ID: 1143036966

View in Genome Browser
Species Human (GRCh38)
Location 17:4004987-4005009
Sequence ACAGCGGCGGCCACTGCCAT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143036963_1143036966 -4 Left 1143036963 17:4004968-4004990 CCTGACGGGAGGATGGAGTACAG 0: 1
1: 0
2: 1
3: 22
4: 211
Right 1143036966 17:4004987-4005009 ACAGCGGCGGCCACTGCCATAGG 0: 1
1: 0
2: 0
3: 9
4: 112
1143036958_1143036966 21 Left 1143036958 17:4004943-4004965 CCAGCGTTTATTTACAGCTGATC 0: 1
1: 0
2: 0
3: 3
4: 60
Right 1143036966 17:4004987-4005009 ACAGCGGCGGCCACTGCCATAGG 0: 1
1: 0
2: 0
3: 9
4: 112
1143036957_1143036966 22 Left 1143036957 17:4004942-4004964 CCCAGCGTTTATTTACAGCTGAT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1143036966 17:4004987-4005009 ACAGCGGCGGCCACTGCCATAGG 0: 1
1: 0
2: 0
3: 9
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143036966 Original CRISPR ACAGCGGCGGCCACTGCCAT AGG Exonic
900659295 1:3774771-3774793 ACAGCTGCTGCCACTGCCTGGGG + Intronic
902227848 1:15007948-15007970 ACAGAGGCGGCCCCTGCGAGTGG + Intronic
902355233 1:15893757-15893779 ACGGCGGGAGCCACTGCAATTGG - Intronic
907051053 1:51330277-51330299 GCAGCGGCGGCGGCTGCCAGGGG + Intronic
918689748 1:187465900-187465922 ACAGCTGTGGCCACTCCCATAGG - Intergenic
920683695 1:208092861-208092883 ACAGCGCCTTCCGCTGCCATTGG - Exonic
922411489 1:225380210-225380232 AAAGCGGCTGCCACTGACAGTGG + Intronic
924198966 1:241640216-241640238 GCAGCGGCGGCCACGGCTACTGG - Exonic
1063130410 10:3172877-3172899 ACAGCGACGTCCTCTGCGATAGG + Intergenic
1067513017 10:46911248-46911270 ACAGCGGCGTCCGCGGCGATGGG + Intergenic
1067649231 10:48140574-48140596 ACAGCGGCGTCCGCGGCGATGGG - Intergenic
1069836590 10:71313066-71313088 CCAGCCGAGGCCACAGCCATGGG + Intergenic
1070932532 10:80271506-80271528 CCAGAGGTGGCCACTGCCTTTGG + Intergenic
1076003972 10:126933273-126933295 ACAGCGGCAGCCTCTCCCAGTGG + Intronic
1082814602 11:57499731-57499753 CCAGCGCCGGACCCTGCCATTGG + Intronic
1084273693 11:68041499-68041521 ACCCCAGCGGCCCCTGCCATGGG + Intronic
1085020176 11:73201675-73201697 ACAGCGTCCGACACTGCCATGGG + Intergenic
1085225400 11:74915517-74915539 TCAGCAGTGGCCTCTGCCATTGG - Intronic
1088883047 11:113986692-113986714 ACGCTGCCGGCCACTGCCATCGG + Exonic
1091653460 12:2326539-2326561 AGAGGGGCTGCCACTGCCCTTGG + Intronic
1097164037 12:57072750-57072772 ACAGAAGCTGCCACTGCCAGAGG + Intronic
1097287785 12:57890914-57890936 ACAGCAGCTGCCACTGGAATAGG - Intergenic
1102429430 12:112870403-112870425 ACAGCAGAGGCCATTGCCAAGGG - Intronic
1102804294 12:115765756-115765778 ACATCGGCAGCCACTGTCCTGGG - Intergenic
1102945993 12:116988702-116988724 CCAGCAGCGGCTACTGCCACAGG - Exonic
1103946144 12:124527782-124527804 ACTGCTGCTGTCACTGCCATGGG + Intronic
1104796779 12:131525865-131525887 GCAGCGGCGGCCGCTGTCCTAGG + Intergenic
1105241428 13:18612154-18612176 ACAGCTCTGGCCTCTGCCATGGG - Intergenic
1105418272 13:20231910-20231932 CGGGCGGCGCCCACTGCCATCGG + Intronic
1105492573 13:20902831-20902853 ACAGCGGCTGCGACGGCCCTGGG - Intronic
1108880058 13:55101795-55101817 ACAGTGGCAGCCACTGTTATTGG - Intergenic
1113375549 13:109762233-109762255 GCAGCAGCCGCCAATGCCATAGG + Intronic
