ID: 1143034916

View in Genome Browser
Species Human (GRCh38)
Location 17:3989275-3989297
Sequence CTGGCTCTCCACAGGCATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143034907_1143034916 28 Left 1143034907 17:3989224-3989246 CCTCGGCTTGGCTGTGGCGGGGG No data
Right 1143034916 17:3989275-3989297 CTGGCTCTCCACAGGCATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143034916 Original CRISPR CTGGCTCTCCACAGGCATTG GGG Intergenic
No off target data available for this crispr