410586 CTGAGCGGGGTGAGGGAGGAGGG - Intergenic
1009589114 6:65643220-65643242 CTGTGGGCTGTGTGGGAGCAGGG + Intronic
1009784576 6:68318242-68318264 AAGTGTGCAGTGTGGGAGGAAGG - Intergenic
1010972268 6:82275561-82275583 CTCTGTCCAGAGTGGGAGGAGGG - Intergenic
1010991001 6:82479916-82479938 CTCTCTGCAGTGAGAGAGCAGGG + Intergenic
1011074242 6:83421008-83421030 CTGTATGCAGACAGGGAGGGGGG + Intronic
1012276849 6:97284468-97284490 GTGTGTGCAGAGAGAGAGGAGGG - Intergenic
1012988867 6:105904460-105904482 CATGGAGCAGTGAGGGAGGAAGG - Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1014206609 6:118662802-118662824 CTCTGTAGAGGGAGGGAGGAAGG + Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015891759 6:137976785-137976807 GTGTGTGTAGGGAGGCAGGATGG - Intergenic
1017368500 6:153674775-153674797 TTTTGTGAAGTGATGGAGGAGGG + Intergenic
1017577130 6:155817553-155817575 ATGCATGCAGTGAGGCAGGAGGG - Intergenic
1017720043 6:157237429-157237451 CCGTGTGCTGTGAGAGAGCAGGG - Intergenic
1017912460 6:158805859-158805881 CTGTGGGCAGGGATGGGGGAAGG - Intronic
1018134511 6:160766992-160767014 CTGTGAGAAGTGAGGGTTGAAGG - Intergenic
1018890132 6:167977067-167977089 CTGAGTGGGGGGAGGGAGGAGGG + Intergenic
1019197561 6:170291162-170291184 TTTTGTGTGGTGAGGGAGGAAGG - Intergenic
1019219864 6:170464744-170464766 TTGTGAGCAGAGTGGGAGGAAGG - Intergenic
1019344712 7:523564-523586 CTGTGTGCAGTGACGGCTGTGGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1019815380 7:3196119-3196141 CTGAGTGCTGGAAGGGAGGATGG - Intergenic
1020106788 7:5425909-5425931 CTGTGTGCCTTAGGGGAGGAGGG + Intergenic
1021021026 7:15599225-15599247 CTGGCTGCAGTGAGGCAGGCTGG + Intergenic
1021159886 7:17259811-17259833 CTGTGTGCCCTGAGGGAGACAGG - Intergenic
1022509463 7:30925938-30925960 GTGAGTGGAGGGAGGGAGGAAGG - Intergenic
1022865037 7:34408986-34409008 CTGTATGCATTGAGGCAGCAGGG + Intergenic
1023158500 7:37275275-37275297 CTGGGTGCTGGGTGGGAGGAGGG + Intronic
1023467835 7:40477301-40477323 CTGGGTGGAGTTAGGGAGGGTGG + Intronic
1023741879 7:43288309-43288331 CCGGGAGCAGGGAGGGAGGAAGG + Intronic
1024089657 7:45924730-45924752 CTGTGTGCCTGGAGGGACGAGGG + Intergenic
1024356035 7:48414268-48414290 CAGAGTGCAGTGAGGGCGGGTGG - Intronic
1024471959 7:49774538-49774560 AGGTGTGCAGTGCGGGAGGCTGG - Intronic
1026471087 7:70694515-70694537 ATGTGCGGAGGGAGGGAGGAGGG - Intronic
1026826052 7:73582263-73582285 CTGTGGGCAGTGGGGTAGGGAGG + Intergenic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028128204 7:87139470-87139492 TGGTATGCAGTGAGGAAGGAAGG - Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1030688591 7:112510415-112510437 ATGAGAGTAGTGAGGGAGGAAGG + Intergenic
1031552131 7:123128022-123128044 TTGTGTGAAGTGAGGGGGAAGGG - Intronic
1031894555 7:127334040-127334062 TTGTGTGCAGTGAGAGATAAGGG - Intergenic
1032517466 7:132517809-132517831 CTGAGGGCAGTGAGGGAGTTGGG + Intronic
1032529334 7:132607329-132607351 TGGTGAGCAGTGAGGCAGGAGGG - Intronic
1032675868 7:134129269-134129291 CAGAGTGGAGGGAGGGAGGAAGG - Intronic
1032858966 7:135859800-135859822 CTGTGTGCAGTGAGGTTGAGAGG + Intergenic
1034450249 7:151133427-151133449 CCGAGTGCAGGGAGGGAGGGTGG - Intronic
1034960557 7:155361853-155361875 GAGAGAGCAGTGAGGGAGGACGG + Intronic
1034981954 7:155484774-155484796 CTGTAGGCAGTGAGGGCTGAAGG - Intronic
1035164883 7:156981173-156981195 CTGTGTACTGTTTGGGAGGAGGG + Intergenic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1035939306 8:3878106-3878128 ATGTGGGCAGGGAAGGAGGAAGG - Intronic