1119178130 14:72584650-72584672 AAAGCGCCAGCCTCTGCCATGGG + Intergenic
1121465987 14:94115873-94115895 TCCGCGGCGGCCATTGCCAATGG + Exonic
1122061218 14:99137842-99137864 ACAGCAGCTGGCACTGCCCTGGG - Intergenic
1122614529 14:103007950-103007972 ACAGCCGCGTGCTCTGCCATTGG - Intronic
1123489931 15:20772996-20773018 ACAGCTCTGGCCTCTGCCATGGG + Intergenic
1123546430 15:21342083-21342105 ACAGCTCTGGCCTCTGCCATGGG + Intergenic
1124240502 15:28024208-28024230 ACAGCACCGCCCACTGCCATGGG + Intronic
1132255598 15:100373584-100373606 ACAGCCGCGGCCTCGGCCGTGGG - Intergenic
1202954757 15_KI270727v1_random:69298-69320 ACAGCTCTGGCCTCTGCCATGGG + Intergenic
1138516041 16:57536077-57536099 AGAGCCGCGGCGACTGCCAATGG - Intronic
1139175142 16:64678318-64678340 ACAGAGTTGGCCACAGCCATAGG + Intergenic
1139593122 16:67944062-67944084 GCAGCGTCACCCACTGCCATGGG + Exonic
1141410301 16:83828548-83828570 CCAGAGGCGGGCACTGCCATTGG - Intergenic
1143036966 17:4004987-4005009 ACAGCGGCGGCCACTGCCATAGG + Exonic
1143798328 17:9356710-9356732 AGAGAGGCTGCCACTGCCATGGG - Intronic
1149674533 17:58447461-58447483 GCACCGGCTGCCACAGCCATGGG + Intronic
1150624823 17:66835099-66835121 GCGGCGGCGGCCACGGTCATTGG + Exonic
1150746702 17:67822776-67822798 AAAGCGGGGGGCACTTCCATTGG - Intergenic
1151767873 17:76141329-76141351 ACAGCTTCCGCCTCTGCCATTGG + Intergenic
1151780229 17:76240520-76240542 ACCGCGGCGGCCCCAGCCAATGG + Intergenic
1152845286 17:82596042-82596064 ACAGCCGGGGCCACTGCGGTAGG - Intronic
1154017323 18:10630595-10630617 AAAGCTGGGGCCACTCCCATTGG + Intergenic
1154187538 18:12199002-12199024 AAAGCTGGGGCCACTCCCATTGG - Intergenic
1154447531 18:14447752-14447774 ACAGCTCTGGCCTCTGCCATGGG + Intergenic
1158197947 18:54909695-54909717 ACAGCGCCGGGTACTGGCATGGG + Intronic
1158476233 18:57782099-57782121 ACATGGGAGGCCTCTGCCATAGG + Intronic
1158652645 18:59301343-59301365 ACATCTGAGGCCACTGCCCTGGG - Intronic
1160775649 19:854066-854088 ACAGAGGCGGCCCCTGCCCTGGG - Intronic
1161110281 19:2465588-2465610 ACAGAGGCTGCCACTCCCCTGGG - Intergenic
1165994297 19:39833444-39833466 ACAGCAGCCGCCACTGCCACCGG + Exonic
1167045779 19:47048045-47048067 ACAGTGGTGGCCTCTGCAATCGG + Intronic
929087104 2:38179159-38179181 ACAGTGGTGGCCACTGCGTTTGG - Intergenic
936757905 2:115736748-115736770 TCAGCGATGGCCACTACCATTGG + Intronic
938127809 2:128687055-128687077 AGGGCTGCTGCCACTGCCATGGG + Intergenic
938562751 2:132489282-132489304 ACAGCGCCGGCGCCTGCCAATGG - Intronic
943180321 2:184531442-184531464 AAACCGGCTACCACTGCCATCGG + Intergenic
947808042 2:232982042-232982064 ACAGGGGAGGCCACAGCCCTGGG + Intronic
948473945 2:238204249-238204271 AGAAAGGCGGCCACTGACATCGG + Intergenic
1175399752 20:58693388-58693410 GCAGCTGGGGACACTGCCATGGG - Intronic
1176241800 20:64078898-64078920 AAAGCGGCAGCCACTCCCAAGGG - Intronic
1176448669 21:6842914-6842936 ACAGCTCTGGCCTCTGCCATGGG - Intergenic
1176826839 21:13707937-13707959 ACAGCTCTGGCCTCTGCCATGGG - Intergenic
1179821517 21:43939925-43939947 ACAGCTGCGGGCTCTGCCGTCGG - Intronic
1179931737 21:44575214-44575236 GGAGGGGAGGCCACTGCCATGGG - Exonic
1180729591 22:17971666-17971688 ACAGTGGTGGACACAGCCATCGG + Intronic