1036275436 8:7347894-7347916 ACATGTGCAGTGAGGGTGGAAGG - Intergenic
1036345921 8:7962464-7962486 ACATGTGCAGTGAGGGTGGAAGG + Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036841245 8:12123217-12123239 ACATGTGCAGTGAGGGTGGAAGG + Intergenic
1036863054 8:12369469-12369491 ACATGTGCAGTGAGGGTGGAAGG + Intergenic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1038158080 8:25009668-25009690 CTGTGAGCAGAGAGGGAGATGGG - Intergenic
1038692264 8:29774177-29774199 CTGTGGGCATTGGGGGAGGGAGG - Intergenic
1038807174 8:30805110-30805132 CTGTGGGCAGTGAAGAAGAAAGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039390673 8:37178791-37178813 CAGTGCTCAGTGAAGGAGGAGGG + Intergenic
1039771691 8:40694201-40694223 CTGCAGGCAGTAAGGGAGGATGG + Intronic
1040640643 8:49330298-49330320 CGTGGAGCAGTGAGGGAGGAAGG - Intergenic
1040912533 8:52534744-52534766 GTGTGTGCAGAGGGGCAGGAAGG + Intronic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1042873501 8:73419353-73419375 CTGTGAGCAGGTAGAGAGGATGG + Intergenic
1043130489 8:76454944-76454966 CTGTGCTCAGTGAGGAGGGAGGG + Intergenic
1043362410 8:79490271-79490293 CTGTGGGCAGTGGGGGAGAAAGG + Intergenic
1043567200 8:81561624-81561646 CTGTGTGCATGGGGGAAGGAGGG + Intergenic
1043980071 8:86627752-86627774 TTGTGTGCCCTGAGGCAGGATGG + Intronic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044820671 8:96153849-96153871 CCGTGTGCAGTCTGGGAGGAAGG + Intronic
1045535925 8:103027835-103027857 GTGTGTGCAGGGAGGGTGGGAGG - Intronic
1045948842 8:107829074-107829096 GAGCTTGCAGTGAGGGAGGAAGG + Intergenic
1046193282 8:110827512-110827534 ATGTGTGTGGTGTGGGAGGAGGG - Intergenic
1046919390 8:119712035-119712057 CATGGAGCAGTGAGGGAGGAAGG + Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047896585 8:129373222-129373244 AAGGCTGCAGTGAGGGAGGAGGG - Intergenic
1048033454 8:130654431-130654453 CTGTTTGTAGTGAGGGATGCTGG + Intergenic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048167390 8:132075628-132075650 TTGTTGGCAGTGAAGGAGGAAGG - Intronic
1048332463 8:133480041-133480063 AAGTGTGCGGTGAGGGAGGCCGG + Intronic
1048441258 8:134460792-134460814 GTGTGTGCGGTGTGGGAGGGTGG + Intergenic
1048577769 8:135706444-135706466 CTGTGTGTAGTTTGGGAGGTAGG - Intergenic
1049537187 8:143187899-143187921 CTGCCTGCAGTGAGGGAAGGTGG + Intergenic
1049577384 8:143396009-143396031 GTGTGGGGAGTTAGGGAGGAGGG + Intergenic
1049851859 8:144836848-144836870 CAGTCTGCAGCGAGGGAGGCAGG + Intronic
1050353421 9:4761495-4761517 CTGAGAGCAGTGTGGGAGGCTGG - Intergenic
1051243058 9:15080552-15080574 CTGTGGGCAGTGAGGCATAAAGG - Intergenic
1051342179 9:16121523-16121545 CGGTGTGCAGAGAGGGTGGGGGG + Intergenic
1051369630 9:16347320-16347342 CAATGTGCAGTGAGGGATCATGG - Intergenic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1052067033 9:24034660-24034682 CTATGTCCAGGGAGGGAGGAAGG + Intergenic
1053165522 9:35841383-35841405 CTCTGTGCTGGGAGGGAGGGAGG - Intronic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1056438757 9:86598832-86598854 CTGTGTGGGGTGGGGTAGGAGGG - Intergenic
1056544973 9:87605961-87605983 GTGAGTGCCTTGAGGGAGGAGGG + Intronic
1056580765 9:87886961-87886983 CTGGGTGCAGGGATGGAGGAAGG - Exonic
1056815658 9:89799036-89799058 GTGTGTGGTGTGAGGGAGGCAGG + Intergenic
1056884169 9:90424107-90424129 GAGTGTGCAGTGAAGGGGGAAGG - Intergenic
1056887314 9:90455873-90455895 TTGGCTGCAGTGAGGAAGGAAGG - Intergenic
1056911718 9:90707049-90707071 CAGTGTGCAGTGCAGGAGGAAGG + Intergenic
1057292103 9:93813339-93813361 CAGAGTCCAGTGAGGGAGGGAGG - Intergenic
1057310096 9:93937354-93937376 AAGTGTGCAGGGAGGGAGGGTGG + Intergenic
1057516781 9:95728926-95728948 CCGTGTGCGGTGAAGGAGCAGGG + Intergenic
1057702886 9:97376379-97376401 CTGAGTTCAGTGAGGGTGGGAGG + Intronic
1058983127 9:110188453-110188475 ACGTCTGCAGTGAGGAAGGACGG - Intergenic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1060048307 9:120358573-120358595 TTGTGTCCACTGAGAGAGGAAGG - Intergenic
1060056026 9:120413793-120413815 ATGGGCGCAGTGAGCGAGGAGGG + Intronic
1060236040 9:121863245-121863267 CTGGGTTCTGTGGGGGAGGATGG + Intronic
1060882930 9:127131108-127131130 CTGTGGGCTGTGGGGGTGGAGGG + Intronic
1061541096 9:131278100-131278122 CTGTGTGCGGGGAGCGAGGGTGG - Intergenic
1061544833 9:131298621-131298643 CTATGTGCACTGCGGGAAGAGGG - Intronic
1061563448 9:131421581-131421603 CTGGGGGCAGTGAGAGAGAAAGG - Intronic
1061726966 9:132587319-132587341 GTGTCCGCAGTGAAGGAGGAGGG + Exonic
1061736682 9:132665550-132665572 CTCTGAGCAGAGAGGGAGCAAGG + Intronic
1061838028 9:133342058-133342080 GTTTCTGCAGTCAGGGAGGAGGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062177796 9:135173847-135173869 CTGCGGGCTGTGAGGGAGAAGGG + Intergenic
1062222446 9:135424557-135424579 ATGTGTGCAGGGGGGGCGGAGGG + Intergenic
1062285236 9:135769924-135769946 CTGCGGGCAGTGGGGGAGGCCGG - Intronic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1062549887 9:137081088-137081110 CTCAGTGCACTGAGGGAGGCAGG + Intronic
1185859570 X:3565006-3565028 GTGAGTGCAGCGAGGGATGAAGG + Intergenic
1186038451 X:5449565-5449587 CTGTGTGTGGGGAGGGAGGTGGG - Intergenic
1186801090 X:13092929-13092951 CAGTGGGCAGTGAGGGGGCAGGG + Intergenic
1186852705 X:13596324-13596346 CATGGAGCAGTGAGGGAGGAAGG - Intronic
1187556236 X:20354805-20354827 GTGGGTGAAGTGAGGAAGGAGGG + Intergenic
1187814068 X:23211852-23211874 GTGGGTGCAGTGAGGGAGAAGGG - Intergenic
1188644892 X:32553775-32553797 CTGTCTTCAGTGTTGGAGGAAGG + Intronic
1189171647 X:38915221-38915243 CTGTGAGCTGAGAGTGAGGAGGG + Intergenic
1189922558 X:45916719-45916741 CTGTGTTCTGTGAGGGATAAAGG + Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1192208003 X:69108851-69108873 ATTTGTGCAGTGAGAGAGGCTGG - Intergenic
1192428860 X:71099334-71099356 ATGTCACCAGTGAGGGAGGAAGG + Intronic
1193570442 X:83134963-83134985 GAGTGTGGAGGGAGGGAGGAGGG + Intergenic
1194193095 X:90860851-90860873 CTATATGCAGTGGGGGAGAAAGG + Intergenic
1194792445 X:98167732-98167754 CAGAGTGCAGTGGGAGAGGATGG + Intergenic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1195965648 X:110427889-110427911 CTGGGTGAAGGGAGGGAGGAAGG - Intronic
1196309651 X:114148609-114148631 CAGTGGGCTGTGAGGGATGAAGG + Intergenic
1196398210 X:115288579-115288601 CCGGGTGTGGTGAGGGAGGAAGG + Intergenic
1196401636 X:115323234-115323256 TAGTGTGCAGGGTGGGAGGAGGG + Intergenic
1197120056 X:122880523-122880545 CTGTGGGCTGTGTGGGAGCAGGG + Intergenic
1197424374 X:126277131-126277153 CTGTGTTCATTGATGGATGAAGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198507073 X:137311541-137311563 GAGTGTGCAGAGTGGGAGGAGGG - Intergenic
1200064755 X:153498963-153498985 CTGTGTGCATTGGGAGAGGGTGG + Intronic
1200255715 X:154581554-154581576 CTTTGTGCAGTGAGGGATCTTGG - Intergenic
1200262054 X:154622850-154622872 CTTTGTGCAGTGAGGGATCTTGG + Intergenic
1200539708 Y:4443301-4443323 CTATATGCAGTGTGGGAGAAAGG + Intergenic
1200841156 Y:7783006-7783028 CAGTCTGCAGTGAGGCCGGATGG + Intergenic
1200862333 Y:8006290-8006312 TTGTGGGCAGTGTGGTAGGACGG + Intergenic
1201633035 Y:16091256-16091278 CTGTGTGTGGGGAGGGAGGTGGG + Intergenic