1181447037 22:22985127-22985149 GCAGCTGCCTCCACTGCCATGGG - Intergenic
1181941858 22:26483888-26483910 GCAGCTGCGGCCGCAGCCATTGG - Exonic
1182088060 22:27575023-27575045 AGAGTGGCGGCCACTGCCTGGGG - Intergenic
956604275 3:71056504-71056526 ACAGCAGCAGGCACTGCCAAAGG + Intronic
959006457 3:101025941-101025963 ACAGCTGCAGCCTCTCCCATAGG - Intergenic
961318123 3:126054529-126054551 ACAGGGGTGGCCGCTGTCATGGG - Intronic
961715397 3:128853993-128854015 CCAGTGGTGGCCTCTGCCATGGG + Intergenic
969471772 4:7393257-7393279 ACAGCTCCGGCCATTGCCAAGGG - Intronic
969665263 4:8553690-8553712 AAAGCTGCTGCCAATGCCATTGG - Intergenic
980053800 4:128061556-128061578 GCAGCGGCGGCCACGGCCGCCGG + Intronic
983222834 4:165059145-165059167 AGAGCTGCTGCCACTGCCATTGG - Intergenic
985535713 5:464807-464829 ACAGCAGCAGCCACTGACACGGG + Intronic
985908663 5:2862459-2862481 ACAGCAGCAGCCACAGCCACAGG + Intergenic
986723392 5:10576826-10576848 AAAGTGGCAGCCAGTGCCATGGG + Intronic
986885131 5:12225456-12225478 ACTGCAGTGGCCACTGCCACTGG + Intergenic
1006641386 6:35491483-35491505 ACAAGGGAGGCCACTGCCAGGGG + Intronic
1007430762 6:41775432-41775454 ACATCGGCGGCCACTCTCAAAGG + Exonic
1007809726 6:44477195-44477217 ACAGCATCGGCCACTTCCACAGG + Intergenic
1007993402 6:46281015-46281037 ACAGCATTGGCCTCTGCCATAGG - Intronic
1014095184 6:117452367-117452389 ACAGCTGTGGCCCCTGCCCTAGG + Intronic
1017148008 6:151252115-151252137 ACAGCAGAGACCACTGGCATTGG + Intronic
1017750514 6:157486923-157486945 GCAACAGCAGCCACTGCCATAGG - Intronic
1018465435 6:164040082-164040104 ATAGCGGCAGCCACAGCCACAGG - Intergenic
1023877133 7:44292951-44292973 ACAGCAGCAGCCACTGCCCTGGG + Intronic
1025764804 7:64433813-64433835 ACAGCGGCAGCCGCTCCCACAGG - Intergenic
1026480377 7:70773689-70773711 ACAGTGGCAGTCCCTGCCATGGG + Intronic
1028241383 7:88425299-88425321 ACTGAGGTGGCCACTGGCATGGG + Intergenic
1029118682 7:98252078-98252100 GCAGCGGCGGCCAGGGCCGTGGG - Intronic
1035590901 8:812283-812305 ACAACCGTGCCCACTGCCATAGG - Intergenic
1035687345 8:1535173-1535195 ACAGAGGCGGCCACTACCCCTGG - Intronic
1037337067 8:17801624-17801646 TCAGCGGCTGCCACTGCCGCCGG + Intergenic
1037884844 8:22590479-22590501 ACAGCAGCGCTCACTTCCATGGG - Intronic
1038566354 8:28622760-28622782 CCAGCGGCGGCCACTGCAGCCGG - Intronic
1047088293 8:121544052-121544074 ACAGGGGAGTCTACTGCCATTGG + Intergenic
1047862618 8:128984932-128984954 ACAGCTGCTGCCACTACCAAAGG - Intergenic
1049111074 8:140643799-140643821 ACAGGTGCGCCCACTGCAATGGG - Intergenic
1050644201 9:7701922-7701944 ACCGCTGTGGCCACTACCATTGG + Intergenic
1053620524 9:39809760-39809782 ACAGTGGTGGCCACCGCCACTGG + Intergenic
1060768168 9:126310500-126310522 ACAGCGCCCGCCACTGCCCCTGG + Intergenic
1061725549 9:132580371-132580393 TCGGCGGCGGCCACTGCAGTGGG - Intergenic
1203520520 Un_GL000213v1:41603-41625 ACAGCTCTGGCCTCTGCCATGGG + Intergenic
1190216302 X:48481622-48481644 ACAGCGAAGGCCTCTGCCAGGGG - Exonic
1194142617 X:90223378-90223400 GCAGCAGCGGGCACTGACATAGG - Intergenic
1198727252 X:139691233-139691255 ACAGCTGCTGCCACTGACTTGGG - Intronic
1200488373 Y:3792479-3792501 GCAGCAGCGGGCACTGACATAGG - Intergenic